ABCA4 p.Ser1185Ala
| Predicted by SNAP2: | A: D (53%), C: D (63%), D: D (59%), E: D (53%), F: D (75%), G: N (53%), H: D (53%), I: D (66%), K: D (53%), L: D (71%), M: D (71%), N: N (66%), P: D (63%), Q: D (53%), R: D (59%), T: N (66%), V: D (66%), W: D (85%), Y: D (66%), |
| Predicted by PROVEAN: | A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, T: N, V: N, W: D, Y: N, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Posttranslational modifications of the photorecept... Biochemistry. 2011 Aug 16;50(32):6855-66. Epub 2011 Jul 8. Tsybovsky Y, Wang B, Quazi F, Molday RS, Palczewski K
Posttranslational modifications of the photoreceptor-specific ABC transporter ABCA4.
Biochemistry. 2011 Aug 16;50(32):6855-66. Epub 2011 Jul 8., [PMID:21721517]
Abstract [show]
ABCA4 is a photoreceptor-specific ATP-binding cassette transporter implicated in the clearance of all-trans-retinal produced in the retina during light perception. Multiple mutations in this protein have been linked to Stargardt disease and other visual disorders. Here we report the first systematic study of posttranslational modifications in native ABCA4 purified from bovine rod outer segments. Seven N-glycosylation sites were detected in exocytoplasmic domains 1 and 2 by mass spectrometry, confirming the topological model of ABCA4 proposed previously. The modifying oligosaccharides were relatively short and homogeneous, predominantly representing a high-mannose type of N-glycosylation. Five phosphorylation sites were detected in cytoplasmic domain 1, with four of them located in the linker "regulatory-like" region conserved among ABCA subfamily members. Contrary to published results, phosphorylation of ABCA4 was found to be independent of light. Using human ABCA4 mutants heterologously expressed in mammalian cells, we showed that the Stargardt disease-associated alanine mutation in the phosphorylation site at position 901 led to protein misfolding and degradation. Furthermore, replacing the S1317 phosphorylation site reduced the basal ATPase activity of ABCA4, whereas an alanine mutation in either the S1185 or T1313 phosphorylation site resulted in a significant decrease in the all-trans-retinal-stimulated ATPase activity without affecting the basal activity, protein expression, or localization. In agreement with this observation, partial dephosphorylation of native bovine ABCA4 led to reduction of both basal and stimulated ATPase activity. Thus, we present the first evidence that phosphorylation of ABCA4 can regulate its function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
79 T901A, S1185A, T1313A, and S1317A mutations were introduced by overlap extension polymerase chain reaction using Pfu DNA polymerase and the following mutagenic primers (with introduced mutations shown in bold): T901Af, gagcccctagccgaggaaacg; T901Ar, cgtttcctcggctaggggctc; S1185Af, ctaagggtttcgccac- cacgtgt; S1185Ar, acacgtggtggcgaaacccttag; T1313Af, gctgga- caggccccccaggac; T1313Ar, gtcctggggggcctgtccagc; S1317Af, gacaccccaggacgccaatgtctgc; S1317Ar, gcagacattggcgtcctgggg- tgtc.
X
ABCA4 p.Ser1185Ala 21721517:79:7
status: NEW81 S1185A, T1313A, and S1317A were constructed with ABCA4 FseI-Fwd (agatttttgagccctgtggc) and ABCA4-Sbf I-rev (ccctggtgctgcacctgc) primers and subcloned into the FseI and SbfI sites.
X
ABCA4 p.Ser1185Ala 21721517:81:0
status: NEW187 To reveal possible biological roles of ABCA4 phosphorylation, we created ABCA4 constructs with alanine mutations in the most conserved phosphorylation sites, namely, T901A, S1185A, T1313A, and S1317A.
X
ABCA4 p.Ser1185Ala 21721517:187:173
status: NEW189 The S1185A, T1313A, and, to a lesser extent, S1317A mutants localized to intracellular vesicles like wild-type ABCA445 and demonstrated comparable expression levels (Figure 5A,B).
X
ABCA4 p.Ser1185Ala 21721517:189:4
status: NEW191 Basal ATPase activities of the S1185A and T1313A mutants were identical to that of wild-type ABCA4 (Table 1).
X
ABCA4 p.Ser1185Ala 21721517:191:31
status: NEW193 In the presence of 50 μM all-trans-retinal, the ATPase activity of S1185A and T1313A mutants was increased by only 60 and 100%, respectively, relative to the roughly 150% stimulation observed for the wild-type protein.
X
ABCA4 p.Ser1185Ala 21721517:193:73
status: NEW227 These results agree well with the reduced levels of basal or all-trans-retinal-stimulated activity shown for S1317A or S1185A and T1313A mutants, respectively, of ABCA4 expressed in mammalian cells (Table 1).
X
ABCA4 p.Ser1185Ala 21721517:227:119
status: NEW255 WT and mutants S1185A, T1313A, and, to a lesser extent, S1317A localize to intracellular vesicles.
X
ABCA4 p.Ser1185Ala 21721517:255:15
status: NEW259 Basal and All-trans-Retinal-Stimulated Activity of Human ABCA4 Variants with Mutated Phosphorylation Sites sample basal activity (nmol mg-1 min-1 ) retinal-stimulated activity (nmol mg-1 min-1 ) wild-type 37.5 ± 1.1 91.7 ± 1.5 S1185A 39.0 ± 1.4 61.6 ± 2.2 T1313A 37.5 ± 1.6 74.5 ± 2.4 S1317A 8.5 ± 0.9 13.5 ± 1.1 Figure 6.
X
ABCA4 p.Ser1185Ala 21721517:259:237
status: NEW298 The S1185A, T1313A, and S1317A mutants localized to intracellular vesicles (Figure 5B), suggestive of nativelike folding, although the lower expression level of T1317A could indicate possible destabilization.
X
ABCA4 p.Ser1185Ala 21721517:298:4
status: NEW300 In contrast, the S1185A and T1313A mutants demonstrated native levels of basal ATPase activity, but their all-trans-retinal-stimulated ATPase activities were reduced 1.5-and 1.2-fold, respectively (Table 1).
X
ABCA4 p.Ser1185Ala 21721517:300:17
status: NEW