ABCA13 p.Leu2094Met
| Predicted by SNAP2: | A: N (53%), C: N (61%), D: D (75%), E: D (53%), F: N (66%), G: D (71%), H: N (53%), I: N (93%), K: D (53%), M: N (93%), N: D (59%), P: D (63%), Q: N (57%), R: D (59%), S: D (53%), T: N (61%), V: N (82%), W: D (66%), Y: N (66%), |
| Predicted by PROVEAN: |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Identification of a novel first exon of the human ... Biochim Biophys Acta. 2004 Apr 16;1678(1):22-32. Ile KE, Davis W Jr, Boyd JT, Soulika AM, Tew KD
Identification of a novel first exon of the human ABCA2 transporter gene encoding a unique N-terminus.
Biochim Biophys Acta. 2004 Apr 16;1678(1):22-32., [PMID:15093135]
Abstract [show]
The human ABCA2 transporter is a member of a large family of ATP-binding proteins that transport a variety of molecules across biological membranes. Using RNA ligation-mediated PCR (RLM-PCR), we have identified a novel first exon, which we designate 1B that is located 699 bp upstream of the previously characterized first exon, which we designate 1A. These first exons are alternatively spliced to the second exon of the ABCA2 transcript resulting in a protein that has a unique amino terminus. For exon 1B, the new amino terminus encoded by the first exon is 52 amino acids and for exon 1A, 22 amino acids. We observed that among adult tissues examined, the highest expression of the 1B isoform was in peripheral blood leukocytes (PBL). Laser scanning confocal microscopy revealed that the 1A isoform and the 1B isoform co-localize with lysosome-associated membrane proteins-1 and -2 (LAMP-1 and -2). Cytotoxicity assays suggested a role for ABCA2 in estramustine and estradiol resistance, and overexpression of ABCA2 is seen in an estramustine-resistant prostate carcinoma line. Since both isoforms of the ABCA2 transporter have identical subcellular localization and both are overexpressed in a resistant cell line, we propose that they are also functionally redundant. It is likely that expression of ABCA2 by two independent promoters constitutes locus of regulation controlling expression of the protein to meet requirements in different tissues.
Comments [show]
None has been submitted yet.
No. Sentence Comment
91 Construction of dnABCA2 expression construct and CHO stable transfectant cell lines Mutation of the conserved lysine to methionine in the Walker A motif in nuclear binding domain 2 (NBD2) (L2094M) was generated by overlap extension PCR, using primer (A) 5VAACGAGTACTACGCCAAGATTG 3V , (B) 5VTTGAAGGTGCTGGTCATGCCCGCACCGTTG 3Vand (C) 5V CAACGGTGCGGGCATGACCAGCACCTTCAA 3V , (D) 5V CGGGAAGTTGCGGTTGAAGAAC 3V in the first round of PCR and primers A and D in the second round of PCR.
X
ABCA13 p.Leu2094Met 15093135:91:189
status: NEW