ABCMdb

ABCA1 p.Lys776Asn

None has been submitted yet.

Publications

PMID: 22923419 [PubMed] Reddy MV et al: "Exome sequencing identifies 2 rare variants for low high-density lipoprotein cholesterol in an extended family."

No. Sentence Comment

38 Genotype by sex interaction We included the extended family together with 10 additional families with previously identified mutations in ABCA16-8 in a gene-sex interaction analysis, comprising 200 individuals and 9 different mutations in ABCA1 (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X and S1731C). Login to comment
41 Genotype by Sex Interaction We included the extended family together with 10 additional families with previously identified mutations in ABCA16 -8 in a gene-sex interaction analysis, comprising 200 individuals and 9 different mutations in ABCA1 (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X, and S1731C). Login to comment
158 Figure 3 shows the age-sex specific population HDL-C percentiles by ABCA1 genotypes and sex in 200 French-Canadian family members from 11 French-Canadian families with different ABCA1 mutations (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X, and S1731C). Login to comment

PMID: 21875686 [PubMed] Tietjen I et al: "Increased risk of coronary artery disease in Caucasians with extremely low HDL cholesterol due to mutations in ABCA1, APOA1, and LCAT."

No. Sentence Comment

117 COOHA B T929I H2N R587W B A M1091T C1477R K776N N935S S1181F IVS24+1 G>C V2244I R282X D571G M640L S930F M968T R1615WIVS16-5 CA>del ABCA1 Transmembrane domain ATP-binding domain Q597R A) AA 1 AA 267 K130del L202P 74 90 98 112 122 145 167 189 211 215 233 253 APOA1 Negative charge domain Alpha-helix E222K E134DT37M 140 178 206 41127 104 121 165 200 229 360 391 Y135N V246F 127 206 369 401 Catalytic triad R322C L338H V371MV52M Y107X A117T T147I V333M Phe Leu Asp His AA 1 AA 440 R159Q I202T LCAT Alpha helixBeta sheet B) 419I.Tietjenetal./BiochimicaetBiophysicaActa1821(2012)416-424 3.4. Login to comment
169 Effects of some ABCA1 mutations described here are also consistent with previous in vitro cellular efflux studies; for example, the highly expressive ABCA1 mutations R587W, Q597R, N935S, and M1091T cause ~10-25% of wild-type efflux in vitro, while the less expressive mutations K776N and T929I cause 62 and 80% efflux, respectively [35-37]. Login to comment
170 Our data are also consistent with previous observations of K776N conferring average minimal HDLc reduction in mutation carriers [38]. Login to comment

PMID: 19596329 [PubMed] Frikke-Schmidt R et al: "Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population."

No. Sentence Comment

2338 The remaining non-synonymous mutations (S364C, T774P, and K776N), ranging in frequency from 0.1 to four per 1000, were not associated with low HDL cholesterol levels [65,66]. Login to comment
2368 Genetically increased IHD risk without low HDL cholesterol Another situation was observed with the identification of 37 heterozygous carriers of the K776N mutation in the CCHS [65]. Login to comment
2370 Several arguments favor the functionality of the K776N mutation, among these that the involved amino acid residue is completely conserved between species, and relatively conserved between 12 human ABCAs with very different transport functions [57]. Login to comment
2371 Furthermore, a mutation (R347P) causing cystic fibrosis has been identified in the CFTR gene (=ABCC7, another full ABC transporter) at a site that corresponds to residue 764 in ABCA1 [73], i.e. in close vicinity to the K776N mutation. Login to comment
2372 Also, the application of a substitution position-specific evolutionary conservation score (subPSEC score) [74], which considers site-specific variation among evolutionarily related proteins, predicted the K776N mutation to be deleterious [75]. Login to comment
2376 Thus, it could be speculated that the membrane associated K776N mutation impairs the apoptotic machinery and consequently induces inflammation and atherogenesis without affecting the lipid efflux capacity and thus the level of HDL cholesterol in plasma. Login to comment
2377 The K776N variant has been reported previously, but no association with IHD was observed [81], probably due to a low number of carriers in that study. Login to comment
2378 Although, heterozygous men for the K776N mutation, had marginally lower levels of HDL cholesterol compared to non-carriers in the general population (Fig. 3, lower panel), the two- to three-fold increase in risk of IHD could not be explained by this effect on HDL cholesterol [65]. Login to comment
2380 K776N heterozygotes, ischemic heart disease (IHD) and high-density lipoprotein (HDL) cholesterol levels. Login to comment
2381 Cumulative incidence of IHD as a function of age and by K776N genotype (upper panel), and exact values of HDL cholesterol for the individual heterozygotes as a function of age (lower panels). Login to comment
2385 Frikke-Schmidt et al. revealed four major findings: (1) approximately 10% of individuals with the lowest percentile of HDL cholesterol in the general population are heterozygous for mutations in ABCA1 [57], (2) the frequency of FHA caused by ABCA1 mutations in the general population is about three in 1000 [66], or considerably higher than previously assumed, (3) heterozygosity for a specific mutation, K776N, predicts a two- to three-fold risk of IHD, independent of HDL cholesterol levels [65], and (4) low plasma levels of HDL cholesterol due to heterozygosity for loss-of-function mutations in ABCA1 are not associated with an increased risk of IHD, supporting that a genetically lifelong reduction in plasma levels of HDL cholesterol per se does not predict an increased risk of IHD [66]. Login to comment
2384 Frikke-Schmidt et al. revealed four major findings: (1) approximately 10% of individuals with the lowest percentile of HDL cholesterol in the general population are heterozygous for mutations in ABCA1 [57], (2) the frequency of FHA caused by ABCA1 mutations in the general population is about three in 1000 [66], or considerably higher than previously assumed, (3) heterozygosity for a specific mutation, K776N, predicts a two- to three-fold risk of IHD, independent of HDL cholesterol levels [65], and (4) low plasma levels of HDL cholesterol due to heterozygosity for loss-of-function mutations in ABCA1 are not associated with an increased risk of IHD, supporting that a genetically lifelong reduction in plasma levels of HDL cholesterol per se does not predict an increased risk of IHD [66]. Login to comment

PMID: 18984885 [PubMed] Brunham LR et al: "ABCA1 gene mutations, HDL cholesterol levels, and risk of ischemic heart disease."

No. Sentence Comment

25 In contrast, many of the pathogenic ABCA1 mutations that have been extensively characterized have less than 20% to 30% of normal efflux activity.2 These findings are also in contrast to reports from the same group on the same cohort that showed that genetic variation in ABCA1 influences IHD in the general population and, in the case of the variants K776N (in men)4 and R1587K,5 is associated with low HDL cholesterol levels. Login to comment
28 In contrast, many of the pathogenic ABCA1 mutations that have been extensively characterized have less than 20% to 30% of normal efflux activity.2 These findings are also in contrast to reports from the same group on the same cohort that showed that genetic variation in ABCA1 influences IHD in the general population and, in the case of the variants K776N (in men)4 and R1587K,5 is associated with low HDL cholesterol levels. Login to comment

PMID: 18706283 [PubMed] Iatan I et al: "Effect of ABCA1 mutations on risk for myocardial infarction."

No. Sentence Comment

144 CC: 1.29 ± 0.64 CT: 1.28 ± 0.32 TT: 1.26 ± 0.35 Frikke-Schmidt et al. [36] / 2005 Copenhagen City Heart Study: K776N Heterozygosity for the K776N ABCA1 mutation conferred a twofold to threefold increase risk of IHD, independent of plasma HDL-C. Login to comment
145 The K776N polymorphism was a better predictor of IHD as compared with traditional cardiovascular risk factors. Login to comment
146 Noncarriers ( n = 9039) Women: 1.72 ± 0.01 Men: 1.38 ± 0.01 K776N carriers ( n = 37) Women: 1.82 ± 0.11 Men: 1.18 ± 0.09 P = 0.05 Martin et al. [37] / 2006 Cohort of males diagnosed with MI ( n = 170) NA C-477T † , R219K, I883M In long-term MI prognosis, the C-477T ABCA1 variant was associated with an unfavorable clinical evolution Controls: valvular patients with normal coronariography controls ( n = 100) *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2. Login to comment
165 Indeed, it was documented that a completely conserved ABCA1 common mutation, K776N (frequency, 0.4%), was found to confer a twofold to threefold increase in risk of IHD in 37 heterozygous participants in the Copenhagen City Heart Study (Table 2). Login to comment

PMID: 18523221 [PubMed] Frikke-Schmidt R et al: "Association of loss-of-function mutations in the ABCA1 gene with high-density lipoprotein cholesterol levels and risk of ischemic heart disease."

No. Sentence Comment

26 The 9022 individuals were genotyped for all non-synonymous mutations (S364C, T774P, K776N, P1065S, G1216V, N1800H, R2144X [http://www.hgmd.cf.ac.uk/ac /index.php; http://www.mutdb.org]), which were previously identified by resequencing the promoter, coding region,andconsensussplicesitesofABCA1 in 190 individuals of Danish ancestry with high and low HDL cholesterol levels.13 All end points and data collection were recorded in the follow-up period of January 1, 1976, through July 9, 2007. Login to comment
70 reductions in levels of HDL cholesterol in plasma in heterozygotes vs noncarriers in the CCHS as well as in the CGPS, while 3 were not (S364C, T774P, K776N). Login to comment
25 The 9022 individuals were genotyped for all nonsynonymous mutations (S364C, T774P, K776N, P1065S, G1216V, N1800H, R2144X [http://www.hgmd.cf.ac.uk/ac /index.php; http://www.mutdb.org]), which were previously identified by resequencing the promoter, coding region,andconsensussplicesitesofABCA1 in 190 individuals of Danish ancestry with high and low HDL cholesterol levels.13 All end points and data collection were recorded in the follow-up period of January 1, 1976, through July 9, 2007. Login to comment
54 LOSS-OF-FUNCTION MUTATIONS IN THE ABCA1 GENE AND RISK OF ISCHEMIC HEART DISEASE 2528 reductions in levels of HDL cholesterol in plasma in heterozygotes vs noncarriers in the CCHS as well as in the CGPS, while were not (S364C, T774P, K776N). Login to comment

PMID: 17951323 [PubMed] Frikke-Schmidt R et al: "Genetic variation in ABCA1 predicts ischemic heart disease in the general population."

No. Sentence Comment

110 (6) We have recently shown that a common mutation (frequency 0.4%) in ABCA1, K776N, predicted a 2-to 3-fold increase in risk in the general population independent of HDL-C levels.33 (7) Finally, in the present study adjustments for HDL-C levels did not substantially alter the risk estimates, supporting that ABCA1 has effects on risk of IHD independent of HDL-C levels. Login to comment
104 (6) We have recently shown that a common mutation (frequency 0.4%) in ABCA1, K776N, predicted a 2-to 3-fold increase in risk in the general population independent of HDL-C levels.33 (7) Finally, in the present study adjustments for HDL-C levels did not substantially alter the risk estimates, supporting that ABCA1 has effects on risk of IHD independent of HDL-C levels. Login to comment

PMID: 16343503 [PubMed] Alrasadi K et al: "Functional mutations of the ABCA1 gene in subjects of French-Canadian descent with HDL deficiency."

No. Sentence Comment

6 Three probands had the S1731C mutation, while two others had the R1851X and K776N documented mutations, respectively. Login to comment
124 Lastly, in proband PCH, we found the previously reported K776N, which did not show an unequivocal segregation within the family members (Fig. 2G). Login to comment
146 Proband PCH (Fig. 2G) was bearing the previously reported K776N mutation [5], predicted to be possibly damaging. Login to comment

PMID: 16704350 [PubMed] Brunham LR et al: "Variations on a gene: rare and common variants in ABCA1 and their impact on HDL cholesterol levels and atherosclerosis."

No. Sentence Comment

522 A small number of mutations have been reported in more than one unrelated individual, such as N1800H (16, 28, 43), and the K776N variant that was recently reported to occur in a Danish population at a frequency of 0.4% and to be associated with a two- to threefold increased risk for ischemic heart disease (44). Login to comment
523 The K776N variant was initially described as a SNP (27); however, the Danish study reporting that it occurs at a frequency less than 1% and is associated with a strong phenotypic effect would suggest that this is a relatively "common" ABCA1 mutation, at least in the Danish population, influencing atherosclerosis susceptibility. Login to comment
555 Since a complete loss of function allele would be expected to result in a 50% reduction in HDL levels, a greater than 50% reduction in HDL is most likely explained by a dominant negative allele, in which TABLE 3 Patient phenotypes associated with heterozygous ABCA1 mutations Mutation HDL (mmol/L) HDL (% of control) Number of patients M1091T 0.48 ± 0.5 30 ± 30 4 G1216V 0.50 40 1 R2144X 0.56 ± 0.2 41 ± 18 12 R282X 0.52 41 1 R909X 0.59 ± 0.3 42 ± 19 5 K776N 0.55 ± 0.1 47 ± 5 2 R587W 0.61 ± 0.1 47 ± 8 7 S364C 0.60 48 1 P1065S 0.80 51 1 c-ter deletion 0.75 53 1 N1800H - 56.5 33 P85L 0.72 ± 0.4 57 ± 33 5 Del693L 0.79 ± 0.2 57 ± 15 8 D1289N 0.80 ± 0.1 59 ± 12 4 R2081W 0.80 ± 0.1 59 ± 12 4 2203X 0.80 ± 0.2 59 ± 20 4 DelED1893,4 0.77 ± 0.2 59 ± 18 8 2145X 0.82 ± 0.1 59 ± 9 4 A1046D 0.70 ± 0.1 60 ± 8 2 Q597R 0.82 ± 0.1 60 ± 5 5 C1477R 0.82 ± 0.2 61 ± 15 9 IVS25 + 1G > C 0.78 ± 0.1 62 ± 12 4 D1099Y 0.83 ± 0.3 63 ± 21 5 1552X 1.00 64 1 F2009S 0.82 ± 0.2 64 ± 19 6 R587W 0.86 ± 0.1 65 ± 17 2 R1068H 0.90 ± 0.3 67 ± 26 9 N935S 1.00 ± 0.3 74 ± 16 7 T929I 1.01 ± 0.2 76 ± 7 8 1284X 1.11 ± 0.2 83 ± 14 5 A937V 1.15 ± 0.6 85 ± 28 2 R1680W 1.22 ± 0.2 87 ± 17 3 635X 1.24 ± 0.5 90 ± 32 7 W590S 1.32 ± 0.6 103 ± 46 15 the mutant protein actually interferes with the activity of the remaining wild-type protein. Login to comment

PMID: 16429166 [PubMed] Brunham LR et al: "Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene."

No. Sentence Comment

48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment

PMID: 16226177 [PubMed] Frikke-Schmidt R et al: "Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population."

No. Sentence Comment

0 Mutation in ABCA1 Predicted Risk of Ischemic Heart Disease in the Copenhagen City Heart Study Population Ruth Frikke-Schmidt, MD, PHD,* Børge G. Nordestgaard, MD, DMSC,†‡ Peter Schnohr, MD,‡ Rolf Steffensen, MD,§ Anne Tybjærg-Hansen, MD, DMSC,‡ Copenhagen, Herlev, Bispebjerg, and Hillerød, Denmark OBJECTIVES We tested whether heterozygosity for the K776N mutation (frequency: 0.4%) in ATP-binding cassette transporter A1 (ABCA1) predicted ischemic heart disease (IHD) in the Copenhagen City Heart Study population. Login to comment
5 RESULTS The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p ϭ 0.005). Login to comment
6 At the age of 80 years, 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years. Login to comment
7 The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5). Login to comment
10 CONCLUSIONS Heterozygosity for an ABCA1 mutation (K776N) conferred two- to three-fold risk of IHD in 37 participants in the Copenhagen City Heart study. Login to comment
21 The K776N mutation is of particular interest because: 1) K776 is completely conserved between species; 2) the K Ͼ N amino acid substitution results in a change in side chain charge (basic to uncharged polar); 3) K776N is reported to be relatively frequent in Caucasians (3 per 1,000) (14); 4) disease-causing mutations have been identified in the corresponding region of a closely related gene, the cystic fibrosis transmembrane conductance regulator (CFTR or ABCC7) (15). Login to comment
22 We tested the hypothesis that ABCA1 K776N genotype is associated with risk of IHD in the general population. Login to comment
45 An ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, California) was used to genotype the K776N (nucleotide 2327G Ͼ C) mutation. Login to comment
55 Cox proportional hazards regression models estimated hazard ratios for IHD as a function of K776N genotype, and Kaplan-Meier plots and log-rank tests evaluated the cumulative incidence of IHD as a function of age and K776N genotype. Login to comment
63 RESULTS Among the 9,076 participants in The Copenhagen City Heart Study, 37 (frequency: 0.4%) were heterozygous and none were homozygous for K776N. Login to comment
65 Risk factors for IHD did not differ between non-carriers and K776N heterozygotes, except for levels of HDL-C in men (Table 1). Login to comment
66 The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log- Abbreviations and Acronyms apoAI ϭ apolipoprotein AI CFTR ϭ cystic fibrosis transmembrane conductance regulator HDL-C ϭ high-density lipoprotein cholesterol IHD ϭ ischemic heart disease rank test: p ϭ 0.005) (Fig. Login to comment
68 At the age of 80 years, about 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years (Table 2). Login to comment
69 The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5) (Table 2). Login to comment
71 Finally, in an independent case-control study comparing 562 patients with IHD with 3,103 healthy controls within the same age range, the odds ratio for IHD in K776N heterozygotes versus non-carriers was 2.8 (95% confidence interval 0.8 to 9.4) (Table 3). Login to comment
72 Mean plasma HDL-C in non-carriers and K776N heterozygotes was 1.72 mmol/l and 1.82 mmol/l in women (p ϭ 0.42), and 1.38 mmol/l and 1.18 mmol/l in men (p ϭ 0.05). Login to comment
73 Mean plasma apoAI levels in non-carriers and K776N heterozygotes were 151 mg/dl and 150 mg/dl in women (p ϭ 0.93), and 130 mg/dl and 117 mg/dl in men (p ϭ 0.03) (data not shown); HDL-C levels in the 37 individuals heterozygous for K776N ranged from 1.0 to 2.7 mmol/l in women, and from 0.5 to 2.0 mmol/l in men. Login to comment
79 The frequency of IHD in K776N heterozygotes in the present study was 26% to 28% (women: 5 of 19; men: 5 of 18), comparable to the frequency in Tangier disease. Login to comment
87 Cumulative incidence of ischemic heart disease (IHD) as a function of age and ABCA1 K776N genotype. Login to comment
89 Characteristics of Individuals in the General Population by ABCA1 K776N Genotype Women Men Non-Carriers (n ‫؍‬ 5,003) K776N Heterozygotes (n ‫؍‬ 19) Non-Carriers (n ‫؍‬ 4,036) K776N Heterozygotes (n ‫؍‬ 18) Age at entry (yrs) 46 Ϯ 0.2 45 Ϯ 3.0 45 Ϯ 0.2 48 Ϯ 2.5 Cholesterol (mmol/l) 6.3 Ϯ 0.02 6.2 Ϯ 0.3 6.0 Ϯ 0.02 5.6 Ϯ 0.3 Apolipoprotein B (mg/dl) 86.4 Ϯ 0.3 83.8 Ϯ 5.3 86.2 Ϯ 0.3 85.1 Ϯ 6.2 HDL-C (mmol/l) 1.72 Ϯ 0.01 1.82 Ϯ 0.11 1.38 Ϯ 0.01 1.18 Ϯ 0.09* Triglycerides (mmol/l) 1.7 Ϯ 0.02 1.4 Ϯ 0.2 2.1 Ϯ 0.03 2.3 Ϯ 0.3 Body mass index (kg/m2 ) 25.2 Ϯ 0.07 25.0 Ϯ 1.0 26.1 Ϯ 0.06 24.7 Ϯ 1.1 Smoking (%) 73 89 84 88 Diabetes mellitus (%) 3 0 6 11 Hypertension (%) 51 37 59 56 Values are mean Ϯ SE, or percentages. Login to comment
98 To our knowledge, no homozygotes for K776N have been described so far, and we also did not identify any. Login to comment
100 It is therefore unlikely that the majority of K776N homozygotes would express an HDL-C deficiency phenotype comparable to Tangier disease, where HDL-C levels are generally below 0.2 mmol/l. Login to comment
101 However, as is the case for K776N in the present study, in Tangier disease there also does not seem to be a clear correlation between the reduction in plasma HDL-C levels and risk of IHD. Login to comment
105 Although K776N is a relatively common mutation, it is not a common cause of IHD. Login to comment
106 The population-attributable fraction of K776N to IHD is about 0.4% in the Copenhagen City Heart Study, or comparable to the risk of IHD attributed to low-density lipoprotein receptor mutations in the same study. Login to comment
107 However, at the individual level, K776N appears to have a marked impact on risk. Login to comment
109 However, several arguments favor a true observation: 1) the involved amino acid residue is completely conserved between species and relatively conserved between 12 ABCAs with very different transport functions; 2) the amino acid substitution changes the charge of the side-chain, potentially leading to structural alterations of the protein, and consequently to altered protein interactions or transport properties; 3) in the CFTR (or ABCC7), a disease-causing mutation (R347P) has been identified at a site that corresponds to residue 764 in ABCA1 (15), and thus in close vicinity to K776N; 4) the present study is of a large cohort, and therefore includes only incident cases, avoiding the normal pitfalls of case reports and case-control studies (30); 5) we observed a similar trend on risk of IHD in a separate case-control study; 6) we have previously determined effects on lipids and lipoproteins of all non-synonymous SNPs identified in ABCA1 (R219K, V771M, V825I, I883M, E1172D, R1587K). Login to comment
110 When taking multiple testing into account, the log-rank test for the cumulative incidence of ischemic heart disease as a function of age and K776N genotype fulfilled a Bonferroni-corrected p value Ͻ0.007 (0.05 of 7) on a two-sided test (seven different genetic variants tested including K776N). Login to comment
112 If mortality rate from ischemic heart disease was higher among K776N heterozygotes and homozygotes than among non-carriers, our study would underestimate the association between ABCA1 K776N and risk of ischemic heart disease. Login to comment
113 However, the fact that K776N was in Hardy-Weinberg equilibrium suggested that no serious selection bias had occurred in the cohort during follow-up. Login to comment
116 Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the General Population Events Incidence Rate/10,000 Person-Years (95% CI) Hazard Ratio (95% CI) Observed Expected Age-Adjusted HDL-C-Adjusted Multifactorial-Adjusted Non-carriers 1,023 1,029 61 (58-65) 1 1 1 K776N heterozygotes 10 4 157 (76-290) 2.4 (1.3-4.5) 2.4 (1.3-4.5) 2.4 (1.3-4.5) In the Cox regression model (age-adjusted, HDL-C-adjusted, and multifactorial-adjusted), age is adjusted for by incorporating age in the baseline hazard function (left truncation). Login to comment
121 Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the Case-Control Study Frequency Odds Ratio (95% CI) Age-AdjustedIHD Controls All Non-carriers 558 (99.3) 3,095 (99.7) 1 K776N heterozygotes 4 (0.7) 8 (0.3) 2.8 (0.8-9.4) A total of 562 45-to 64-year-old patients with ischemic heart disease (IHD) verified by coronary angiography were compared with 3,103 healthy controls within the same age range. Login to comment
44 An ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, California) was used to genotype the K776N (nucleotide 2327G b0e; C) mutation. Login to comment
54 Cox proportional hazards regression models estimated hazard ratios for IHD as a function of K776N genotype, and Kaplan-Meier plots and log-rank tests evaluated the cumulative incidence of IHD as a function of age and K776N genotype. Login to comment
62 RESULTS Among the 9,076 participants in The Copenhagen City Heart Study, 37 (frequency: 0.4%) were heterozygous and none were homozygous for K776N. Login to comment
64 Risk factors for IHD did not differ between non-carriers and K776N heterozygotes, except for levels of HDL-C in men (Table 1). Login to comment
67 The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5) (Table 2). Login to comment
70 Mean plasma HDL-C in non-carriers and K776N heterozygotes was 1.72 mmol/l and 1.82 mmol/l in women (p afd; 0.42), and 1.38 mmol/l and 1.18 mmol/l in men (p afd; 0.05). Login to comment
77 The frequency of IHD in K776N heterozygotes in the present study was 26% to 28% (women: 5 of 19; men: 5 of 18), comparable to the frequency in Tangier disease. Login to comment
85 Cumulative incidence of ischemic heart disease (IHD) as a function of age and ABCA1 K776N genotype. Login to comment
96 To our knowledge, no homozygotes for K776N have been described so far, and we also did not identify any. Login to comment
99 However, as is the case for K776N in the present study, in Tangier disease there also does not seem to be a clear correlation between the reduction in plasma HDL-C levels and risk of IHD. Login to comment
103 Although K776N is a relatively common mutation, it is not a common cause of IHD. Login to comment
104 The population-attributable fraction of K776N to IHD is about 0.4% in the Copenhagen City Heart Study, or comparable to the risk of IHD attributed to low-density lipoprotein receptor mutations in the same study. Login to comment
108 When taking multiple testing into account, the log-rank test for the cumulative incidence of ischemic heart disease as a function of age and K776N genotype fulfilled a Bonferroni-corrected p value b0d;0.007 (0.05 of 7) on a two-sided test (seven different genetic variants tested including K776N). Login to comment
111 However, the fact that K776N was in Hardy-Weinberg equilibrium suggested that no serious selection bias had occurred in the cohort during follow-up. Login to comment
114 Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the General Population Events Incidence Rate/10,000 Person-Years (95% CI) Hazard Ratio (95% CI) Observed Expected Age-Adjusted HDL-C-Adjusted Multifactorial-Adjusted Non-carriers 1,023 1,029 61 (58-65) 1 1 1 K776N heterozygotes 10 4 157 (76-290) 2.4 (1.3-4.5) 2.4 (1.3-4.5) 2.4 (1.3-4.5) In the Cox regression model (age-adjusted, HDL-C-adjusted, and multifactorial-adjusted), age is adjusted for by incorporating age in the baseline hazard function (left truncation). Login to comment
119 Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the Case-Control Study Frequency Odds Ratio (95% CI) Age-Adjusted IHD Controls All Non-carriers 558 (99.3) 3,095 (99.7) 1 K776N heterozygotes 4 (0.7) 8 (0.3) 2.8 (0.8-9.4) A total of 562 45-to 64-year-old patients with ischemic heart disease (IHD) verified by coronary angiography were compared with 3,103 healthy controls within the same age range. Login to comment

PMID: 12763760 [PubMed] Singaraja RR et al: "Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene."

No. Sentence Comment

136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
160 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels. Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
152 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels. Login to comment

PMID: 12840658 [PubMed] Miller M et al: "Genetics of HDL regulation in humans."

No. Sentence Comment

66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.] Login to comment

PMID: 12700893 [PubMed] Evans D et al: "The association of the R219K polymorphism in the ATP-binding cassette transporter 1 ( ABCA1) gene with coronary heart disease and hyperlipidaemia."

No. Sentence Comment

87 Clee et al. [15] found that the R219K polymorphism was in linkage disequilibrium with two less frequent variants, V771M and K776N; however, excluding patients who were also carriers of these polymorphisms did not alter the results they obtained for the R219K polymorphism. Login to comment

PMID: 11238261 [PubMed] Clee SM et al: "Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease."

No. Sentence Comment

48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
132 Carriers of V399A had half the frequency of a positive family history of CAD (22.2% versus 49.4%, Pϭ0.18) and trends toward an increased baseline MOD (Table 6) and less progression in MSD (-0.05Ϯ0.10 versus 0.08Ϯ0.19 mm in noncarriers, Pϭ0.16) during the trial. Login to comment
137 Carriers of the other 3 rare variants (T774P, K776N, and E1172D) showed no significant differences in lipid levels or CAD compared with their respective noncarriers (Table 6). Login to comment
140 The presence of this variant in individuals heterozygous for the R2144X ABCA1 mutation was associated with further significantly decreased HDL-C compared with R2144X carriers without this polymorphism (0.16Ϯ0.04 mmol/L, nϭ2, versus 0.64Ϯ0.14 mmol/L, nϭ10; Pϭ0.0009). Login to comment
144 Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment
145 If all V771M and K776N carriers are excluded, the results are unaltered, with increased MOD (1.80Ϯ0.35 versus 1.73Ϯ0.35 mm, Pϭ0.006) and MSD (2.76Ϯ0.36 versus 2.70Ϯ0.37 mm, Pϭ0.02) and lower mean TG levels (1.71Ϯ0.75 versus 1.84Ϯ0.77 mmol/L, Pϭ0.02) in carriers of R219K (nϭ329) compared with noncarriers (nϭ422). Login to comment
156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D. Login to comment
161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n). Login to comment
186 Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident. Login to comment
191 Similarly, the region containing the V771M, T774P, and K776N variants is unlikely to be critical to ABCA1 function, because a high degree of polymorphism is tolerated without functional effects. Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
139 Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment

PMID: 23136402 [PubMed] Bochem AE et al: "ABCA1 mutation carriers with low high-density lipoprotein cholesterol are characterized by a larger atherosclerotic burden."

No. Sentence Comment

115 An alternative approach is the assessment of effects of genetic variation in ABCA1 using a Mendelian randomization approach as performed by Frikke-Schmidt et al.42 In line with our results, they report that in a prospective cohort comprising 9000 individuals, heterozygosity for the ABCA1 mutation p.Lys776Asn led to a two-to-three-fold higher risk of ischaemic heart disease. Login to comment

PMID: 24385509 [PubMed] Westerterp M et al: "ATP-binding cassette transporters, atherosclerosis, and inflammation."

No. Sentence Comment

59 In a Mendelian randomization approach in a prospective cohort comprising ࣈ9000 individuals, heterozygosity for the ABCA1 mutation K776N led to a 2-to-3 times higher risk of ischemic heart disease.105 Furthermore, 5 single-nucleotide polymorphisms (SNPs) inABCA1 (V771M,V825I, I883M, E1172D, R1587K) were shown to predict risk of ischemic heart disease in a cohort of 9259 individuals.106 However, the same group reported more recently that heterozygosity for 4 loss-of-function mutations (P1065S, G1216V, N1800H, R2144X) was not associated with a higher risk of ischemic heart disease in 3 prospective cohorts comprising 56ߙ886 individuals.107 It must be noted, however, that only small decreases in HDL, of ࣈ28% as opposed to ࣈ50% in previously reported ABCA1 heterozygotes, were observed.94,101-103,107 Also, the residual cholesterol efflux was substantial (74%-79% for P1065S and G1216V and 48%-49% for N1800H and R2144X for homozygous mutations compared with controls),107 whereas in patients with TD there was only 20% to 30% residual cholesterol efflux.108 In addition, LDL levels were reduced by ࣈ25%, probably offsetting the effects of reduced HDL on CVD.107 Thus, the conflicting results in these studies could be related to inclusion of relatively mild ABCA1 mutations as well as offsetting effects of reduced LDL cholesterol levels.109 In a meta-analysis of genome-wide association studies, SNPs near the ABCA1 gene have been associated with HDL and total cholesterol levels,110,111 but not with cardiovascular risk.112 Although these studies have the benefit of huge statistical power, some caution is merited in the interpretation of findings. Login to comment