ABCMdb

PMID: 10831598

Urbatsch IL, Gimi K, Wilke-Mounts S, Senior AE
Conserved walker A Ser residues in the catalytic sites of P-glycoprotein are critical for catalysis and involved primarily at the transition state step.
J Biol Chem. 2000 Aug 11;275(32):25031-8., [PubMed]

Sentences

No. Mutations Sentence Comment

49 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr EXPERIMENTAL PROCEDURES Introduction of S430A, S430T, S1073A, and S1073T Mutations into Mouse mdr3 cDNA-Site-directed mutagenesis used the commercially available Altered Sites II method from Promega. Login to comment 52 ABCB4 p.Ser430Ala The mutagenic oligonucleotide for the S430A mutation was: GCTGTGGAAAAGCGACAACTGTCCAG in which the underlined GCG (Ala) replaced AGC (Ser) and introduced a PshAI site. Login to comment 57 ABCB4 p.Ser430Thr The S430T mutation was obtained as follows. Login to comment 64 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr Mutations were transferred into plasmid pHIL-mdr3.5-His6 (24) using the following restriction fragments: S430A and S430T, BglII- SmaI; S1073A and S1073T, SpeI-SnaBI. Login to comment 140 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr We generated mutations S430A, S430T, S1073A, and S1073T in mouse MDR3 Pgp, in order to study the catalytic role of these Ser residues. Login to comment 159 ABCB4 p.Ser430Thr Fig. 2 shows results obtained for wild-type, S430T, and S1073T mutants. Login to comment 160 ABCB4 p.Ser430Thr It is seen that maximal MgATPase activity of S430T and S1073T was around 80% of wild-type, and was obtained at equimolar concentration of Mg2ϩ and ATP as in wild-type. Login to comment 175 ABCB4 p.Ser430Ala No significant ATPase activity was seen at any concentration of Mg2ϩ with either S430A or S1073A. Login to comment 180 ABCB4 p.Ser430Thr Inhibition of MgATPase Activity of S430T and S1073T Mutant Pgp by Vanadate, Fluoroaluminate, and Beryllium Fluoride-Vi and AlFx are transition state analogs that trap MgADP tenaciously in the catalytic sites of Pgp, while BeFx is a ground-state analog that traps MgADP and mimics bound MgATP. Login to comment 190 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr Fig. 4 shows results for wild-type, S430A, and S430T with 2.5 ␮M nucleotide. Login to comment 194 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr From Fig. 4 it is clear that, in mutants and wild-type, degree of labeling was the same in the S430A, S430T, and wild-type Pgp. Login to comment 200 ABCB4 p.Ser430Thr Metal dependence of ATPase activity of wild-type, S430T, and S1073T mutant Pgp. Login to comment 202 ABCB4 p.Ser430Thr E, wild-type; ƒ, S430T; Ⅺ, S1073T. Login to comment 204 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr TABLE I MgATPase activity of wild-type and mutant Pgp preparations Mutant Pgp Specific ATPase activity KM(MgATP)a Kapp(verapamil)b No verapamil Plus verapamila ␮mol/min/mg mM ␮M Wild-type 0.3 4.0 (13-fold) 0.44 6.0 S430A NSc NSc S430T 0.26 3.3 (13-fold) 0.53 3.0 S1073A NSc NSc S1073T 0.18 3.2 (18-fold) 0.47 5.0 a Verapamil was included at 150 ␮M, shown to be sufficient for maximal stimulation of activity. Login to comment 212 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr Fig. 5A shows photolabeling of lipid-activated wild-type Pgp by 8-azido-[32 P]ATP. Fig. 5B shows that other nucleotide substrates, including natural ATP, competed well with 8-azido- ATP. Fig. 5 (C-F) shows results obtained with S430A, S430T, S1073A, and S1073T mutants. Login to comment 216 ABCB4 p.Ser430Ala The point that lack of ATPase activity in the S430A and S1073A mutants is not due to lack of substrate binding is therefore confirmed. Login to comment 217 ABCB4 p.Ser430Ala An unexpected finding was that S430A and S1073A mutants showed the same modulation of 8-azido-ATP binding by increasing Mg2ϩ concentration as wild-type. Login to comment 220 ABCB4 p.Ser430Thr Vi Trapping of Mg-[␣-32 P]ADP-Development of the centrifuge column procedure for use with pure Pgp allowed Vi trapping procedures to be carried out with the natural substrate MgATP, and for stoichiometry of trapped nucleotide to be calculated for the first time with pure protein. Fig. 6 shows that wild-type, S430T, and S1073T mutants each trapped Mg[␣- 32 P]ADP to the extent of 0.90-0.96 mol/mol of Pgp. Login to comment 223 ABCB4 p.Ser430Ala No trapping of Mg[␣- 32 P]ADP occurred in S430A and S1073A mutants, showing that, although they could bind MgATP (see above), these mutants could not attain the catalytic transition state, in either their mutated or intact nucleotide site. Login to comment 227 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr This showed that direct photolabeling is strongly disfavored in the transition state conformation.4 Vi Trapping of 8-Azido-[␣-32 P]ADP with Different Metals-It was shown above that S430T and S1073T mutants showed a different spectrum of ATPase activities from wild-type with varied metal cofactors and, interestingly, that S430A and S1073A mutants, which were inactive with MgATP as substrate, nevertheless showed very low hydrolysis activity with MnATP, CoATP and CaATP (Fig. 3). Login to comment 229 ABCB4 p.Ser430Thr With wild-type, S430T, and S1073T, Vi trapping occurred with all four divalent metals, but not in presence of EDTA. Login to comment 232 ABCB4 p.Ser430Ala With S430A and S1073A mutants, no trapping was seen with Mg2ϩ , agreeing with ATPase assays (Fig. 3), but low levels of trapping were seen with Mn2ϩ and Co2ϩ . Login to comment 234 ABCB4 p.Ser430Ala The autoradiogams identify the very low ATPase activity with Mn- and Co-nucleotide as due to S430A and S1073A Pgp. Login to comment 235 ABCB4 p.Ser430Ala However, no trapped nucleotide was evident with Ca2ϩ in S430A or S1073A, possibly because the rate of dissociation of Vi-trapped Ca-8-azido-ADP is rapid compared with the hydrolysis rate. Login to comment 239 ABCB4 p.Ser430Ala Metal dependence of ATPase activity of S430A and S1073A mutant Pgp. Login to comment 242 ABCB4 p.Ser430Ala A, S430A Pgp; B, S1073A Pgp. Login to comment 243 ABCB4 p.Ser430Thr TABLE II Inhibition of S430T and S1073T mutant Pgp by vanadate, fluoroaluminate, and beryllium fluoride, and reactivation rate after inhibition ATPase activity was assayed at 37 °C in presence of 1 mM NaATP, 3 mM MgCl2, 150 ␮M verapamil, for 20 min, pH 7.5, at 37 °C in presence of Vi, AlFx, or BeFx added at varying concentration. Login to comment 247 ABCB4 p.Ser430Thr Mutant Pgp Vanadate Fluoroaluminate Beryllium fluoride IC50 a t1/2 b IC50 a t1/2 b IC50 a t1/2 b ␮M min ␮M min ␮M min Wild-type 1.0 81 5.0 5.4 9.0 38 S430T 2.0 89 10 5.7 10 39 S1073T 2.0 73 10 5.5 15 40 a IC50, concentration at which 50% inhibition was observed. Login to comment 248 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr b t1/2, half-time for reactivation of ATPase at 37 °C. DISCUSSION General-In this work we examined the mutants S430A, S430T, S1073A, and S1073T, affecting the Ser residue at the end of the Walker A sequence of the Nand C-terminal ATP-binding sites of mouse MDR3 P-glycoprotein. Login to comment 269 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr After irradiation, protein was run on SDS gels and subjected to autoradiography. A, wild-type Pgp; B, S430A mutant; C, S430T mutant. Login to comment 272 ABCB4 p.Ser430Ala ABCB4 p.Ser430Thr Panels A and C-F, Pgp (2 ␮g) was incubated with 2.5 ␮M 8-azido-[␣-32 P]ATP and 150 ␮M verapamil in presence of increasing concentration of MgCl2 (the zero Mg2ϩ lane had 1 mM EDTA), irradiated by UV light, and the protein run on SDS gels then subjected to autoradiography. A, wild-type; C, S430A; D, S430T; E, S1073A; F, S1073T. Login to comment