ABCA4 p.Ser1185Ala

[switch to full view]
Comments [show]
Publications
PMID: 21721517 [PubMed] Tsybovsky Y et al: "Posttranslational modifications of the photoreceptor-specific ABC transporter ABCA4."
No. Sentence Comment
79 T901A, S1185A, T1313A, and S1317A mutations were introduced by overlap extension polymerase chain reaction using Pfu DNA polymerase and the following mutagenic primers (with introduced mutations shown in bold): T901Af, gagcccctagccgaggaaacg; T901Ar, cgtttcctcggctaggggctc; S1185Af, ctaagggtttcgccac- cacgtgt; S1185Ar, acacgtggtggcgaaacccttag; T1313Af, gctgga- caggccccccaggac; T1313Ar, gtcctggggggcctgtccagc; S1317Af, gacaccccaggacgccaatgtctgc; S1317Ar, gcagacattggcgtcctgggg- tgtc.
X
ABCA4 p.Ser1185Ala 21721517:79:7
status: NEW
Login to comment

81 S1185A, T1313A, and S1317A were constructed with ABCA4 FseI-Fwd (agatttttgagccctgtggc) and ABCA4-Sbf I-rev (ccctggtgctgcacctgc) primers and subcloned into the FseI and SbfI sites.
X
ABCA4 p.Ser1185Ala 21721517:81:0
status: NEW
Login to comment

187 To reveal possible biological roles of ABCA4 phosphorylation, we created ABCA4 constructs with alanine mutations in the most conserved phosphorylation sites, namely, T901A, S1185A, T1313A, and S1317A.
X
ABCA4 p.Ser1185Ala 21721517:187:173
status: NEW
Login to comment

189 The S1185A, T1313A, and, to a lesser extent, S1317A mutants localized to intracellular vesicles like wild-type ABCA445 and demonstrated comparable expression levels (Figure 5A,B).
X
ABCA4 p.Ser1185Ala 21721517:189:4
status: NEW
Login to comment

191 Basal ATPase activities of the S1185A and T1313A mutants were identical to that of wild-type ABCA4 (Table 1).
X
ABCA4 p.Ser1185Ala 21721517:191:31
status: NEW
Login to comment

193 In the presence of 50 μM all-trans-retinal, the ATPase activity of S1185A and T1313A mutants was increased by only 60 and 100%, respectively, relative to the roughly 150% stimulation observed for the wild-type protein.
X
ABCA4 p.Ser1185Ala 21721517:193:73
status: NEW
Login to comment

227 These results agree well with the reduced levels of basal or all-trans-retinal-stimulated activity shown for S1317A or S1185A and T1313A mutants, respectively, of ABCA4 expressed in mammalian cells (Table 1).
X
ABCA4 p.Ser1185Ala 21721517:227:119
status: NEW
Login to comment

255 WT and mutants S1185A, T1313A, and, to a lesser extent, S1317A localize to intracellular vesicles.
X
ABCA4 p.Ser1185Ala 21721517:255:15
status: NEW
Login to comment

259 Basal and All-trans-Retinal-Stimulated Activity of Human ABCA4 Variants with Mutated Phosphorylation Sites sample basal activity (nmol mg-1 min-1 ) retinal-stimulated activity (nmol mg-1 min-1 ) wild-type 37.5 ± 1.1 91.7 ± 1.5 S1185A 39.0 ± 1.4 61.6 ± 2.2 T1313A 37.5 ± 1.6 74.5 ± 2.4 S1317A 8.5 ± 0.9 13.5 ± 1.1 Figure 6.
X
ABCA4 p.Ser1185Ala 21721517:259:237
status: NEW
Login to comment

298 The S1185A, T1313A, and S1317A mutants localized to intracellular vesicles (Figure 5B), suggestive of nativelike folding, although the lower expression level of T1317A could indicate possible destabilization.
X
ABCA4 p.Ser1185Ala 21721517:298:4
status: NEW
Login to comment

300 In contrast, the S1185A and T1313A mutants demonstrated native levels of basal ATPase activity, but their all-trans-retinal-stimulated ATPase activities were reduced 1.5-and 1.2-fold, respectively (Table 1).
X
ABCA4 p.Ser1185Ala 21721517:300:17
status: NEW
Login to comment