ABCA13 p.Leu2094Met

[switch to full view]
Comments [show]
Publications
PMID: 15093135 [PubMed] Ile KE et al: "Identification of a novel first exon of the human ABCA2 transporter gene encoding a unique N-terminus."
No. Sentence Comment
91 Construction of dnABCA2 expression construct and CHO stable transfectant cell lines Mutation of the conserved lysine to methionine in the Walker A motif in nuclear binding domain 2 (NBD2) (L2094M) was generated by overlap extension PCR, using primer (A) 5VAACGAGTACTACGCCAAGATTG 3V , (B) 5VTTGAAGGTGCTGGTCATGCCCGCACCGTTG 3Vand (C) 5V CAACGGTGCGGGCATGACCAGCACCTTCAA 3V , (D) 5V CGGGAAGTTGCGGTTGAAGAAC 3V in the first round of PCR and primers A and D in the second round of PCR.
X
ABCA13 p.Leu2094Met 15093135:91:189
status: NEW
Login to comment