PMID: 15093135

Ile KE, Davis W Jr, Boyd JT, Soulika AM, Tew KD
Identification of a novel first exon of the human ABCA2 transporter gene encoding a unique N-terminus.
Biochim Biophys Acta. 2004 Apr 16;1678(1):22-32., [PubMed]
Sentences
No. Mutations Sentence Comment
91 ABCA13 p.Leu2094Met
X
ABCA13 p.Leu2094Met 15093135:91:189
status: NEW
view ABCA13 p.Leu2094Met details
 Construction of dnABCA2 expression construct and CHO stable transfectant cell lines Mutation of the conserved lysine to methionine in the Walker A motif in nuclear binding domain 2 (NBD2) (L2094M) was generated by overlap extension PCR, using primer (A) 5VAACGAGTACTACGCCAAGATTG 3V , (B) 5VTTGAAGGTGCTGGTCATGCCCGCACCGTTG 3Vand (C) 5V CAACGGTGCGGGCATGACCAGCACCTTCAA 3V , (D) 5V CGGGAAGTTGCGGTTGAAGAAC 3V in the first round of PCR and primers A and D in the second round of PCR. Login to comment