ABCB1 p.Arg538Met
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 15155846
[PubMed]
Ren XQ et al: "Function of the ABC signature sequences in the human multidrug resistance protein 1."
No.
Sentence
Comment
32
Mutation of the MDR1 signature sequence at R538M also showed greatly decreased ATPase activity, although some amino acid replacements in the ABC signature region did not affect the ATPase function of MDR1 (Bakos et al., 1997).
X
ABCB1 p.Arg538Met 15155846:32:43
status: NEW
PMID: 9169612
[PubMed]
Bakos E et al: "Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region."
No.
Sentence
Comment
18
insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity.
X
ABCB1 p.Arg538Met 9169612:18:87
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Arg538Met 9169612:38:311
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Arg538Met 9169612:64:131
status: NEWX
ABCB1 p.Arg538Met 9169612:64:221
status: NEW73 In immunoflow cytometry experiments, the mutant MDR1 proteins G534D, R538M and I541R were recognized by both monoclonal antibodies, in a manner indistinguishable from that of the wild-type protein (Figure 3).
X
ABCB1 p.Arg538Met 9169612:73:69
status: NEW90 An interesting finding was that the MDR1 mutant R538M showed a reduced maximal level of drug-stimulated ATPase activity in the presence of each of the four drugs studied.
X
ABCB1 p.Arg538Met 9169612:90:48
status: NEW95 As demonstrated in Figure 5, the ATPase reaction catalysed by the R538M mutant MDR1 also had a similar KATP m value as the Figure 5 MgATP-concentration-dependence of vanadate-sensitive ATPase activity in isolated Sf9 cell membranes The ATPase activity of the isolated Sf9 cell membranes was estimated by measuring Pi liberation in the presence of 30 µM verapamil, as described in the Experimental section.
X
ABCB1 p.Arg538Met 9169612:95:66
status: NEW145 In the central polar region of the ABC signature, the replacement of arginine at position 538 with methionine (R538M) created an MDR1 protein with a lowered maximum level of drug-stimulated ATPase activity (approx.
X
ABCB1 p.Arg538Met 9169612:145:69
status: NEWX
ABCB1 p.Arg538Met 9169612:145:111
status: NEW147 This difference was observed with each of the four drugs used in this study (Figure 4), suggesting that the R538M MDR1 shows lower maximum activity but not altered substrate specificity.
X
ABCB1 p.Arg538Met 9169612:147:108
status: NEW154 The (fully expressed) R538M mutant had decreased maximum MDR1 ATPase activity, while the G534D and I541R mutants showed a complete loss of activity despite retaining a wild-type ABC signature region in the C-terminal half of the protein.
X
ABCB1 p.Arg538Met 9169612:154:22
status: NEW
PMID: 16352426
[PubMed]
Ambudkar SV et al: "The power of the pump: mechanisms of action of P-glycoprotein (ABCB1)."
No.
Sentence
Comment
53
Hoof et al. (1994) Human L531R Decreased cell surface expression Bakos et al. (1997) G534V K536I Normal cell surface expression K536R Normal ATP hydrolysis I541T R543S LSGGQ or linker peptide or signature motif Human R538M Normal cell surface expression Decreased ATP hydrolysis Bakos et al. (1997) I541R Normal cell surface expression No ATP hydrolysis Walker B Mouse D551N D1196N No ATP hydrolysis, required for Mg2+ binding Urbatsch et al. (1998) Human D555A D1200A Same as above Hrycyna et al. (1999) Walker B Mouse E552A E1197A Trapping of ATP, no steady-state hydrolysis Tombline et al. (2004b) Mouse E552Q E1197Q No steady-state ATP hydrolysis Vigano et al. (2002) Human E556A E1201A Trapping of ATP or ADP in the absence of vanadate, low levels of ATP hydrolysis Sauna et al. (2002) D-loop Mouse D558N D1203N Decreased ATP hydrolysis Urbatsch et al. (2000b) the ABC transporter superfamily.
X
ABCB1 p.Arg538Met 16352426:53:217
status: NEW