ABCB1 p.Arg588Cys
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 15049699
[PubMed]
Omote H et al: "Improved energy coupling of human P-glycoprotein by the glycine 185 to valine mutation."
No.
Sentence
Comment
58
YEpMDR1His∆CysG185C (glycine 185 to cysteine) and YEpMDR1His∆CysR588C (arginine 588 to cysteine) were generated by PCR mutagenesis using a set of primers (AAGATTAATGAATGTATTGGTGACAAA and TTTGT- CACCAATACATTCTTATAATTC, forward and reverse, respectively, for G185C, GTGATAGCTCATTGTTTGTC- TACAGTT and AACTGTAGACAAACAATGAGCTAT- CAC for R588C).
X
ABCB1 p.Arg588Cys 15049699:58:85
status: NEWX
ABCB1 p.Arg588Cys 15049699:58:346
status: NEW270 For comparison, the partially buried spin-labeled R588C/Cys(-), which is located near the surface region of the catalytic domain (see Figure 7), showed a smaller center peak width (3.7 ( 0.04 G).
X
ABCB1 p.Arg588Cys 15049699:270:50
status: NEW272 In contrast, for R588C-SL, the mobility of the spin probe increased in the presence of ATP (∆∆H0 ) -0.11 G) and stayed nearly constant with drugs (∆∆H0 ) +0.01 G for verapamil) but was the most mobile in the presence of both ligands (∆∆H0 ) -0.28 G).
X
ABCB1 p.Arg588Cys 15049699:272:17
status: NEW