ABCB1 p.Met986Val
| Predicted by SNAP2: | A: D (71%), C: D (66%), D: D (85%), E: D (80%), F: N (57%), G: D (75%), H: D (85%), I: N (57%), K: D (91%), L: N (53%), N: D (80%), P: D (91%), Q: N (53%), R: D (80%), S: D (75%), T: N (57%), V: N (53%), W: D (66%), Y: D (71%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]
Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.
Comments [show]
None has been submitted yet.
No. Sentence Comment
126 In addition to the possible decrease in expression levels, ATPase activity in the ABCG2 +24 Intron 20 G A +40 Intron 20 C T 2547 Exon 21 A G 849 Ile to Met 2650 Exon 21 C T 884 Syn 2677 Exon 21 G T 893 Ala to Ser 2677# Exon 21 G A 893 Ala to Thr +31 Intron 22 G A 2956 Exon 24 A G 986 Met to Val 2995 Exon 24 G A 999 Ala to Thr 3151 Exon 25 C G 1051 Pro to Ala 3320 Exon 26 A C 1107 Gln to Pro 3322 Exon 26 T C 1108 Trp to Arg 3396 Exon 26 C T 1132 Syn 3421 Exon 26 T A 1141 Ser to Thr 3435** Exon 26 C T 1145 Syn 3751 Exon 28 G A 1251 Val to Ile 3767 Exon 28 C A 1256 Thr to Lys 4030 Exon 28 G C Non-coding 4036 Exon 28 A G Non-coding +21 Intron 28 T C Table 2. Summary of common genetic variants in the ABCB1 gene (continued) *cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758 with an A as the reference at position 43.
X
ABCB1 p.Met986Val 15882131:126:281
status: NEW[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]
Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
106 Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % 61 A G 21 Asn 21 Asp 799 89.7 10.3 193 100 0 100 97.5 2.5 266 T C 89 Met 89 Thr 100 99.5 0.5 145 100 0 100 100 0 307 T C 103 Phe 103 Leu 546 99.9 0.1 48 100 0 ND ND ND 325 G A 108 Glu 108 Lys ND ND ND 37 95.9 4.1 ND ND ND 781 A G 261 Ile 261 Val 100 100 0 145 100 0 100 98.5 1.5 1199 G A 400 Ser 400 Asn 696 95.0 5.0 193 100 0 100 99 1 1985 T G 662 Leu 662 Arg 100 99.5 0.5 145 100 0 100 100 0 2005 C T 669 Arg 669 Cys 100 100 0 145 100 0 100 99 1 2485 A G 829 Ile 829 Val 185 99.2 0.8 ND ND ND ND ND ND 2547 A G 849 Ile 849 Met 100 99.5 0.5 145 100 0 100 100 0 2677 G T A 893 Ala 893 Ser 893 Thr 611 55.1 42.1 2.8 241 40.0 41.1 18.9 100 90 10 0.5 2956 A G 986 Met 986 Val ND ND ND 100 99.5 0.5 ND ND ND 3151 C G 1051 Pro 1051 Ala 100 100 0 145 100 0 100 99.5 0.5 3320 A C 1107 Gln 1107 Pro 461 99.8 0.2 ND ND ND ND ND ND 3322 T C 1108 Trp 1108 Arg 100 100 0 145 100 0 100 99.5 0.5 3421 T A 1141 Ser 1141 Thr 100 100 0 145 100 0 100 88.9 11.1 3751 G A 1251 Val 1251 Ile 100 100 0 145 99 1 100 100 0 3767 C A 1256 Thr 1256 Lys 100 99.5 0.5 145 100 0 100 100 0 Data from [31-38, 203].
X
ABCB1 p.Met986Val 16259577:106:822
status: NEW115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis.
X
ABCB1 p.Met986Val 16259577:115:157
status: NEW124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity.
X
ABCB1 p.Met986Val 16259577:124:67
status: NEW129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2.
X
ABCB1 p.Met986Val 16259577:129:105
status: NEW[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]
Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.
Comments [show]
None has been submitted yet.
No. Sentence Comment
167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis.
X
ABCB1 p.Met986Val 16399366:167:106
status: NEW[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]
Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.
Comments [show]
None has been submitted yet.
No. Sentence Comment
761 0.09d c. 61 A>G N21D 0.11d IVS 5-35 G>C intronic 0.006c IVS 5-25 G>T intronic 0.16c IVS 6+139 C>T intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T synonymous 0.41d IVS 12+44 C>T intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17-76 T>A intronic 0.46d IVS 17+137 A>G intronic 0.006c c. 2650 C>T synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T synonymous 0.54e c. 4030 G >C synonymous 0.005b c. 4036 A>G synonymous 0.30b a Taniguchi et al. (2003).
X
ABCB1 p.Met986Val 16766035:761:378
status: NEW[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]
Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 Functional Significance of ABCB1 SNPs Table6.3 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies (134) Position Amino acid or effect Frequency of the variant allele 5'-Flanking -2903 T>C 0.02a 5'-Flanking -2410 T>C 0.10a 5'-Flanking -2352 G>A 0.28a 5'-Flanking -1910 T>C 0.10a 5'-Flanking -1717 T>C 0.02a 5'-Flanking -1325 A>G 0.02a 5'-Flanking -934 A>G 0.10a 5'-Flanking -692 T>C 0.10a 5'-Flanking -41 A>G 0.09b IVS 1a -145 C>G 0.02b IVS 1b -129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 -1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 -35 G>C Intronic 0.006c IVS 5 -25 G>T Intronic 0.16c IVS 6 +139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T Synonymous 0.41d IVS 12 +44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 -76 T>A Intronic 0.46d IVS 17 +137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d c. 4030 Synonymous 0.005b c. 4036 Synonymous 0.30b References: a [42], b [26], c [25], d [28], e [23] with lower activity or expression in Caucasians.
X
ABCB1 p.Met986Val 19949922:52:926
status: NEW[hide] Genetic polymorphisms of the human MDR1 drug trans... Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10. Schwab M, Eichelbaum M, Fromm MF
Genetic polymorphisms of the human MDR1 drug transporter.
Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10., [PMID:12359865]
Abstract [show]
P-glycoprotein is an ATP-dependent efflux pump that contributes to the protection of the body from environmental toxins. It transports a huge variety of structurally diverse compounds. P-glycoprotein is involved in limiting absorption of xenobiotics from the gut lumen, in protection of sensitive tissues (brain, fetus, testis), and in biliary and urinary excretion of its substrates. P-glycoprotein can be inhibited or induced by xenobiotics, thereby contributing to variable drug disposition and drug interactions. Recently, several SNPs have been identified in the MDR1 gene, some of which can affect P-glycoprotein expression and function. Potential implications of MDR1 polymorphisms for drug disposition, drug effects, and disease risk are discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
60 In a Northern Italian population, the extent of linkage disequilibrium TABLE 2 Summary of MDR1 genetic variants in different ethnic groups Location Position Allele Effect Reference promotor 5 flanking/-41a A (28) G exon 1a exon 1a/-145 C (28) G exon 1b exon 1b/-129 T (25, 33) C intron 1 exon 2/-4 C (29) T intron 1 exon 2/-1 G initiation of translation (25, 27, 29) A exon 2 exon 2/61 A Asn21Asp (25-27, 29) G intron 4 exon 5/-35 G (25) C intron 4 exon 5/-25 G (25) T exon 5 exon 5/307 T Phe103Leu (25) C intron 6 exon 6/+139 C (25, 27) T intron 6 exon 6/+145 C (25) T exon 7 exon 7/548 A Asn183Ser (29) G exon 11 exon 11/1199 G Ser400Asn (25, 27, 29) A exon 12 exon 12/1236 C wobble (23, 25, 27, 29) T (Gly412Gly) intron 12 exon 12/+44 C (25, 27) T exon 13 exon 13/1474 C Arg492Cys (29) T intron 16 exon 17/-76 T (25, 27) A intron 17 exon 17/137 A (25) G exon 21 exon 21/2650 C wobble (29) T (Leu884Leu) (Continued ) TABLE 2 (Continued) Location Position Allele Effect Reference exon 21 exon 21/2677 G (22, 23, 27, 29) T Ala893Ser A Ala893Thr exon 24 exon 24/2956 A Met986Val (33) G exon 24 exon 24/2995 G Ala999Thr (22) A exon 26 exon 26/3320 A Gln1107Pro (27) C exon 26 exon 26/3396 C wobble (25) T exon 26 exon 26/3421 T Ser1141Thr (29, 30) A exon 26 exon 26/3435 C wobble (23, 25, 29) T (Ile1145Ile) exon 28 exon 28/4030 G (33) C exon 28 exon 28/4036 A (23, 33) G The positions of the polymorphisms correspond to positions of MDR1 cDNA with the first base of the ATG start codon set to 1 (GenBank accession # M14758).
X
ABCB1 p.Met986Val 12359865:60:1073
status: NEW[hide] MDR1 genotype-related pharmacokinetics and pharmac... Biol Pharm Bull. 2002 Nov;25(11):1391-400. Sakaeda T, Nakamura T, Okumura K
MDR1 genotype-related pharmacokinetics and pharmacodynamics.
Biol Pharm Bull. 2002 Nov;25(11):1391-400., [PMID:12419946]
Abstract [show]
The multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. MDR1 acts as an energy-dependent efflux pump that exports its substrates out of cells. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multidrug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and detected 15 single nucleotide polymorphisms (SNPs). They also indicated that a polymorphism in exon 26 at position 3435 (C3435T), a silent mutation, affected the expression level of MDR1 protein in duodenum, and thereby the intestinal absorption of digoxin. To date, the genotype frequencies of C3435T have been investigated extensively using a larger population and interethnic difference has been elucidated, and a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on MDR1 genotype-related MDR1 expression and pharmacokinetics have also been performed around the world; however, results were not always consistent with Hoffmeyer's report. In this review, published reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping. In addition, recent investigations have raised the possibility that MDR1 and related transporters play a fundamental role in regulating apoptosis and immunology, and in fact, there are reports of MDR1-related susceptibility to inflammatory bowel disease, HIV infection and renal cell carcinoma. Herein, these issues are also summarized, and the current status of the knowledge in the area of pharmacogenomics of other transporters is briefly introduced.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 In 2001, Hitzl et al. also indicated that healthy Caucasian subjects with T/T3435 had a more decreased efflux of rhodamine from CD56ϩ NK cells and a lower MDR1 mRNA expression in leukocytes than those with C/C3435 .65) In renal tissues, the C3435T polymorphism is reported to be associated with reduced MDR1 expression.31) However, Tanabe et al. suggested that C3435T had no effect on the placental MDR1 expression based on 89 subjects and Western blotting.53) We determined MDR1 mRNA levels in biopsy specimens of the duodenum obtained from 13 healthy Japanese subjects by real time quantitative RT-PCR and found that MDR1 mRNA expression was higher in T/T3435 than C/C3435 or C/T3435 (Fig. 1).66) The discrepancies between the reports might be ex- November 2002 1393 Table 2. Summary of Genetic Polymorphisms in MDR1 Position Location Effect A1a/-41G Intron Noncoding C-145G Exon 1a Noncoding T-129C (T12C) Exon 1b Noncoding C-4T Exon 2 Noncoding G-1A Exon 2 Noncoding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/ϩ139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/ϩ44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/ϩ137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent This list was based on the literature (refs. 49-54).
X
ABCB1 p.Met986Val 12419946:56:1323
status: NEW[hide] Pharmacogenetics of MDR1 and its impact on the pha... Pharmacogenomics. 2003 Jul;4(4):397-410. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmacodynamics of drugs.
Pharmacogenomics. 2003 Jul;4(4):397-410., [PMID:12831320]
Abstract [show]
The multi-drug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multi-drug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and indicated that a single nucleotide polymorphism (SNP), C3435T in exon 26, which caused no amino acid change, was associated with the duodenal expression of MDR1 and thereby the plasma concentrations of digoxin after oral administration. Interethnic differences in genotype frequencies of C3435T have been clarified, and, at present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on the effects of C3435T on MDR1 expression and function in the tissues, and also on the pharmacokinetics and pharmacodynamics have been performed around the world; however, there are still discrepancies in the results, suggesting that the haplotype analysis of the gene should be included instead of SNP detection, and the design of clinical trials must be carefully planned to avoid misinterpretations. A polymorphism of C3435T is also reported to be a risk factor for a certain class of diseases such as the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this might also be explained by the effects on MDR1 expression and function. In this review, the latest reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping.
Comments [show]
None has been submitted yet.
No. Sentence Comment
75 Position Location Effect A1a/-41G Intron Non-coding C-145G Exon 1a Non-coding T-129C (T12C) Exon 1b Non-coding C-4T Exon 2 Non-coding G-1A Exon 2 Non-coding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/+139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/+44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/+137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent See references [34-39].
X
ABCB1 p.Met986Val 12831320:75:485
status: NEW[hide] P-glycoprotein: from genomics to mechanism. Oncogene. 2003 Oct 20;22(47):7468-85. Ambudkar SV, Kimchi-Sarfaty C, Sauna ZE, Gottesman MM
P-glycoprotein: from genomics to mechanism.
Oncogene. 2003 Oct 20;22(47):7468-85., 2003-10-20 [PMID:14576852]
Abstract [show]
Resistance to chemically different natural product anti-cancer drugs (multidrug resistance, or MDR) results from decreased drug accumulation, resulting from expression of one or more ATP-dependent efflux pumps. The first of these to be identified was P-glycoprotein (P-gp), the product of the human MDR1 gene, localized to chromosome 7q21. P-gp is a member of the large ATP-binding cassette (ABC) family of proteins. Although its crystallographic 3-D structure is yet to be determined, sequence analysis and comparison to other ABC family members suggest a structure consisting of two transmembrane (TM) domains, each with six TM segments, and two nucleotide-binding domains. In the epithelial cells of the gastrointestinal tract, liver, and kidney, and capillaries of the brain, testes, and ovaries, P-gp acts as a barrier to the uptake of xenobiotics, and promotes their excretion in the bile and urine. Polymorphisms in the MDR1 gene may affect the pharmacokinetics of many commonly used drugs, including anticancer drugs. Substrate recognition of many different drugs occurs within the TM domains in multiple-overlapping binding sites. We have proposed a model for how ATP energizes transfer of substrates from these binding sites on P-gp to the outside of the cell, which accounts for the apparent stoichiometry of two ATPs hydrolysed per molecule of drug transported. Understanding of the biology, genetics, and biochemistry of P-gp promises to improve the treatment of cancer and explain the pharmacokinetics of many commonly used drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
85 Kioka et al. (1989) showed a slight increase in resistance to doxorubicin, but no effect on colchicine or vinblastine Table 2 Common MDR1 exonic polymorphisms Exon number Polymorphic nucleotide variant Change in amino acid References 1 À145 - Ito et al. (2001) 1 À129 - Hoffmeyer et al. (2000); Tanabe et al. (2001) 2 61 N21D Cascorbi et al. (2001); Decleves et al. (2000); Hoffmeyer et al. (2000); Kim et al. (2001) 5 307 F103L Hoffmeyer et al. (2000) 7 548 N183S Kim et al. (2001) 10 1107 G369P Hoffmeyer et al. (2000) 11 1199 S400N Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001) 12 1236 Wobble Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 13 1474 R492C Kim et al. (2001) 21 2650 Wobble Kim et al. (2001) 21 2677 893A, S, or T Cascorbi et al. (2001); Kim et al. (2001); Kioka et al. (1989); Mickley et al. (1998) 24 2956 M986V Tanabe et al. (2001) 24 2995 A999T Mickley et al. (1998) 26 3320 Q1107P Cascorbi et al. (2001) 26 3396 Wobble Hoffmeyer et al. (2000) 26 3421 S1141T Kim et al. (2001) 26a 3435 Wobble Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 28 4030 - Tanabe et al. (2001) 28 4036 - Kioka et al. (1989); Tanabe et al. (2001) a The only polymorphism that correlates with changes in drug delivery and disposition P-glycoprotein SV Ambudkar et al resistance in the SNP located on exon 21, position 2677, Ser893 (Kioka et al., 1989).
X
ABCB1 p.Met986Val 14576852:85:896
status: NEW[hide] Polymorphisms in human MDR1 (P-glycoprotein): rece... Clin Pharmacol Ther. 2004 Jan;75(1):13-33. Marzolini C, Paus E, Buclin T, Kim RB
Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance.
Clin Pharmacol Ther. 2004 Jan;75(1):13-33., [PMID:14749689]
Abstract [show]
Drug transporters are increasingly recognized to be important to drug disposition and response. P-glycoprotein, the encoded product of the human MDR1 (ABCB1) gene, is of particular clinical relevance in that this transporter has broad substrate specificity, including a variety of structurally divergent drugs in clinical use today. Moreover, expression of this efflux transporter in certain tissue compartments such as the gastrointestinal tract and brain capillary endothelial cells limits oral absorption and central nervous system entry of many drugs. Recently, a number of single-nucleotide polymorphisms (SNPs) in MDR1 have been identified. An increasing number of studies have also implicated certain commonly occurring SNPs in MDR1 in problems including altered drug levels and host susceptibility to diseases such as Parkinson's disease, inflammatory bowel disease, refractory seizures, and CD4 cell recovery during human immunodeficiency virus therapy. However, in many such cases, the reported effects of MDR1 SNPs have been inconsistent and, in some cases, conflicting. In this review SNPs in MDR1 in relation to population frequencies, drug levels, and phenotypes are outlined. In addition, issues relating to MDR1 haplotypes, environmental factors, and study design, as potential confounding factors of the observed MDR1 polymorphism effect in vivo, are also discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
75 Summary of genetic polymorphisms in MDR1 Location Position Mutation Effect Mutant allele frequency (%) Hoffmeyer et al89 : C Cascorbi et al90 : C Siegmund et al91 : C Promotor 5' flanking/-41 A/G Noncoding Exon 1a Exon 1a/-145 C/G Noncoding Exon 1b Exon 1b/-129 T/C Noncoding 5.9 Intron 1 Exon 2/-4 C/T Noncoding Intron 1 Exon 2/-1 G/A Initial translation 5.6 9 3.7 Exon 2 Exon 2/61 A/G Asn21Asp 9.3 11.2 8.9 Intron 4 Exon 5/-35 G/C 0.6 Intron 4 Exon 5/-25 G/T 16.5 Exon 5 Exon 5/307 T/C Phe103Leu 0.6 0 Intron 6 Exon 6/ϩ139 C/T 40.6 37.2 35.8 Intron 6 Exon 6/ϩ145 C/T 1.2 Exon 7 Exon 7/548 A/G Asn183Ser Exon 11 Exon 11/1199 G/A Ser400Asn 6.5 5.5 2.9 Exon 12 Exon 12/1236 C/T Silent 37.8 41 34.3 Intron 12 Exon 12/ϩ44 C/T 5.9 4.9 7.5 Exon 13 Exon 13/1474 C/T Arg492Cys Intron 16 Exon 17/-76 T/A 45.3 46.2 49.3 Intron 17 Exon 17/ϩ137 A/G 0.6 Exon 21 Exon 21/2650 C/T Silent Exon 21 Exon 21/2677 G/T Ala893Ser 41.6 40.3 G/A Ala893Thr 1.9 3.7 Exon 24 Exon 24/2956 A/G Met986Val Exon 24 Exon 24/2995 G/A Ala999Thr Exon 26 Exon 26/3320 A/C Gln1107Pro 0.2 Exon 26 Exon 26/3396 C/T Silent 0.3 Exon 26 Exon 26/3421 T/A Ser1141Thr Exon 26 Exon 26/3435 C/T Silent 48.1 53.9 50.7 Exon 28 Exon 28/4030 G/C Exon 28 Exon 28/4036 A/G The positions of the polymorphisms were established with the first base of the ATG start codon set to 1.
X
ABCB1 p.Met986Val 14749689:75:990
status: NEW[hide] Pharmacogenomics of drug transporters: a new appro... Biol Pharm Bull. 2004 Jul;27(7):939-48. Ishikawa T, Onishi Y, Hirano H, Oosumi K, Nagakura M, Tarui S
Pharmacogenomics of drug transporters: a new approach to functional analysis of the genetic polymorphisms of ABCB1 (P-glycoprotein/MDR1).
Biol Pharm Bull. 2004 Jul;27(7):939-48., [PMID:15256718]
Abstract [show]
In the 21st century, emerging genomic technologies (i.e., bioinformatics, functional genomics, and pharmacogenomics) are shifting the paradigm of drug discovery research and improving the strategy of medical care for patients. In order to realize the personalized medicine, it is critically important to understand molecular mechanisms underlying inter-individual differences in the drug response, namely, pharmacological effect vs. side effect. Evidence is now accumulating to strongly suggest that drug transporters are one of the determinant factors governing the pharmacokinetic profile of drugs. Effort has been made to identify genetic variation in drug transporter genes. In particular, genetic variations of the human ABCB1 (P-glycoprotein/MDR1) gene have been most extensively studied. Hitherto more than fifty single nucleotide polymorphisms (SNPs) and insertion/deletion polymorphisms in the ABCB1 gene have been reported. However, at the present time, information is still limited with respect to the actual effect of those genetic polymorphisms on the function of ABCB1. In this context, we have undertaken functional analyses of ABCB1 polymorphisms. To quantify the impact of genetic polymorphisms on the substrate specificity of ABCB1, we have developed a high-speed screening system and a new structure-activity relationship (SAR) analysis method. This review addresses functional aspects of the genetic polymorphism of ABCB1 and provides the standard method to evaluate the effect of polymorphisms on the function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
79 For this purpose, the cDNA of ABCB1 was cloned from the human liver cDNA library, and several variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) were prepared by site-directed mutagenesis (see Fig. 4A for primers).
X
ABCB1 p.Met986Val 15256718:79:162
status: NEW94 The variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) exhibited the verapamil-enhanced ATPase activity, as did the wild type of ABCB1.
X
ABCB1 p.Met986Val 15256718:94:72
status: NEW118 Kinetic Parameters of the Wild Type and SNP Variants of ABCB1 Variant Km Vmax (mM) (nmol/min/mg protein) Wild type 2.190Ϯ0.150 13.14Ϯ1.95 N21D 0.502Ϯ0.126 45.26Ϯ11.33 N44S 0.580Ϯ0.148 31.03Ϯ4.65 F103L 1.100Ϯ0.078 36.34Ϯ8.33 G185V 0.831Ϯ0.102 56.76Ϯ6.76 S400N 0.327Ϯ0.025 13.74Ϯ2.08 A893S 0.441Ϯ0.042 17.24Ϯ6.72 A893T 0.904Ϯ0.244 10.77Ϯ1.35 M986V 0.419Ϯ0.062 22.69Ϯ6.84 The wild type and variants of ABCB1 were then expressed it in Sf9 cells using the pFASTBAC1 vector and recombinant baculoviruses.
X
ABCB1 p.Met986Val 15256718:118:436
status: NEW[hide] Pharmacogenetics of drug transporters and its impa... Curr Top Med Chem. 2004;4(13):1385-98. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of drug transporters and its impact on the pharmacotherapy.
Curr Top Med Chem. 2004;4(13):1385-98., [PMID:15379652]
Abstract [show]
Most drug responses are determined by the interplay of several gene products that influence pharmacokinetics and pharmacodynamics, i.e., drug metabolizing enzymes, drug transporters, and drug targets. With the sequencing of the human genome, it has been estimated that approximately 500-1200 genes code for drug transporters. Concerning the effects of genetic polymorphisms on pharmacotherapy, the best characterized drug transporter is the multidrug resistant transporter P-glycoprotein/MDR1, the gene product of MDR1. Little such information is available on other drug transporters. MDR1 is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily, and is expressed mainly in intestines, liver, kidneys and brain. A number of various types of structurally unrelated drugs are substrates for MDR1, and their intestinal absorption, hepatobiliary secretion, renal secretion and brain transport are regulated by MDR1. The first investigation on the effects of MDR1 genotypes on pharmacotherapy was reported in 2000: a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. At present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical investigations on the association of MDR1 genotypes with the expression and function of MDR1 in tissues, and with pharmacokinetics and pharmacodynamics have mainly focused on C3435T; however, there are still discrepancies in the results, suggesting that the haplotype of the gene should be analyzed instead of a SNP. C3435T is also reported to be a risk factor for a certain class of diseases including the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this also might be explained by the effects on MDR1 expression and function. In this review, the latest reports on the effects of genetic polymorphisms of MDR1 on pharmacotherapy are summarized, and the pharmacogenetics of other transporters is briefly introduced.
Comments [show]
None has been submitted yet.
No. Sentence Comment
127 Position Location Effect A1a/-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G G5/-25T G5/-35C exon 2 intron intron Asn21Asp T307C C6/+139T exon 5 intron Phe103Leu A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T C12/+44T exon 12 intron silent C1474T T17/-76A A17/+137G exon 13 intron intron Arg492Cys C2650T exon 21 silent G2677(A,T) exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent The list was based on the reports [67,68,71-74].
X
ABCB1 p.Met986Val 15379652:127:480
status: NEW[hide] Functional evaluation of ABCB1 (P-glycoprotein) po... Drug Metab Pharmacokinet. 2004 Feb;19(1):1-14. Ishikawa T, Hirano H, Onishi Y, Sakurai A, Tarui S
Functional evaluation of ABCB1 (P-glycoprotein) polymorphisms: high-speed screening and structure-activity relationship analyses.
Drug Metab Pharmacokinet. 2004 Feb;19(1):1-14., [PMID:15499164]
Abstract [show]
Evidence is accumulating to strongly suggest that drug transporters are one of the determinant factors governing the pharmacokinetic profile of drugs. Effort has been made to identify genetic variation in drug transporter genes. In particular, genetic variations of the human ABCB1 (MDR1) gene have been most extensively studied. Hitherto more than fifty single nucleotide polymorphisms (SNPs) and insertion/deletion polymorphisms in the ABCB1 gene have been reported. However, at the present time, information is still limited with respect to the actual effect of those genetic polymorphisms on the function of ABCB1. In this context, we have undertaken functional analyses of ABCB1 polymorphisms. To quantify the impact of genetic polymorphisms on the substrate specificity of ABCB1, we have developed a high-speed screening system and a new structure-activity relationship (SAR) analysis method. This review addresses functional aspects of the genetic polymorphism of ABCB1 and provides the standard method to evaluate the effect of polymorphisms on the function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 For this purpose, the cDNA of ABCB1 was cloned from the human liver cDNA library, and several variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) were prepared by site-directed mutagenesis (see Fig. 2A for primers).
X
ABCB1 p.Met986Val 15499164:78:162
status: NEW86 The variant forms (i.e., N21D, N44S, F103L, G185V, S400N, A893S, A893T, M986V) exhibited the verapamil-enhanced ATPase activity, as did the wild type of ABCB1.
X
ABCB1 p.Met986Val 15499164:86:72
status: NEW105 Kinetic parameters of the wild type and SNP variants of ABCB1 Variant Km Vmax (mM) (nmolWminWmg protein) Wild type 2.190±0.150 13.14±1.95 N21D 0.502±0.126 45.26±11.33 N44S 0.580±0.148 31.03±4.65 F103L 1.100±0.078 36.34±8.33 G185V 0.831±0.102 56.76±6.76 S400N 0.327±0.025 13.74±2.08 A893S 0.441±0.042 17.24±6.72 A893T 0.904±0.244 10.77±1.35 M986V 0.419±0.062 22.69±6.84 The wild type and variants of ABCB1 were then expressed it in Sf9 cells using the pFASTBAC1 vector and recombinant baculoviruses.
X
ABCB1 p.Met986Val 15499164:105:420
status: NEW[hide] Polymorphism of MDR1 gene in healthy japanese subj... Drug Metab Pharmacokinet. 2002;17(5):479-81. Honda T, Dan Y, Koyabu N, Ieiri I, Otsubo K, Higuchi S, Ohtani H, Sawada Y
Polymorphism of MDR1 gene in healthy japanese subjects: a novel SNP with an amino acid substitution (Glu108Lys).
Drug Metab Pharmacokinet. 2002;17(5):479-81., [PMID:15618700]
Abstract [show]
We discovered a novel single nucleotide polymorphism (SNP) at position 325 (G325A) in exon 5 of the multidrug-resistance 1 (MDR1) gene in a study of 37 healthy Japanese subjects. Details are as follows. SNP, 020614Honda001; GENE NAME, human P-glycoprotein (MDR1); ACCESSION NUMBER, M29427; LENGTH, 25 bases; 5'-ATGAATCTGGAGG/AAAGACATGACCA-3'. This SNP is expected to cause an amino acid substitution (Glu108Lys). In this study, one homozygote and one heterozygote for G325A were identified.
Comments [show]
None has been submitted yet.
No. Sentence Comment
13 To date, the following SNPs in the MDR1 gene leading to amino acid substitutions have been identiˆed: A61G (Asn21Asp) in exon 2, T307C (Phe103Leu) in exon 5, G1199A (Ser400Asn) in exon 11, G2677T (Ala893Ser) in exon 21, G2677A (Ala893Thr) in exon 21 and A2956G (Met986Val) in exon 24.
X
ABCB1 p.Met986Val 15618700:13:268
status: NEW[hide] Twelve novel single nucleotide polymorphisms in AB... Drug Metab Pharmacokinet. 2002;17(6):566-71. Itoda M, Saito Y, Komamura K, Ueno K, Kamakura S, Ozawa S, Sawada J
Twelve novel single nucleotide polymorphisms in ABCB1/MDR1 among Japanese patients with ventricular tachycardia who were administered amiodarone.
Drug Metab Pharmacokinet. 2002;17(6):566-71., [PMID:15618713]
Abstract [show]
Twelve novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, P-glycoprotein, from 60 Japanese individuals who were administered the anti-antiarrythmic drug, amiodarone. The detected SNPs were as follows: 1) SNP, MPJ6_AB1017 (IVS6-109); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 2) SNP, MPJ6_AB1018 (IVS7+14); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 3) SNP, MPJ6_AB1021 (IVS9-44); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 4) SNP, MPJ6_AB1052 (IVS12+17); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 5) SNP, MPJ6_AB1029 (IVS15-69); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 6) SNP, MPJ6_AB1040 (IVS24+16); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 7) SNP, MPJ6_AB1053 (IVS27-189); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 8) SNP, MPJ6_AB1054 (IVS27-172); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 9) SNP, MPJ6_AB1048 (IVS27-167); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 10) SNP, MPJ6_AB1055 (IVS27-152); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 11) SNP, MPJ6_AB1049 (IVS27-119); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 12) SNP, MPJ6_AB1051 (at nucleotide 3751 (exon 28) from the A of the translation initiation codon); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168. Among these SNPs, only MPJ6_AB1051 resulted in an amino acid alteration, V1251I.
Comments [show]
None has been submitted yet.
No. Sentence Comment
18 Much eort has been taken to uncover polymorphisms in the ABCB1WMDR1 gene since a synonymous SNP, which correlated with diminished MDR1 expression levels in the human duodenum, was reported by Homeyer et al.7) To date, information on 19 single nucleotide polymorphisms (SNPs) including 7 nonsynonymous ones (N21D, F103L, S400N, A893S, A893T, A999T and Q1107P) for ABCB1WMDR1 have been reported in Caucasians.8,9) ABCB1WMDR1 gene SNPs including intronic10) and 2 nonsynonymous SNPs (E108K, M986V)11,12) were also reported in Japanese population.
X
ABCB1 p.Met986Val 15618713:18:500
status: NEW[hide] Single nucleotide polymorphisms in human P-glycopr... Expert Opin Drug Deliv. 2006 Jan;3(1):23-35. Dey S
Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition.
Expert Opin Drug Deliv. 2006 Jan;3(1):23-35., [PMID:16370938]
Abstract [show]
Drug efflux pumps belong to a large family of ATP-binding cassette transporter proteins. These pumps bind their substrate and export it through the membrane using energy derived from ATP hydrolysis. P-glycoprotein, the main efflux pump in this family, is expressed not only in tumour cells but also in normal tissues with excretory function (liver, kidney and the intestine). It has a broad specificity of substrates and plays an important role in drug delivery and disposition. Recently, genetic screening of P-glycoprotein has yielded multiple single nucleotide polymorphisms, which seem to alter transporter function and expression. This review discusses the various polymorphisms of this gene and its impact on drug disposition and diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
123 Location Position Mutation Effect Promoter 5`/-41 A→G Noncoding Exon 1a Exon 1a/-145 C→G Noncoding Exon 1b Exon 1b/-129 T→C Noncoding Intron 1 Exon 2/-4 C→T Noncoding Intron 1 Exon 2/-1 G→A Initiation of translation Exon 2 Exon 2/61 A→G Asn21Asp Intron 4 Exon 5/-35 G→C Intron 4 Exon 5/-25 G→T Exon 5 Exon 5/307 T→C Phe103Leu Intron 6 Exon 6/+139 C→T Intron 6 Exon 6/+145 C→T Exon 7 Exon 7/548 A→G Asn183Ser Exon 11 Exon 11/1119 G→A Ser400Asn Exon 12 Exon 12/1236 C→T Silent base change Intron 12 Exon 12/+44 C→T Exon 13 Exon 13/1474 C→T Arg492Cys Intron 16 Exon 17/-76 T→A Intron 17 Exon 17/+137 A→G Exon 21 Exon 21/2650 C→T Silent base change Exon 21 Exon 21/2677 G→T G→A Ala893Ser Ala893Thr Exon 24 Exon 24/2956 A→G Met986Val Exon 24 Exon 24/2995 G→A Ala999Thr Exon 26 Exon 26/3320 A→C Gln1107Pro Exon 26 Exon 26/3396 C→T Silent base change Exon 26 Exon 26/3421 T→A Ser1141Thr Exon 26 Exon 26/3435 C→T Silent base change Exon 28 Exon 28/4030 G→C Exon 28 Exon 28/4036 A→G The positions of the polymorphism are from the first base of the ATG start codon set to 1.
X
ABCB1 p.Met986Val 16370938:123:873
status: NEW[hide] MDR1 genotype-related pharmacokinetics: fact or fi... Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414. Sakaeda T
MDR1 genotype-related pharmacokinetics: fact or fiction?
Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414., [PMID:16415525]
Abstract [show]
Multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics. The first investigation of the effects of MDR1 genotypes on pharmacotherapy was reported in 2000; a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. In the last 5 years, clinical studies have been conducted around the world on the association of MDR1 genotype with MDR1 expression and function in tissues, and with the pharmacokinetics and pharmacodynamics of drugs; however, there are still discrepancies in the results on C3435T. In 1995, a novel concept to predict in vivo oral pharmacokinetic performance from data on in vivo permeability and in vitro solubility has been proposed, and this Biopharmaceutical Classification System strongly suggested that the effects of intestinal MDR1 on the intestinal absorption of substrates is minimal in the case of commercially available oral drugs, and therefore MDR1 genotypes are little associated with the pharmacokinetics after oral administration. This review summarizes the latest reports for the future individualization of pharmacotherapy based on MDR1 genotyping, and attempts to explain discrepancies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 Representative genetic polymorphisms in MDR1 Position Location EŠect A1aW-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G exon 2 Asn21Asp G5W-25T intron G5W-35C intron T307C exon 5 Phe103Leu C6W＋139T intron C6W＋145T intron A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T exon 12 silent C12W＋44T intron C1474T exon 13 Arg492Cys T17W-76A intron A17W＋137G intron C2650T exon 21 silent G2677A,T exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent See references 27, 32-36.
X
ABCB1 p.Met986Val 16415525:29:572
status: NEW[hide] Genetic variations and haplotype structures of the... Ann Hum Genet. 2006 Sep;70(Pt 5):605-22. Sai K, Itoda M, Saito Y, Kurose K, Katori N, Kaniwa N, Komamura K, Kotake T, Morishita H, Tomoike H, Kamakura S, Kitakaze M, Tamura T, Yamamoto N, Kunitoh H, Yamada Y, Ohe Y, Shimada Y, Shirao K, Minami H, Ohtsu A, Yoshida T, Saijo N, Kamatani N, Ozawa S, Sawada J
Genetic variations and haplotype structures of the ABCB1 gene in a Japanese population: an expanded haplotype block covering the distal promoter region, and associated ethnic differences.
Ann Hum Genet. 2006 Sep;70(Pt 5):605-22., [PMID:16907707]
Abstract [show]
As functional ABCB1 haplotypes were recently reported in the promoter region of the gene, we resequenced the ABCB1 distal promoter region, along with other regions (the enhancer and proximal promoter regions, and all 28 exons), in a total of 533 Japanese subjects. Linkage disequilibrium (LD) analysis based on 92 genetic variations revealed 4 LD blocks with the same make up as previously described (Blocks -1, 1, 2 and 3), except that Block 1 was expanded to include the distal promoter region, and that a new linkage between polymorphisms -1,789G>A in the distal promoter region and IVS5 + 123A>G in intron 5 was identified. We re-assigned Block 1 haplotypes, and added novel haplotypes to the other 3 blocks. The reported promoter haplotypes were further classified into several types according to tagging variations within Block 1 coding or intronic regions. Our current data reconfirm the haplotype profiles of the other three blocks, add more detailed information on functionally-important haplotypes in Block 1 and 2 in the Japanese population, and identified differences in haplotype profiles between ethnic groups. Our updated analysis of ABCB1 haplotype blocks will assist pharmacogenetic and disease-association studies carried out using Asian subjects.
Comments [show]
None has been submitted yet.
No. Sentence Comment
117 Novel haplotype groups bearing amino acid substitutions were assigned as * 12 [1804G>A (D602N)], * 13 [2719G>A (V907I)], * 14 [1342G>A (E448K)], * 15 [2956A>G (M986V)], * 16 [3043A>G (T1015A)], and * 17 [2359C>T(R787W)], xE6.Int.6In.t7Itn8.Iin.t9Itn1.0nI.t12Int.14Ex.15xE1.9nI.t19Ex.22nI.t42 VI5S 2+32 VI5S +422 447 I6SV 1-90 VI7S 1+4 I8SV 601- I9SV 44- I1SV0 4-1 32161342 I1SV2 1+7 VI1S3 2+4 VI31S 18+ I1SV4 3+8 0814 VI51S 59- I1SV5 6-9 VI1S6 5+2 VI61S 37+ I1SV6 7-6 VI1S8 8+7 VI81S 53- 2953 VI1S9 8-8 VI02S 42+ I2SV0 -351 76272677 I2SV1 4+9 VI2S1 7-3__ 7-6 729126594033 VI42S 1+6 3534 VI2S6 5+9 VI62S 8+0 A>TG>TAG>>GTG>AA>G>GATG>C>TGA>>GATC>C>TG>AG>AAG>>TCAC>A>GTA>C>TG>CC>TC>TGA>>AGGA>>GTT>C edl CTGT G>AA>GAG>C>TC>T>TGTC> 941KK214GGEK844D206NR787WAT3988AS39I709VM9V68T1A510I1I541FNreqcneuy 1*e711011.0 1*f74440.0 1*g72520.0 1*L01900.0 1*h60600.
X
ABCB1 p.Met986Val 16907707:117:160
status: NEW[hide] Analyses of single nucleotide polymorphisms and ha... Arch Pharm Res. 2006 Dec;29(12):1132-9. Ryu HC, Kwon HY, Choi IK, Rhee DK
Analyses of single nucleotide polymorphisms and haplotype linkage of the human ABCB1 (MDR1) gene in Korean.
Arch Pharm Res. 2006 Dec;29(12):1132-9., [PMID:17225463]
Abstract [show]
Single nucleotide polymorphisms (SNPs) in the MDR1 gene that are responsible for drug efflux can cause toxicity. Therefore, this study determined the SNPs of the Korean MDR1 gene, and analyzed the haplotypes and a linkage disequilibrium (LD) of the SNPs determined. The frequency of 9 SNPs from the MDR1 gene was determined by PCR-RFLP analyses of 100 to 500 healthy individuals. The frequcies of the SNPs were C3435T (47.7%), G2677T (37.6%), G2677A (4.4%), T1236C (21.7%), T129C (8%), A2956G (2.5%), T307C (1.5%), A41aG (9.2%), C145G (0%), and G4030C (0 %). Analyses of the haplotype structure and an estimation of the LD of the combined polymorphisms demonstrated that the frequency of the 1236T-2677G-3435T haplotype is much higher in Koreans (14.1%) than in Chinese and western black Africans and the C3435T SNP in Koreans appears to have LD with T129C in Koreans for the first time. These results provide insight into the genetic variation of MDR1 in Koreans, and demonstrated the possibility of a new LD in this gene.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 In addition, two non-coding SNPs in the Korean TableI1.Positions,sequences,and frequenciesof the MDR1variantsin the KoreangenomicDNA MDR1 Analyzed Genotype,N Exon/Position Effect individuals,N GenomicDNA Allelefrequency(%) W/W WN VN W V A-41aG 5'-flanking/-41 Noncoding 388 320(NA) 66(NG) C-145G la/-145 Noncoding 100 100(C/C) 0 (C/G) T-129C lb/-129 Noncoding 100 84(T/T) 16(T/C) T-307C 5/307 Phel03Leu 100 97(T/T) 3 (T/C) T-1236C 12/1236 Gly412Gly 500 330(T/T) 123(T/C) G-2677T 21/2677 Ata893Ser 500 166G/G) 208(G/T) G-2677A 21/2677 Ala893Thr 500 40(G/A) 4 (NT) A-2956G 24/2956 Met986Val 100 95(NA) 5(NG) C-3435T 26/3435 Ile114511e 500 112(C/C) 299(C/T) G4030C 28/4030 Noncoding 100 100(G/G) 0(G/C) 2 (G/G) 91 (A) 9.2 (G) 0 (G/G) 100 (C) 0 (G) 0 (C/C) 92 (T) 8 (C) 0 (C/C) 98.5 (m) 1.5 (C) 47 (C/C) 78.3 (T) 21.7 (C) 82 (T/T) 58 (G) 37.6 (m) 0 (NA) 4.4 (A) 0 (G/G) 97.5 (A) 2.5 (G) 89 (T/T) 52.3 (C) 47.7 (T) 0 (C/C) 100(G) 0 (C) * PCR-RFLP-basedgenotypingwas developedto detectthe newand knownvariationsusing are presentedas (exon+/-n),i.e.,n nucleotidesupstream(-) or downstream(+) of theexons.
X
ABCB1 p.Met986Val 17225463:58:579
status: NEW[hide] Potential impact of ABCB1 (p-glycoprotein) polymor... Arch Toxicol. 2007 Aug;81(8):553-63. Epub 2007 Mar 13. Macdonald N, Gledhill A
Potential impact of ABCB1 (p-glycoprotein) polymorphisms on avermectin toxicity in humans.
Arch Toxicol. 2007 Aug;81(8):553-63. Epub 2007 Mar 13., [PMID:17354009]
Abstract [show]
Several members of the ATP binding cassette (ABC) transporter protein superfamily perform xenobiotic efflux functions in mammals, limiting gut absorption, mediating excretion, and controlling entry of a wide range of chemicals to sensitive compartments such as brain, testes and foetus. Perhaps the best characterised of these is p-glycoprotein (gene name ABCB1/MDR1), a barrier epithelia expressed protein with structurally diverse substrates, including the avermectin pesticides. In specific mouse and dog strains, ABCB1 mutations have been identified that result in loss of p-glycoprotein function in the blood brain barrier (BBB) and increased susceptibility to avermectin neurotoxicity. As yet no large rearrangements of the human ABCB1 gene analogous to those in the mouse and dog have been identified. However, numerous human ABCB1 single nucleotide polymorphisms (SNPs) have been identified, the allelic frequencies of which vary with ethnicity. There is no clear consensus on whether or not SNPs, or combinations of SNPs, reduce human p-glycoprotein functionality. However, recent in vivo human data indicate that the two commonest ABCB1 haplotypes both exhibit full BBB functionality. We discuss here the role of p-glycoprotein in limiting brain absorption of avermectin pesticides, as well as the potential impact of the reported functional effects and population frequencies of known ABCB1 polymorphisms on avermectin pesticide risk assessments.
Comments [show]
None has been submitted yet.
No. Sentence Comment
132 Only two known human SNP results in change of an amino acid in a transmembrane domain, A2547G which results in substitution of a methionine in place of leucine 849 (Kroetz et al. 2003), and A2956G which results in substitution of valine in place of methionine at amino acid 986 (Tanabe et al. 2001).
X
ABCB1 p.Met986Val 17354009:132:230
status: NEW[hide] Quantitative structure--activity relationship anal... Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9. Sakurai A, Onishi Y, Hirano H, Seigneuret M, Obanayama K, Kim G, Liew EL, Sakaeda T, Yoshiura K, Niikawa N, Sakurai M, Ishikawa T
Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1).
Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9., 2007-07-03 [PMID:17559192]
Abstract [show]
Several preclinical and clinical studies suggest the importance of naturally occurring polymorphisms of drug transporters in the individual difference of drug response. To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. The kinetic properties (Km and Vmax) of those variants were analyzed by measuring the ATPase activity to obtain the ATPase profile for each variant toward structurally unrelated substrates. On the basis of the experimental data, we determined the substrate specificity of ABCB1 WT and its variants by the quantitative structure-activity relationship (QSAR) analysis method. While several SNP variants appeared to influence the substrate specificity of ABCB1, the nonsynonymous polymorphisms of 2677G > T, A, or C at amino acid position 893 (Ala > Ser, Thr, or Pro) have great impacts on both the activity and the substrate specificity of ABCB1. The A893P variant (2677G > C), a rare mutation, exhibited markedly high activity of ATPase toward different test compounds. Molecular dynamics (MD) simulation based on a three-dimensional structural model of human ABCB1 revealed that multiple kinks are formed in the intracellular loop between transmembrane domains 10 and 11 of the A893P variant (2677G > C) protein. The polymorphisms of 2677G, 2677T, and 2677A exhibit wide ethnic differences in the allele frequency, and these nonsynonymous polymorphisms are suggested to be clinically important because of their altered ATPase activity and substrate specificity toward different drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells.
X
ABCB1 p.Met986Val 17559192:1:185
status: NEW38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis.
X
ABCB1 p.Met986Val 17559192:38:164
status: NEW53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944).
X
ABCB1 p.Met986Val 17559192:53:217
status: NEW80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse.
X
ABCB1 p.Met986Val 17559192:80:1078
status: NEW142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures.
X
ABCB1 p.Met986Val 17559192:142:152
status: NEW180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts.
X
ABCB1 p.Met986Val 17559192:180:120
status: NEW184 A893P, I849M, A893T, M986V, and G1063A variants showed higher Vmax values than did the WT, whereas the Vmax value of A893S was lower than that of WT.
X
ABCB1 p.Met986Val 17559192:184:21
status: NEW186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6).
X
ABCB1 p.Met986Val 17559192:186:127
status: NEW187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6.
X
ABCB1 p.Met986Val 17559192:187:424
status: NEW189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6.
X
ABCB1 p.Met986Val 17559192:189:427
status: NEW240 On the other hand, the benzene structure linked to the other ring by a single or double bond (CFC ) M113) negatively contributed to the drug-stimulated ATPase activity of M986V, G1063A, A999T, S400N, and A893S variants and WT, whereas the activity of the other variants was not affected by this structural component.
X
ABCB1 p.Met986Val 17559192:240:171
status: NEW269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function.
X
ABCB1 p.Met986Val 17559192:269:135
status: NEW273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance).
X
ABCB1 p.Met986Val 17559192:273:223
status: NEW293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5.
X
ABCB1 p.Met986Val 17559192:293:113
status: NEW316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1.
X
ABCB1 p.Met986Val 17559192:316:134
status: NEW340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined.
X
ABCB1 p.Met986Val 17559192:340:1339
status: NEW[hide] P-glycoprotein: tissue distribution, substrates, a... Handb Exp Pharmacol. 2011;(201):261-83. Cascorbi I
P-glycoprotein: tissue distribution, substrates, and functional consequences of genetic variations.
Handb Exp Pharmacol. 2011;(201):261-83., [PMID:21103972]
Abstract [show]
P-glycoprotein (ABCB1, MDR1) belongs to the ABC transporter family transporting a wide range of drugs and xenobiotics from intra- to extracellular at many biological interfaces such as the intestine, liver, blood-brain barrier, and kidney. The ABCB1 gene is highly polymorphic. Starting with the observation of lower duodenal protein expression and elevated digoxin bioavailability in relation to the 3435C>T single nucleotide polymorphism, hundreds of pharmacokinetic and outcome studies have been performed, mostly genotyping 1236C>T, 2677G>T/A, and 3435C>T. Though some studies pointed out that intracellular concentrations of anticancer drugs, for example, within lymphocytes, might be affected by ABCB1 variants resulting in differential outcome, current knowledge of the functional significance genetic variants of ABC membrane transporters does not allow selection of a particular SNP to predict an individual's pharmacokinetics.
Comments [show]
None has been submitted yet.
No. Sentence Comment
13 Absence of the gene, as being the case in double-knockout mice, is conformable N21D S400N A893S/T Q1107P 3435C>T1236T>C N183S R492C S1141T NBD1 NBD2 Intracellular (e.g. lymphocyte) Extracellular M986V Fig. 1 Two-dimensional structure of ABCB1 with locations of amino acid replacements and two frequent synonymous SNPs, NBD ¼ nucleotide binding domain [adapted from Cascorbi and Haenisch (2010)] Inducer intra cellular ABCB1 Transkription Translation ABCB1 (P-gp) luminal Fig. 2 Induction of ABCB1 via the nuclear PXR/RXR receptor leading to accelerated extrusion of P-glycoprotein substrates with life.
X
ABCB1 p.Met986Val 21103972:13:195
status: NEW81 Table 2 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies [according to Cascorbi (2006) and Cascorbi and Haenisch (2010)] Position Amino acid or effect Frequency of the variant allele Association to expression, kinetics or drug response 50 -flanking À2903 T>C 0.02a 50 -flanking À2410 T>C 0.10a Decreased mRNAa 50 -flanking À2352 G>A 0.28a 50 -flanking À1910 T>C 0.10a 50 -flanking À1717 T>C 0.02a 50 -flanking À1325 A>G 0.02a 50 -flanking À934 A>G 0.10a 50 -flanking À692 T>C 0.10a Decreased mRNAa 50 -flanking À41 A>G 0.09b IVS 1a À145 C>G 0.02b IVS 1b À129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 À1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 À35 G>C Intronic 0.006c IVS 5 À25 G>T Intronic 0.16c IVS 6 þ139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 571 G>A G191R 0.07f Reduced chemotherapy resistancef c. 1199 G>A S400N 0.05d c. 1199 C>T S400I 0.02g Elevated activityg c. 1236 C>T Synonymous 0.41d Increased imatinib disposition and therapy responseh IVS 12 þ44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 À76 T>A Intronic 0.46d IVS 17 þ137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d In vitro increased vmax,i increased imatinib response in CMLh c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d Decreased mRNA and protein expression,e, k decreased in vitro transport,l no effect on expression and bioavailability of talinolol,m no effect on in vitro transport,n, o decreased digoxin (continued) 4.2.1 Digoxin The heart glycoside digoxin is widely accepted as typical P-glycoprotein substrate.
X
ABCB1 p.Met986Val 21103972:81:1342
status: NEW[hide] Pharmacogenetics of drug transporters in the enter... Pharmacogenomics. 2011 May;12(5):611-31. Stieger B, Meier PJ
Pharmacogenetics of drug transporters in the enterohepatic circulation.
Pharmacogenomics. 2011 May;12(5):611-31., [PMID:21619426]
Abstract [show]
This article summarizes the impact of the pharmacogenetics of drug transporters expressed in the enterohepatic circulation on the pharmacokinetics and pharmacodynamics of drugs. The role of pharmacogenetics in the function of drug transporter proteins in vitro is now well established and evidence is rapidly accumulating from in vivo pharmacokinetic studies, which suggests that genetic variants of drug transporter proteins can translate into clinically relevant phenotypes. However, a large amount of conflicting information on the clinical relevance of drug transporter proteins has so far precluded the emergence of a clear picture regarding the role of drug transporter pharmacogenetics in medical practice. This is very well exemplified by the case of P-glycoprotein (MDR1, ABCB1). The challenge is now to develop pharmacogenetic models with sufficient predictive power to allow for translation into drug therapy. This will require a combination of pharmacogenetics of drug transporters, drug metabolism and pharmacodynamics of the respective drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
91 Gene name Transporter SNP Protein Population size (n) Invitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transportactivity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transportactivity [202] c.3151C>G p.P1051A N/A Increased transport activity (substratedependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression invitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells invitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPaseactivity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302].
X
ABCB1 p.Met986Val 21619426:91:1266
status: NEW94 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transport activity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transport activity [202] c.3151C>G p.P1051A N/A Increased transport activity (substrate dependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression in vitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells in vitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPase activity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302].
X
ABCB1 p.Met986Val 21619426:94:1268
status: NEW[hide] Emerging new technologies in Pharmacogenomics: rap... Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4. Ishikawa T, Sakurai A, Hirano H, Lezhava A, Sakurai M, Hayashizaki Y
Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1).
Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4., [PMID:20138191]
Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters as well as drug-metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and, by extension, their overall pharmacological effects. There are an increasing number of reports addressing genetic polymorphisms of drug transporters. A key requirement for the development of individualized medicine or personalized therapy is the ability to rapidly and conveniently test patients for genetic polymorphisms and/or mutations. We have recently developed a rapid and cost-effective method for single nucleotide polymorphism (SNP) detection, named Smart Amplification Process 2 (SmartAmp2), which enables us to detect genetic polymorphisms or mutations in 30 to 45min under isothermal conditions without DNA isolation and PCR amplification. Furthermore, high-speed functional screening, quantitative structure-activity relationship (QSAR) analysis, and molecular dynamic (MD) simulation methods have been developed to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function and substrate specificity. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. This review addresses such new methods for validating genetic polymorphisms of human ABC transporter ABCB1 (P-gp/MDR1) which is critically involved in the pharmacokinetics of drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells.
X
ABCB1 p.Met986Val 20138191:478:186
status: NEW500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6.
X
ABCB1 p.Met986Val 20138191:500:485
status: NEW533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007).
X
ABCB1 p.Met986Val 20138191:533:113
status: NEW476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells.
X
ABCB1 p.Met986Val 20138191:476:186
status: NEW498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6.
X
ABCB1 p.Met986Val 20138191:498:452
status: NEW502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const.
X
ABCB1 p.Met986Val 20138191:502:113
status: NEW534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007).
X
ABCB1 p.Met986Val 20138191:534:113
status: NEW[hide] Implications of genetic polymorphisms in drug tran... Cancer Lett. 2006 Mar 8;234(1):4-33. Epub 2006 Feb 28. Kerb R
Implications of genetic polymorphisms in drug transporters for pharmacotherapy.
Cancer Lett. 2006 Mar 8;234(1):4-33. Epub 2006 Feb 28., [PMID:16504381]
Abstract [show]
Drug transporters are increasingly recognized as a key determinant of drug disposition and response. It is now widely appreciated that expression of the ATP-dependent efflux transporter, MDR1 (ABCB1, P-glycoprotein), in organs such as the gastrointestinal tract, liver and kidney significantly alters the extent of drug absorption and excretion. Moreover, expression of MDR1 at the level of the blood-brain barrier limits the entry of many drugs into the central nervous system. Given such an important role of MDR1 in the drug disposition process, it is not surprising to see increasing focus on the role of single nucleotide polymorphisms (SNPs) in this transporter as a potential determinant of interindividual variability in drug disposition and pharmacological response. However, drug transport is often the result of the concerted action of efflux and uptake pumps located both in the basolateral and apical membranes of epithelial cells. A growing list of membrane-spanning proteins involved in the in- or outward transport of a large variety of drugs has been recognized and characterized over the past few years in almost all tissues, including organic anion and cation transporters (OAT, OCT, solute carrier family SLC22A), organic anion transport proteins (OATP, solute carrier family SLCO, formerly SLC21A), and MRPs (ABCCs), other members of the ATP-binding cassette family. We are just beginning to appreciate their role for drug delivery and disposition and the contribution of genetic polymorphisms in these transport proteins to interindividual variability in the efficacy and safety for pharmacotherapy. This review summarizes the consequences of inherited differences in drug transport for pharmacotherapy. With the main focus on ABCB1, an update of recent advances is given and clinically relevant examples are used to illustrate how heritable differential drug transport can help to explain individual variability in drug response. The pharmacogenetics of other transporters is briefly introduced.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 R. Kerb / Cancer Letters 234 (2006) 4-338 naturally-occurring polymorphisms in the human ABCB1 gene reported was the amino acid substitution Gly185Val [89], and more recently Ala893Ser and Met986Val [90].
X
ABCB1 p.Met986Val 16504381:64:190
status: NEW63 naturally-occurring polymorphisms in the human ABCB1 gene reported was the amino acid substitution Gly185Val [89], and more recently Ala893Ser and Met986Val [90].
X
ABCB1 p.Met986Val 16504381:63:147
status: NEW[hide] MDR1 gene polymorphisms and clinical relevance. Yi Chuan Xue Bao. 2006 Feb;33(2):93-104. Li YH, Wang YH, Li Y, Yang L
MDR1 gene polymorphisms and clinical relevance.
Yi Chuan Xue Bao. 2006 Feb;33(2):93-104., [PMID:16529292]
Abstract [show]
In vivo and in vitro studies have demonstrated that P-glycoprotein (P-gp) plays a very significant role in the ADME processes (absorption, distribution, metabolism, excretion) and drug-drug interaction (DDI) of drugs in humans. P-gp is the product of multidrug resistance gene (MDR1/ABCB1). Pharmacogenomics and pharmacogenetics studies have revealed that genetic polymorphisms of MDR1 are associated with alteration in P-gp expression and function in different ethnicities and subjects. By now, 50 single nucleotide polymorphisms (SNPs) and 3 insertion/deletion polymorphisms have been found in the MDR1 gene. Some of them, such as C3435T, have been identified to be a risk factor for numerous diseases. It is believed that further understanding of the physiology and biochemistry of P-gp with respect to its genetic variations may be important for individualized pharmacotherapy. Therefore, based on the latest public information and our studies, this review focuses on the following four aspects: 1) the impact of P-gp on pharmacokinetics; 2) MDR1 genetic polymorphisms and their impacts on pharmacogenetics; 3) relationship between altered P-gp expression and function and the MDR1(C3435T) SNP, and 4) relevance of MDR1 polymorphisms to certain human diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp .
X
ABCB1 p.Met986Val 16529292:42:652
status: NEW49 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp .
X
ABCB1 p.Met986Val 16529292:49:652
status: NEW[hide] Role of human MDR1 gene polymorphism in bioavailab... Clin Pharmacol Ther. 2002 Aug;72(2):209-19. Kurata Y, Ieiri I, Kimura M, Morita T, Irie S, Urae A, Ohdo S, Ohtani H, Sawada Y, Higuchi S, Otsubo K
Role of human MDR1 gene polymorphism in bioavailability and interaction of digoxin, a substrate of P-glycoprotein.
Clin Pharmacol Ther. 2002 Aug;72(2):209-19., [PMID:12189368]
Abstract [show]
OBJECTIVE: Our objective was to quantitate the contribution of the genetic polymorphism of the human MDR1 gene to the bioavailability and interaction profiles of digoxin, a substrate of P-glycoprotein. METHODS: The pharmacokinetics of digoxin was studied in 15 healthy volunteers, who were divided into 3 groups (n = 5 each) on the basis of genotyping for the MDR1 gene, in a 4-dose study after single doses of digoxin alone (0.5 mg orally and intravenously) and coadministered with clarithromycin (400 mg orally for 8 days). The dose of digoxin was reduced during the clarithromycin phase (0.25 mg orally and intravenously). RESULTS: The bioavailability of digoxin in G/G2677C/C3435, G/T2677C/T3435, and T/T2677T/T3435 subjects were 67.6% +/- 4.3%, 80.9% +/- 8.9%, and 87.1% +/- 8.4%, respectively, and the difference between G/G2677C/C3435 and T/T2677T/T3435 subjects was statistically significant (P <.05). The MDR1 variants were also associated with differences in disposition kinetics of digoxin, with the renal clearance being almost 32% lower in T/T2677T/T3435 subjects (1.9 +/- 0.1 mL/min per kilogram) than G/G2677C/C3435 subjects (2.8 +/- 0.3 mL/min per kilogram), and G/T2677C/T3435 subjects having an intermediate value (2.1 +/- 0.6 mL/min per kilogram). Coadministration of clarithromycin did not consistently affect digoxin clearance or renal clearance. However, a significant increase in digoxin bioavailability was observed in G/G2677C/C3435 subjects (67.6% +/- 4.3% versus 85.4% +/- 6.1%; P <.05) but not in the other 2 genotype groups. CONCLUSION: The allelic variants in the human MDR1 gene are likely to be associated with altered absorption and/or disposition profiles of digoxin and P-glycoprotein-mediated drug interaction
Comments [show]
None has been submitted yet.
No. Sentence Comment
57 1 5 14 15 16 2 7 9 11 12 3 4 6 10 13 5Ј-Flanking region A-41aG Noncoding A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A G/G Exon 1a C-145G Noncoding C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C C/C Exon 1b T-129C Noncoding T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/T T/C Exon 12 T1236C Gly412Gly C/C C/C T/T T/T T/C T/T C/C T/T T/T T/C T/T T/T T/T T/T T/T Exon 21 G2677T Ala893Ser G/G G/G G/G G/G G/G G/T G/T G/T G/T G/T T/T T/T T/T T/T T/T Exon 24 A2956G Met986Val A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A A/A Exon 26 C3435T Ile1145I1e C/C C/C C/C C/C C/C C/T C/T C/T C/T C/T T/T T/T T/T T/T T/T Exon 28 G4030C Noncoding G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G G/G Exon 28 A4036G Noncoding A/G A/A A/G A/A A/A A/G A/A G/G A/A A/A A/G A/G A/A A/G A/G Genotypic classification G/G2677C/C3435 G/T2677C/T3435 T/T2677T/T3435 Fig 1.
X
ABCB1 p.Met986Val 12189368:57:494
status: NEW[hide] A linkage and association analysis study in the mu... Int J Mol Epidemiol Genet. 2012;3(4):314-20. Epub 2012 Nov 15. Bazrafshani MR, Poulton KV, Mahmoodi M
A linkage and association analysis study in the multidrug resistance gene 1 (mdr1) in renal patients.
Int J Mol Epidemiol Genet. 2012;3(4):314-20. Epub 2012 Nov 15., [PMID:23205183]
Abstract [show]
Several investigations demonstrated that the polymorphisms of multidrug resistance gene (MDR1) gene contribute to interindividual variability in bioavailability and tissue distribution of its substrates. Genotyping of closely spaced single-nucleotide polymorphism (SNP) markers frequently yields highly correlated data, owing to extensive linkage disequilibrium (LD) between markers. The product of multidrug resistance gene (P-gp) is an important molecule, which regulating the bioavailability of many drugs, including calcineurin inhibitors. It also reported that some MDR1 gene polymorphisms (such as 3435C>T) was associated with significantly reduced intestinal P-gp expression in T/T homozygotes. The aim of this study is to develop genotyping assays for polymorphisms of the MDR1 gene, which are believed to have functional properties and to assess the distribution of variant alleles in renal patients (UK Caucasoid). A total of ten polymorphisms in the MDR-1 gene were selected for analysis. Haplotype assays were performed by using EH programme in 172 individuals. The following possible haplotype was apparent (G-41, C-145, C-129, C+139, C+1236, G+2677, G+2956, C+3435, C+4030 and A+4036). This finding suggests the importance of haplotype assignment for the MDR1 gene.
Comments [show]
None has been submitted yet.
No. Sentence Comment
32 Those are included, the non-coding SNPs G-41A, G-145C, C-129T (5&#b4;-untranslated region), A4036G and C4030G (3&#b4;-untranslated region), C139T (intron 6) and the coding SNPs C1236T (Gly412Gly), G2677T (Ala893Ser), G2956 (Met986Val) and C3435T (ILe1145ILe).
X
ABCB1 p.Met986Val 23205183:32:224
status: NEW53 It is interesting that the association of C139T (intron 6), G2956 (Met986Val) in exon 24, A4036G and C4030G (3&#b4;-untranslated region) were never observed with any of these LD blocks.
X
ABCB1 p.Met986Val 23205183:53:67
status: NEW