ABCB4 p.Ser430Ala
| Predicted by SNAP2: | A: N (78%), C: D (75%), D: N (57%), E: N (78%), F: D (85%), G: N (66%), H: N (82%), I: D (63%), K: N (66%), L: D (63%), M: N (57%), N: N (78%), P: N (82%), Q: N (87%), R: N (66%), T: N (82%), V: D (53%), W: D (85%), Y: D (85%), |
| Predicted by PROVEAN: | A: N, C: D, D: N, E: N, F: D, G: N, H: N, I: D, K: N, L: D, M: D, N: N, P: D, Q: N, R: N, T: N, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]
Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
146 S430A and/or S1073A/T changes in the catalytic sites of MDR3 abolished MgATPase and transition state formation at both sites [95].
X
ABCB4 p.Ser430Ala 16442101:146:0
status: NEW[hide] Overexpression, purification, and functional chara... Biochim Biophys Acta. 2003 Feb 17;1610(1):63-76. Cai J, Gros P
Overexpression, purification, and functional characterization of ATP-binding cassette transporters in the yeast, Pichia pastoris.
Biochim Biophys Acta. 2003 Feb 17;1610(1):63-76., 2003-02-17 [PMID:12586381]
Abstract [show]
The ATP-binding cassette (ABC) transporter superfamily is a large gene family that has been highly conserved throughout evolution. The physiological importance of these membrane transporters is highlighted by the large variety of substrates they transport, and by the observation that mutations in many of them cause heritable diseases in human. Likewise, overexpression of certain ABC transporters, such as P-glycoprotein and members of the multidrug resistance associated protein (MRP) family, is associated with multidrug resistance in various cells and organisms. Understanding the structure and molecular mechanisms of transport of the ABC transporters in normal tissues and their possibly altered function in human diseases requires large amounts of purified and active proteins. For this, efficient expression systems are needed. The methylotrophic yeast Pichia pastoris has proven to be an efficient and inexpensive experimental model for high-level expression of many proteins, including ABC transporters. In the present review, we will summarize recent advances on the use of this system for the expression, purification, and functional characterization of P-glycoprotein and two members of the MRP subfamily.
Comments [show]
None has been submitted yet.
No. Sentence Comment
190 Similar conclusions were reached from the study of additional loss-of- function mutants at highly conserved serine residues in the Walker A motif of NBD1 (S430A) and NBD2 (S1073A) [97].
X
ABCB4 p.Ser430Ala 12586381:190:155
status: NEW[hide] Involvement of the "occluded nucleotide conformati... Biochemistry. 2005 Sep 27;44(38):12879-86. Tombline G, Muharemagic A, White LB, Senior AE
Involvement of the "occluded nucleotide conformation" of P-glycoprotein in the catalytic pathway.
Biochemistry. 2005 Sep 27;44(38):12879-86., [PMID:16171403]
Abstract [show]
We found recently that the combined mutation of both "catalytic carboxylate" residues (E552A/E1197A) in mouse P-glycoprotein (Pgp) arrested the protein in an "occluded nucleotide conformation", possibly a stabilized dimer of nucleotide-binding domains (NBDs), that binds MgATP tightly at stoichiometry of 1 mol/mol Pgp [Tombline, G., Bartholomew, L., Urbatsch, I. L., and Senior, A. E. (2004) J. Biol. Chem. 279, 31212-31220]. Here, we further examine this conformation in respect to its potential involvement in the catalytic pathway. The occluded nucleotide conformation is promoted by drugs. Verapamil markedly accelerated the rate of tight binding of MgATP, whereas it did not effect the rate of dissociation. Mutations in "Q-loop" residues that are thought to interfere with communication between drug and catalytic sites prevented the occluded nucleotide conformation, as did covalent reagents N-ethylmaleimide and 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole, which are known to inhibit ATP hydrolysis by reacting in catalytic sites. Mutations of Walker A Ser and Lys residues in combination with E552A/E1197A had the same effect, showing that interaction of these conserved residues with MgATP is required to stabilize the occluded nucleotide conformation. We present an enzymatic scheme that incorporates this conformation. We propose that upon initial loose binding of MgATP at two nucleotide-binding domains (NBDs), together with drug binding, the NBDs dimerize to form the occluded conformation, with one tightly bound MgATP committed to hydrolysis. The pathway progresses such that the tightly bound MgATP enters the transition state and is hydrolyzed. This work suggests that small molecules or peptides that interact at the NBD dimer interface might effectively disable Pgp catalysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
117 E552A/E1197A/S430A and E552A/E1197A/S1073A.
X
ABCB4 p.Ser430Ala 16171403:117:13
status: NEW120 Previous work has shown (17) that the single mutations S430A and S1073A strongly impair ATPase activity and abolish Vi-trapping of nucleotide in Pgp, although MgATP binding as evaluated by photolabeling with Mg-8-azido-ATP was unimpaired.
X
ABCB4 p.Ser430Ala 16171403:120:55
status: NEW122 Figure 4 shows that the mutations S430A or S1073A, when combined with E552A/ E1197A, abolished tight binding of MgATP.
X
ABCB4 p.Ser430Ala 16171403:122:34
status: NEW208 The mutants S430A and S1073A at the loci of the Walker A Ser residues in Pgp remove the hydroxyl side chain known to coordinate to the Mg cation of bound MgATP and MgADP in many nucleotide-binding proteins, including ABC transporters (6, 31-34).
X
ABCB4 p.Ser430Ala 16171403:208:12
status: NEW209 As noted in the Results, the single mutations S430A and S1073A had been shown previously (17) to inhibit Pgp ATPase activity and transition-state formation (as measured by Vi-ADP trapping) but not to prevent the initial binding of MgATP (as evaluated by 8-azido-ATP labeling), as if the Ser-OH only became tangibly engaged with the Mg-nucleotide at the stage of a "closed conformation".
X
ABCB4 p.Ser430Ala 16171403:209:46
status: NEW211 Consistent with these data, the mutants E552A/E1197A/S430A and E552A/E1197A/S1073A were deficient in tight binding of MgATP and MgADP (Figures 4 and 5).
X
ABCB4 p.Ser430Ala 16171403:211:53
status: NEW[hide] Conserved walker A Ser residues in the catalytic s... J Biol Chem. 2000 Aug 11;275(32):25031-8. Urbatsch IL, Gimi K, Wilke-Mounts S, Senior AE
Conserved walker A Ser residues in the catalytic sites of P-glycoprotein are critical for catalysis and involved primarily at the transition state step.
J Biol Chem. 2000 Aug 11;275(32):25031-8., [PMID:10831598]
Abstract [show]
P-glycoprotein mutants S430A/T and S1073A/T, affecting conserved Walker A Ser residues, were characterized to elucidate molecular roles of the Ser and functioning of the two P-glycoprotein catalytic sites. Results showed the Ser-OH is critical for MgATPase activity and formation of the normal transition state, although not for initial MgATP binding. Mutation to Ala in either catalytic site abolished MgATPase and transition state formation in both sites, whereas Thr mutants had similar MgATPase to wild-type. Trapping of 1 mol of MgADP/mol of P-glycoprotein by vanadate, shown here with pure protein, yielded full inhibition of ATPase. Thus, congruent with previous work, both sites must be intact and must interact for catalysis. Equivalent mutations (Ala or Thr) in the two catalytic sites had identical effects on a wide range of activities, emphasizing that the two catalytic sites function symmetrically. The role of the Ser-OH is to coordinate Mg(2+) in MgATP, but only at the stage of the transition state are its effects tangible. Initial substrate binding is apparently to an "open" catalytic site conformation, where the Ser-OH is dispensable. This changes to a "closed" conformation required to attain the transition state, in which the Ser-OH is a critical ligand. Formation of the latter conformation requires both sites; both sites may provide direct ligands to the transition state.
Comments [show]
None has been submitted yet.
No. Sentence Comment
49 EXPERIMENTAL PROCEDURES Introduction of S430A, S430T, S1073A, and S1073T Mutations into Mouse mdr3 cDNA-Site-directed mutagenesis used the commercially available Altered Sites II method from Promega.
X
ABCB4 p.Ser430Ala 10831598:49:40
status: NEW52 The mutagenic oligonucleotide for the S430A mutation was: GCTGTGGAAAAGCGACAACTGTCCAG in which the underlined GCG (Ala) replaced AGC (Ser) and introduced a PshAI site.
X
ABCB4 p.Ser430Ala 10831598:52:38
status: NEW64 Mutations were transferred into plasmid pHIL-mdr3.5-His6 (24) using the following restriction fragments: S430A and S430T, BglII- SmaI; S1073A and S1073T, SpeI-SnaBI.
X
ABCB4 p.Ser430Ala 10831598:64:105
status: NEW140 We generated mutations S430A, S430T, S1073A, and S1073T in mouse MDR3 Pgp, in order to study the catalytic role of these Ser residues.
X
ABCB4 p.Ser430Ala 10831598:140:23
status: NEW175 No significant ATPase activity was seen at any concentration of Mg2ϩ with either S430A or S1073A.
X
ABCB4 p.Ser430Ala 10831598:175:87
status: NEW190 Fig. 4 shows results for wild-type, S430A, and S430T with 2.5 M nucleotide.
X
ABCB4 p.Ser430Ala 10831598:190:36
status: NEW194 From Fig. 4 it is clear that, in mutants and wild-type, degree of labeling was the same in the S430A, S430T, and wild-type Pgp.
X
ABCB4 p.Ser430Ala 10831598:194:95
status: NEW204 TABLE I MgATPase activity of wild-type and mutant Pgp preparations Mutant Pgp Specific ATPase activity KM(MgATP)a Kapp(verapamil)b No verapamil Plus verapamila mol/min/mg mM M Wild-type 0.3 4.0 (13-fold) 0.44 6.0 S430A NSc NSc S430T 0.26 3.3 (13-fold) 0.53 3.0 S1073A NSc NSc S1073T 0.18 3.2 (18-fold) 0.47 5.0 a Verapamil was included at 150 M, shown to be sufficient for maximal stimulation of activity.
X
ABCB4 p.Ser430Ala 10831598:204:229
status: NEW212 Fig. 5A shows photolabeling of lipid-activated wild-type Pgp by 8-azido-[32 P]ATP. Fig. 5B shows that other nucleotide substrates, including natural ATP, competed well with 8-azido- ATP. Fig. 5 (C-F) shows results obtained with S430A, S430T, S1073A, and S1073T mutants.
X
ABCB4 p.Ser430Ala 10831598:212:228
status: NEW216 The point that lack of ATPase activity in the S430A and S1073A mutants is not due to lack of substrate binding is therefore confirmed.
X
ABCB4 p.Ser430Ala 10831598:216:46
status: NEW217 An unexpected finding was that S430A and S1073A mutants showed the same modulation of 8-azido-ATP binding by increasing Mg2ϩ concentration as wild-type.
X
ABCB4 p.Ser430Ala 10831598:217:31
status: NEW223 No trapping of Mg[␣- 32 P]ADP occurred in S430A and S1073A mutants, showing that, although they could bind MgATP (see above), these mutants could not attain the catalytic transition state, in either their mutated or intact nucleotide site.
X
ABCB4 p.Ser430Ala 10831598:223:49
status: NEW227 This showed that direct photolabeling is strongly disfavored in the transition state conformation.4 Vi Trapping of 8-Azido-[␣-32 P]ADP with Different Metals-It was shown above that S430T and S1073T mutants showed a different spectrum of ATPase activities from wild-type with varied metal cofactors and, interestingly, that S430A and S1073A mutants, which were inactive with MgATP as substrate, nevertheless showed very low hydrolysis activity with MnATP, CoATP and CaATP (Fig. 3).
X
ABCB4 p.Ser430Ala 10831598:227:330
status: NEW232 With S430A and S1073A mutants, no trapping was seen with Mg2ϩ , agreeing with ATPase assays (Fig. 3), but low levels of trapping were seen with Mn2ϩ and Co2ϩ .
X
ABCB4 p.Ser430Ala 10831598:232:5
status: NEW234 The autoradiogams identify the very low ATPase activity with Mn- and Co-nucleotide as due to S430A and S1073A Pgp.
X
ABCB4 p.Ser430Ala 10831598:234:93
status: NEW235 However, no trapped nucleotide was evident with Ca2ϩ in S430A or S1073A, possibly because the rate of dissociation of Vi-trapped Ca-8-azido-ADP is rapid compared with the hydrolysis rate.
X
ABCB4 p.Ser430Ala 10831598:235:62
status: NEW239 Metal dependence of ATPase activity of S430A and S1073A mutant Pgp.
X
ABCB4 p.Ser430Ala 10831598:239:39
status: NEW242 A, S430A Pgp; B, S1073A Pgp.
X
ABCB4 p.Ser430Ala 10831598:242:3
status: NEW248 b t1/2, half-time for reactivation of ATPase at 37 °C. DISCUSSION General-In this work we examined the mutants S430A, S430T, S1073A, and S1073T, affecting the Ser residue at the end of the Walker A sequence of the Nand C-terminal ATP-binding sites of mouse MDR3 P-glycoprotein.
X
ABCB4 p.Ser430Ala 10831598:248:117
status: NEW269 After irradiation, protein was run on SDS gels and subjected to autoradiography. A, wild-type Pgp; B, S430A mutant; C, S430T mutant.
X
ABCB4 p.Ser430Ala 10831598:269:102
status: NEW272 Panels A and C-F, Pgp (2 g) was incubated with 2.5 M 8-azido-[␣-32 P]ATP and 150 M verapamil in presence of increasing concentration of MgCl2 (the zero Mg2ϩ lane had 1 mM EDTA), irradiated by UV light, and the protein run on SDS gels then subjected to autoradiography. A, wild-type; C, S430A; D, S430T; E, S1073A; F, S1073T.
X
ABCB4 p.Ser430Ala 10831598:272:323
status: NEW