ABCMdb

PMID: 19188174

Einstein MH, Leanza S, Chiu LG, Schlecht NF, Goldberg GL, Steinberg BM, Burk RD
Genetic variants in TAP are associated with high-grade cervical neoplasia.
Clin Cancer Res. 2009 Feb 1;15(3):1019-23., [PubMed]

Sentences

No. Mutations Sentence Comment

45 ABCB2 p.Ile379Val Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment 46 ABCB2 p.Ile379Val Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment 48 ABCB2 p.Ile379Val For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment 49 ABCB2 p.Ile379Val For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment 52 ABCB2 p.Ile379Val The SNPs I333V, I379V, A665T, and Q687STOP were simultaneously amplified in a 25 AL multiplex PCR using primer sets previously reported (11). Login to comment 53 ABCB2 p.Ile379Val ABCB2 p.Ile379Val Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment 56 ABCB2 p.Ile379Val For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment 60 ABCB2 p.Ile379Val The SNPs I333V, I379V, A665T, and Q687STOP were simultaneously amplified in a 25 AL multiplex PCR using primer sets previously reported (11). Login to comment 95 ABCB2 p.Ile379Val Oligonucleotide probe sequences (5&#b6;-3&#b6;) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment 96 ABCB2 p.Ile379Val Oligonucleotide probe sequences (5&#b6;-3&#b6;) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment 103 ABCB2 p.Ile379Val Oligonucleotide probe sequences (5¶-3¶) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment 108 ABCB2 p.Ile379Val For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment 110 ABCB2 p.Ile379Val For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment 117 ABCB2 p.Ile379Val For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment 122 ABCB2 p.Ile379Val Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment 123 ABCB2 p.Ile379Val Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment 124 ABCB2 p.Ile379Val Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment 125 ABCB2 p.Ile379Val Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment 131 ABCB2 p.Ile379Val Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment 132 ABCB2 p.Ile379Val Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment