ABCMdb

PMID: 21721517

Tsybovsky Y, Wang B, Quazi F, Molday RS, Palczewski K
Posttranslational modifications of the photoreceptor-specific ABC transporter ABCA4.
Biochemistry. 2011 Aug 16;50(32):6855-66. Epub 2011 Jul 8., [PubMed]

Sentences

No. Mutations Sentence Comment

79 ABCA4 p.Thr901Ala ABCA4 p.Ser1317Ala ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala T901A, S1185A, T1313A, and S1317A mutations were introduced by overlap extension polymerase chain reaction using Pfu DNA polymerase and the following mutagenic primers (with introduced mutations shown in bold): T901Af, gagcccctagccgaggaaacg; T901Ar, cgtttcctcggctaggggctc; S1185Af, ctaagggtttcgccac- cacgtgt; S1185Ar, acacgtggtggcgaaacccttag; T1313Af, gctgga- caggccccccaggac; T1313Ar, gtcctggggggcctgtccagc; S1317Af, gacaccccaggacgccaatgtctgc; S1317Ar, gcagacattggcgtcctgggg- tgtc. Login to comment 80 ABCA4 p.Thr901Ala T901A was constructed with ABCA4-fwd (aatattgcggccgc- caccatgggcttcgtgagac) and ABCA4-FseI-rev (gccacagggct- caaaaatct) primers and subcloned into the NotI and FseI sites of the ABCA4 construct. Login to comment 81 ABCA4 p.Ser1317Ala ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala S1185A, T1313A, and S1317A were constructed with ABCA4 FseI-Fwd (agatttttgagccctgtggc) and ABCA4-Sbf I-rev (ccctggtgctgcacctgc) primers and subcloned into the FseI and SbfI sites. Login to comment 187 ABCA4 p.Thr901Ala ABCA4 p.Ser1317Ala ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala To reveal possible biological roles of ABCA4 phosphorylation, we created ABCA4 constructs with alanine mutations in the most conserved phosphorylation sites, namely, T901A, S1185A, T1313A, and S1317A. Login to comment 189 ABCA4 p.Ser1317Ala ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala The S1185A, T1313A, and, to a lesser extent, S1317A mutants localized to intracellular vesicles like wild-type ABCA445 and demonstrated comparable expression levels (Figure 5A,B). Login to comment 190 ABCA4 p.Thr901Ala In contrast, replacement of Thr901 with an alanine resulted in a poor expression level along with retention of the protein in the endoplasmic reticulum, indicative of misfolding (Figure 5A,B). Login to comment 191 ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala Basal ATPase activities of the S1185A and T1313A mutants were identical to that of wild-type ABCA4 (Table 1). Login to comment 193 ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala In the presence of 50 μM all-trans-retinal, the ATPase activity of S1185A and T1313A mutants was increased by only 60 and 100%, respectively, relative to the roughly 150% stimulation observed for the wild-type protein. Login to comment 227 ABCA4 p.Ser1317Ala ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala These results agree well with the reduced levels of basal or all-trans-retinal-stimulated activity shown for S1317A or S1185A and T1313A mutants, respectively, of ABCA4 expressed in mammalian cells (Table 1). Login to comment 253 ABCA4 p.Thr901Ala ABCA4 p.Ser1317Ala The T901A mutant is poorly expressed, and the level of expression of the S1317A mutant is reduced compared to those of wild-type ABCA4 and the other ABCA4 mutants. Login to comment 255 ABCA4 p.Ser1317Ala ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala WT and mutants S1185A, T1313A, and, to a lesser extent, S1317A localize to intracellular vesicles. Login to comment 256 ABCA4 p.Thr901Ala Mutant T901A is retained in the ER. Login to comment 259 ABCA4 p.Ser1317Ala ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala Basal and All-trans-Retinal-Stimulated Activity of Human ABCA4 Variants with Mutated Phosphorylation Sites sample basal activity (nmol mg-1 min-1 ) retinal-stimulated activity (nmol mg-1 min-1 ) wild-type 37.5 ± 1.1 91.7 ± 1.5 S1185A 39.0 ± 1.4 61.6 ± 2.2 T1313A 37.5 ± 1.6 74.5 ± 2.4 S1317A 8.5 ± 0.9 13.5 ± 1.1 Figure 6. Login to comment 277 ABCA4 p.Ser100Pro Interestingly, a Stargardt disease-associated missense mutation in ABCA4, S100P,31,50 removes a glycosylation site in the ECD-1 domain (Figure 2B). Login to comment 287 ABCA4 p.Thr901Ala Reportedly, Ala and Arg mutations in the T901 phosphorylation site are associated with Stargardt disease,50,60 cone-rod dystrophy,61,62 and AMD.63 Retention of the T901A mutant in the endoplasmic reticulum (Figure 5B) as well as its drastically reduced level of expression (Figure 5A) demonstrated in this study suggest that replacement of the threonine at this position leads to misfolding and protein degradation, but it is not yet clear if this is caused by a lack of phosphorylation or replacement of the Thr side chain. Login to comment 298 ABCA4 p.Ser1317Ala ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala The S1185A, T1313A, and S1317A mutants localized to intracellular vesicles (Figure 5B), suggestive of nativelike folding, although the lower expression level of T1317A could indicate possible destabilization. Login to comment 300 ABCA4 p.Ser1185Ala ABCA4 p.Thr1313Ala In contrast, the S1185A and T1313A mutants demonstrated native levels of basal ATPase activity, but their all-trans-retinal-stimulated ATPase activities were reduced 1.5-and 1.2-fold, respectively (Table 1). Login to comment