ABCB4 p.Ser430Ala

[switch to full view]
Comments [show]
Publications
PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."
No. Sentence Comment
146 S430A and/or S1073A/T changes in the catalytic sites of MDR3 abolished MgATPase and transition state formation at both sites [95].
X
ABCB4 p.Ser430Ala 16442101:146:0
status: NEW
Login to comment

PMID: 12586381 [PubMed] Cai J et al: "Overexpression, purification, and functional characterization of ATP-binding cassette transporters in the yeast, Pichia pastoris."
No. Sentence Comment
190 Similar conclusions were reached from the study of additional loss-of- function mutants at highly conserved serine residues in the Walker A motif of NBD1 (S430A) and NBD2 (S1073A) [97].
X
ABCB4 p.Ser430Ala 12586381:190:155
status: NEW
Login to comment

PMID: 16171403 [PubMed] Tombline G et al: "Involvement of the "occluded nucleotide conformation" of P-glycoprotein in the catalytic pathway."
No. Sentence Comment
117 E552A/E1197A/S430A and E552A/E1197A/S1073A.
X
ABCB4 p.Ser430Ala 16171403:117:13
status: NEW
Login to comment

120 Previous work has shown (17) that the single mutations S430A and S1073A strongly impair ATPase activity and abolish Vi-trapping of nucleotide in Pgp, although MgATP binding as evaluated by photolabeling with Mg-8-azido-ATP was unimpaired.
X
ABCB4 p.Ser430Ala 16171403:120:55
status: NEW
Login to comment

122 Figure 4 shows that the mutations S430A or S1073A, when combined with E552A/ E1197A, abolished tight binding of MgATP.
X
ABCB4 p.Ser430Ala 16171403:122:34
status: NEW
Login to comment

208 The mutants S430A and S1073A at the loci of the Walker A Ser residues in Pgp remove the hydroxyl side chain known to coordinate to the Mg cation of bound MgATP and MgADP in many nucleotide-binding proteins, including ABC transporters (6, 31-34).
X
ABCB4 p.Ser430Ala 16171403:208:12
status: NEW
Login to comment

209 As noted in the Results, the single mutations S430A and S1073A had been shown previously (17) to inhibit Pgp ATPase activity and transition-state formation (as measured by Vi-ADP trapping) but not to prevent the initial binding of MgATP (as evaluated by 8-azido-ATP labeling), as if the Ser-OH only became tangibly engaged with the Mg-nucleotide at the stage of a "closed conformation".
X
ABCB4 p.Ser430Ala 16171403:209:46
status: NEW
Login to comment

211 Consistent with these data, the mutants E552A/E1197A/S430A and E552A/E1197A/S1073A were deficient in tight binding of MgATP and MgADP (Figures 4 and 5).
X
ABCB4 p.Ser430Ala 16171403:211:53
status: NEW
Login to comment

PMID: 10831598 [PubMed] Urbatsch IL et al: "Conserved walker A Ser residues in the catalytic sites of P-glycoprotein are critical for catalysis and involved primarily at the transition state step."
No. Sentence Comment
49 EXPERIMENTAL PROCEDURES Introduction of S430A, S430T, S1073A, and S1073T Mutations into Mouse mdr3 cDNA-Site-directed mutagenesis used the commercially available Altered Sites II method from Promega.
X
ABCB4 p.Ser430Ala 10831598:49:40
status: NEW
Login to comment

52 The mutagenic oligonucleotide for the S430A mutation was: GCTGTGGAAAAGCGACAACTGTCCAG in which the underlined GCG (Ala) replaced AGC (Ser) and introduced a PshAI site.
X
ABCB4 p.Ser430Ala 10831598:52:38
status: NEW
Login to comment

64 Mutations were transferred into plasmid pHIL-mdr3.5-His6 (24) using the following restriction fragments: S430A and S430T, BglII- SmaI; S1073A and S1073T, SpeI-SnaBI.
X
ABCB4 p.Ser430Ala 10831598:64:105
status: NEW
Login to comment

140 We generated mutations S430A, S430T, S1073A, and S1073T in mouse MDR3 Pgp, in order to study the catalytic role of these Ser residues.
X
ABCB4 p.Ser430Ala 10831598:140:23
status: NEW
Login to comment

175 No significant ATPase activity was seen at any concentration of Mg2ϩ with either S430A or S1073A.
X
ABCB4 p.Ser430Ala 10831598:175:87
status: NEW
Login to comment

190 Fig. 4 shows results for wild-type, S430A, and S430T with 2.5 ␮M nucleotide.
X
ABCB4 p.Ser430Ala 10831598:190:36
status: NEW
Login to comment

194 From Fig. 4 it is clear that, in mutants and wild-type, degree of labeling was the same in the S430A, S430T, and wild-type Pgp.
X
ABCB4 p.Ser430Ala 10831598:194:95
status: NEW
Login to comment

204 TABLE I MgATPase activity of wild-type and mutant Pgp preparations Mutant Pgp Specific ATPase activity KM(MgATP)a Kapp(verapamil)b No verapamil Plus verapamila ␮mol/min/mg mM ␮M Wild-type 0.3 4.0 (13-fold) 0.44 6.0 S430A NSc NSc S430T 0.26 3.3 (13-fold) 0.53 3.0 S1073A NSc NSc S1073T 0.18 3.2 (18-fold) 0.47 5.0 a Verapamil was included at 150 ␮M, shown to be sufficient for maximal stimulation of activity.
X
ABCB4 p.Ser430Ala 10831598:204:229
status: NEW
Login to comment

212 Fig. 5A shows photolabeling of lipid-activated wild-type Pgp by 8-azido-[32 P]ATP. Fig. 5B shows that other nucleotide substrates, including natural ATP, competed well with 8-azido- ATP. Fig. 5 (C-F) shows results obtained with S430A, S430T, S1073A, and S1073T mutants.
X
ABCB4 p.Ser430Ala 10831598:212:228
status: NEW
Login to comment

216 The point that lack of ATPase activity in the S430A and S1073A mutants is not due to lack of substrate binding is therefore confirmed.
X
ABCB4 p.Ser430Ala 10831598:216:46
status: NEW
Login to comment

217 An unexpected finding was that S430A and S1073A mutants showed the same modulation of 8-azido-ATP binding by increasing Mg2ϩ concentration as wild-type.
X
ABCB4 p.Ser430Ala 10831598:217:31
status: NEW
Login to comment

223 No trapping of Mg[␣- 32 P]ADP occurred in S430A and S1073A mutants, showing that, although they could bind MgATP (see above), these mutants could not attain the catalytic transition state, in either their mutated or intact nucleotide site.
X
ABCB4 p.Ser430Ala 10831598:223:49
status: NEW
Login to comment

227 This showed that direct photolabeling is strongly disfavored in the transition state conformation.4 Vi Trapping of 8-Azido-[␣-32 P]ADP with Different Metals-It was shown above that S430T and S1073T mutants showed a different spectrum of ATPase activities from wild-type with varied metal cofactors and, interestingly, that S430A and S1073A mutants, which were inactive with MgATP as substrate, nevertheless showed very low hydrolysis activity with MnATP, CoATP and CaATP (Fig. 3).
X
ABCB4 p.Ser430Ala 10831598:227:330
status: NEW
Login to comment

232 With S430A and S1073A mutants, no trapping was seen with Mg2ϩ , agreeing with ATPase assays (Fig. 3), but low levels of trapping were seen with Mn2ϩ and Co2ϩ .
X
ABCB4 p.Ser430Ala 10831598:232:5
status: NEW
Login to comment

234 The autoradiogams identify the very low ATPase activity with Mn- and Co-nucleotide as due to S430A and S1073A Pgp.
X
ABCB4 p.Ser430Ala 10831598:234:93
status: NEW
Login to comment

235 However, no trapped nucleotide was evident with Ca2ϩ in S430A or S1073A, possibly because the rate of dissociation of Vi-trapped Ca-8-azido-ADP is rapid compared with the hydrolysis rate.
X
ABCB4 p.Ser430Ala 10831598:235:62
status: NEW
Login to comment

239 Metal dependence of ATPase activity of S430A and S1073A mutant Pgp.
X
ABCB4 p.Ser430Ala 10831598:239:39
status: NEW
Login to comment

242 A, S430A Pgp; B, S1073A Pgp.
X
ABCB4 p.Ser430Ala 10831598:242:3
status: NEW
Login to comment

248 b t1/2, half-time for reactivation of ATPase at 37 °C. DISCUSSION General-In this work we examined the mutants S430A, S430T, S1073A, and S1073T, affecting the Ser residue at the end of the Walker A sequence of the Nand C-terminal ATP-binding sites of mouse MDR3 P-glycoprotein.
X
ABCB4 p.Ser430Ala 10831598:248:117
status: NEW
Login to comment

269 After irradiation, protein was run on SDS gels and subjected to autoradiography. A, wild-type Pgp; B, S430A mutant; C, S430T mutant.
X
ABCB4 p.Ser430Ala 10831598:269:102
status: NEW
Login to comment

272 Panels A and C-F, Pgp (2 ␮g) was incubated with 2.5 ␮M 8-azido-[␣-32 P]ATP and 150 ␮M verapamil in presence of increasing concentration of MgCl2 (the zero Mg2ϩ lane had 1 mM EDTA), irradiated by UV light, and the protein run on SDS gels then subjected to autoradiography. A, wild-type; C, S430A; D, S430T; E, S1073A; F, S1073T.
X
ABCB4 p.Ser430Ala 10831598:272:323
status: NEW
Login to comment