ABCB1 p.Arg492Cys
| Predicted by SNAP2: | A: D (59%), C: N (78%), D: D (66%), E: D (66%), F: D (59%), G: D (59%), H: N (72%), I: D (53%), K: N (97%), L: N (61%), M: N (61%), N: N (72%), P: D (71%), Q: N (57%), S: N (57%), T: N (57%), V: D (59%), W: D (53%), Y: D (53%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]
Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis.
X
ABCB1 p.Arg492Cys 16259577:115:129
status: NEW124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity.
X
ABCB1 p.Arg492Cys 16259577:124:39
status: NEW129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2.
X
ABCB1 p.Arg492Cys 16259577:129:55
status: NEW[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]
Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.
Comments [show]
None has been submitted yet.
No. Sentence Comment
167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis.
X
ABCB1 p.Arg492Cys 16399366:167:78
status: NEW[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]
Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.
Comments [show]
None has been submitted yet.
No. Sentence Comment
761 0.09d c. 61 A>G N21D 0.11d IVS 5-35 G>C intronic 0.006c IVS 5-25 G>T intronic 0.16c IVS 6+139 C>T intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T synonymous 0.41d IVS 12+44 C>T intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17-76 T>A intronic 0.46d IVS 17+137 A>G intronic 0.006c c. 2650 C>T synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T synonymous 0.54e c. 4030 G >C synonymous 0.005b c. 4036 A>G synonymous 0.30b a Taniguchi et al. (2003).
X
ABCB1 p.Arg492Cys 16766035:761:230
status: NEW[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]
Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 Functional Significance of ABCB1 SNPs Table6.3 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies (134) Position Amino acid or effect Frequency of the variant allele 5'-Flanking -2903 T>C 0.02a 5'-Flanking -2410 T>C 0.10a 5'-Flanking -2352 G>A 0.28a 5'-Flanking -1910 T>C 0.10a 5'-Flanking -1717 T>C 0.02a 5'-Flanking -1325 A>G 0.02a 5'-Flanking -934 A>G 0.10a 5'-Flanking -692 T>C 0.10a 5'-Flanking -41 A>G 0.09b IVS 1a -145 C>G 0.02b IVS 1b -129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 -1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 -35 G>C Intronic 0.006c IVS 5 -25 G>T Intronic 0.16c IVS 6 +139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T Synonymous 0.41d IVS 12 +44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 -76 T>A Intronic 0.46d IVS 17 +137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d c. 4030 Synonymous 0.005b c. 4036 Synonymous 0.30b References: a [42], b [26], c [25], d [28], e [23] with lower activity or expression in Caucasians.
X
ABCB1 p.Arg492Cys 19949922:52:776
status: NEW[hide] Identification of functionally variant MDR1 allele... Clin Pharmacol Ther. 2001 Aug;70(2):189-99. Kim RB, Leake BF, Choo EF, Dresser GK, Kubba SV, Schwarz UI, Taylor A, Xie HG, McKinsey J, Zhou S, Lan LB, Schuetz JD, Schuetz EG, Wilkinson GR
Identification of functionally variant MDR1 alleles among European Americans and African Americans.
Clin Pharmacol Ther. 2001 Aug;70(2):189-99., [PMID:11503014]
Abstract [show]
MDR1 (P-glycoprotein) is an important factor in the disposition of many drugs, and the involved processes often exhibit considerable interindividual variability that may be genetically determined. Single-strand conformational polymorphism analysis and direct sequencing of exonic MDR1 deoxyribonucleic acid from 37 healthy European American and 23 healthy African American subjects identified 10 single nucleotide polymorphisms (SNPs), including 6 nonsynonymous variants, occurring in various allelic combinations. Population frequencies of the 15 identified alleles varied according to racial background. Two synonymous SNPs (C1236T in exon 12 and C3435T in exon 26) and a nonsynonymous SNP (G2677T, Ala893Ser) in exon 21 were found to be linked (MDR1*2 ) and occurred in 62% of European Americans and 13% of African Americans. In vitro expression of MDR1 encoding Ala893 (MDR1*1 ) or a site-directed Ser893 mutation (MDR1*2 ) indicated enhanced efflux of digoxin by cells expressing the MDR1-Ser893 variant. In vivo functional relevance of this SNP was assessed with the known P-glycoprotein drug substrate fexofenadine as a probe of the transporter's activity. In humans, MDR1*1 and MDR1*2 variants were associated with differences in fexofenadine levels, consistent with the in vitro data, with the area under the plasma level-time curve being almost 40% greater in the *1/*1 genotype compared with the *2/*2 and the *1/*2 heterozygotes having an intermediate value, suggesting enhanced in vivo P-glycoprotein activity among subjects with the MDR1*2 allele. Thus allelic variation in MDR1 is more common than previously recognized and involves multiple SNPs whose allelic frequencies vary between populations, and some of these SNPs are associated with altered P-glycoprotein function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
104 In addition, a number of detected SNPs, such as A548G (Asn183Ser), C1472T (Arg492Cys), and T3421A (Ser1141Thr), represented previously undescribed nonsynonymous SNPs.
X
ABCB1 p.Arg492Cys 11503014:104:75
status: NEW[hide] Genetic polymorphisms of the human MDR1 drug trans... Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10. Schwab M, Eichelbaum M, Fromm MF
Genetic polymorphisms of the human MDR1 drug transporter.
Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10., [PMID:12359865]
Abstract [show]
P-glycoprotein is an ATP-dependent efflux pump that contributes to the protection of the body from environmental toxins. It transports a huge variety of structurally diverse compounds. P-glycoprotein is involved in limiting absorption of xenobiotics from the gut lumen, in protection of sensitive tissues (brain, fetus, testis), and in biliary and urinary excretion of its substrates. P-glycoprotein can be inhibited or induced by xenobiotics, thereby contributing to variable drug disposition and drug interactions. Recently, several SNPs have been identified in the MDR1 gene, some of which can affect P-glycoprotein expression and function. Potential implications of MDR1 polymorphisms for drug disposition, drug effects, and disease risk are discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
54 Further SNPs of the MDR1 gene were identified in Asians, an A to G transversion 41 bases upstream from the initial position of exon 1a (A-41aG) and a C to G transversion at -145 in exon 1a (C-145G) (28), as well as three nonsynonymous mutations A548G (Asn183Ser), C1474T (Arg492Cys), and T3421A (Ser1141Thr) in different ethnic populations (29, 30).
X
ABCB1 p.Arg492Cys 12359865:54:272
status: NEW60 In a Northern Italian population, the extent of linkage disequilibrium TABLE 2 Summary of MDR1 genetic variants in different ethnic groups Location Position Allele Effect Reference promotor 5 flanking/-41a A (28) G exon 1a exon 1a/-145 C (28) G exon 1b exon 1b/-129 T (25, 33) C intron 1 exon 2/-4 C (29) T intron 1 exon 2/-1 G initiation of translation (25, 27, 29) A exon 2 exon 2/61 A Asn21Asp (25-27, 29) G intron 4 exon 5/-35 G (25) C intron 4 exon 5/-25 G (25) T exon 5 exon 5/307 T Phe103Leu (25) C intron 6 exon 6/+139 C (25, 27) T intron 6 exon 6/+145 C (25) T exon 7 exon 7/548 A Asn183Ser (29) G exon 11 exon 11/1199 G Ser400Asn (25, 27, 29) A exon 12 exon 12/1236 C wobble (23, 25, 27, 29) T (Gly412Gly) intron 12 exon 12/+44 C (25, 27) T exon 13 exon 13/1474 C Arg492Cys (29) T intron 16 exon 17/-76 T (25, 27) A intron 17 exon 17/137 A (25) G exon 21 exon 21/2650 C wobble (29) T (Leu884Leu) (Continued ) TABLE 2 (Continued) Location Position Allele Effect Reference exon 21 exon 21/2677 G (22, 23, 27, 29) T Ala893Ser A Ala893Thr exon 24 exon 24/2956 A Met986Val (33) G exon 24 exon 24/2995 G Ala999Thr (22) A exon 26 exon 26/3320 A Gln1107Pro (27) C exon 26 exon 26/3396 C wobble (25) T exon 26 exon 26/3421 T Ser1141Thr (29, 30) A exon 26 exon 26/3435 C wobble (23, 25, 29) T (Ile1145Ile) exon 28 exon 28/4030 G (33) C exon 28 exon 28/4036 A (23, 33) G The positions of the polymorphisms correspond to positions of MDR1 cDNA with the first base of the ATG start codon set to 1 (GenBank accession # M14758).
X
ABCB1 p.Arg492Cys 12359865:60:776
status: NEW[hide] MDR1 genotype-related pharmacokinetics and pharmac... Biol Pharm Bull. 2002 Nov;25(11):1391-400. Sakaeda T, Nakamura T, Okumura K
MDR1 genotype-related pharmacokinetics and pharmacodynamics.
Biol Pharm Bull. 2002 Nov;25(11):1391-400., [PMID:12419946]
Abstract [show]
The multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. MDR1 acts as an energy-dependent efflux pump that exports its substrates out of cells. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multidrug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and detected 15 single nucleotide polymorphisms (SNPs). They also indicated that a polymorphism in exon 26 at position 3435 (C3435T), a silent mutation, affected the expression level of MDR1 protein in duodenum, and thereby the intestinal absorption of digoxin. To date, the genotype frequencies of C3435T have been investigated extensively using a larger population and interethnic difference has been elucidated, and a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on MDR1 genotype-related MDR1 expression and pharmacokinetics have also been performed around the world; however, results were not always consistent with Hoffmeyer's report. In this review, published reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping. In addition, recent investigations have raised the possibility that MDR1 and related transporters play a fundamental role in regulating apoptosis and immunology, and in fact, there are reports of MDR1-related susceptibility to inflammatory bowel disease, HIV infection and renal cell carcinoma. Herein, these issues are also summarized, and the current status of the knowledge in the area of pharmacogenomics of other transporters is briefly introduced.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 Kim et al. defined 15 alleles based on the frequencies of 11 polymorphisms of C-4T (noncoding), G-1A (noncoding), A61G (Asn21Asp), A548G (Asn183Ser), G1199A (Ser400Asn), C1236T (silent), C1474T (Arg492Cys), C2650T (silent), G2677T (Ala893Ser), T3421A (Ser1141Thr) and C3435T (silent).54) Six of 11 accompanied an amino acid change, and the others were conservative mutations.
X
ABCB1 p.Arg492Cys 12419946:52:195
status: NEW56 In 2001, Hitzl et al. also indicated that healthy Caucasian subjects with T/T3435 had a more decreased efflux of rhodamine from CD56ϩ NK cells and a lower MDR1 mRNA expression in leukocytes than those with C/C3435 .65) In renal tissues, the C3435T polymorphism is reported to be associated with reduced MDR1 expression.31) However, Tanabe et al. suggested that C3435T had no effect on the placental MDR1 expression based on 89 subjects and Western blotting.53) We determined MDR1 mRNA levels in biopsy specimens of the duodenum obtained from 13 healthy Japanese subjects by real time quantitative RT-PCR and found that MDR1 mRNA expression was higher in T/T3435 than C/C3435 or C/T3435 (Fig. 1).66) The discrepancies between the reports might be ex- November 2002 1393 Table 2. Summary of Genetic Polymorphisms in MDR1 Position Location Effect A1a/-41G Intron Noncoding C-145G Exon 1a Noncoding T-129C (T12C) Exon 1b Noncoding C-4T Exon 2 Noncoding G-1A Exon 2 Noncoding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/ϩ139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/ϩ44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/ϩ137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent This list was based on the literature (refs. 49-54).
X
ABCB1 p.Arg492Cys 12419946:56:1180
status: NEW[hide] Pharmacogenetics of MDR1 and its impact on the pha... Pharmacogenomics. 2003 Jul;4(4):397-410. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmacodynamics of drugs.
Pharmacogenomics. 2003 Jul;4(4):397-410., [PMID:12831320]
Abstract [show]
The multi-drug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multi-drug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and indicated that a single nucleotide polymorphism (SNP), C3435T in exon 26, which caused no amino acid change, was associated with the duodenal expression of MDR1 and thereby the plasma concentrations of digoxin after oral administration. Interethnic differences in genotype frequencies of C3435T have been clarified, and, at present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on the effects of C3435T on MDR1 expression and function in the tissues, and also on the pharmacokinetics and pharmacodynamics have been performed around the world; however, there are still discrepancies in the results, suggesting that the haplotype analysis of the gene should be included instead of SNP detection, and the design of clinical trials must be carefully planned to avoid misinterpretations. A polymorphism of C3435T is also reported to be a risk factor for a certain class of diseases such as the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this might also be explained by the effects on MDR1 expression and function. In this review, the latest reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping.
Comments [show]
None has been submitted yet.
No. Sentence Comment
75 Position Location Effect A1a/-41G Intron Non-coding C-145G Exon 1a Non-coding T-129C (T12C) Exon 1b Non-coding C-4T Exon 2 Non-coding G-1A Exon 2 Non-coding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/+139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/+44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/+137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent See references [34-39].
X
ABCB1 p.Arg492Cys 12831320:75:348
status: NEW[hide] P-glycoprotein: from genomics to mechanism. Oncogene. 2003 Oct 20;22(47):7468-85. Ambudkar SV, Kimchi-Sarfaty C, Sauna ZE, Gottesman MM
P-glycoprotein: from genomics to mechanism.
Oncogene. 2003 Oct 20;22(47):7468-85., 2003-10-20 [PMID:14576852]
Abstract [show]
Resistance to chemically different natural product anti-cancer drugs (multidrug resistance, or MDR) results from decreased drug accumulation, resulting from expression of one or more ATP-dependent efflux pumps. The first of these to be identified was P-glycoprotein (P-gp), the product of the human MDR1 gene, localized to chromosome 7q21. P-gp is a member of the large ATP-binding cassette (ABC) family of proteins. Although its crystallographic 3-D structure is yet to be determined, sequence analysis and comparison to other ABC family members suggest a structure consisting of two transmembrane (TM) domains, each with six TM segments, and two nucleotide-binding domains. In the epithelial cells of the gastrointestinal tract, liver, and kidney, and capillaries of the brain, testes, and ovaries, P-gp acts as a barrier to the uptake of xenobiotics, and promotes their excretion in the bile and urine. Polymorphisms in the MDR1 gene may affect the pharmacokinetics of many commonly used drugs, including anticancer drugs. Substrate recognition of many different drugs occurs within the TM domains in multiple-overlapping binding sites. We have proposed a model for how ATP energizes transfer of substrates from these binding sites on P-gp to the outside of the cell, which accounts for the apparent stoichiometry of two ATPs hydrolysed per molecule of drug transported. Understanding of the biology, genetics, and biochemistry of P-gp promises to improve the treatment of cancer and explain the pharmacokinetics of many commonly used drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
85 Kioka et al. (1989) showed a slight increase in resistance to doxorubicin, but no effect on colchicine or vinblastine Table 2 Common MDR1 exonic polymorphisms Exon number Polymorphic nucleotide variant Change in amino acid References 1 À145 - Ito et al. (2001) 1 À129 - Hoffmeyer et al. (2000); Tanabe et al. (2001) 2 61 N21D Cascorbi et al. (2001); Decleves et al. (2000); Hoffmeyer et al. (2000); Kim et al. (2001) 5 307 F103L Hoffmeyer et al. (2000) 7 548 N183S Kim et al. (2001) 10 1107 G369P Hoffmeyer et al. (2000) 11 1199 S400N Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001) 12 1236 Wobble Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 13 1474 R492C Kim et al. (2001) 21 2650 Wobble Kim et al. (2001) 21 2677 893A, S, or T Cascorbi et al. (2001); Kim et al. (2001); Kioka et al. (1989); Mickley et al. (1998) 24 2956 M986V Tanabe et al. (2001) 24 2995 A999T Mickley et al. (1998) 26 3320 Q1107P Cascorbi et al. (2001) 26 3396 Wobble Hoffmeyer et al. (2000) 26 3421 S1141T Kim et al. (2001) 26a 3435 Wobble Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 28 4030 - Tanabe et al. (2001) 28 4036 - Kioka et al. (1989); Tanabe et al. (2001) a The only polymorphism that correlates with changes in drug delivery and disposition P-glycoprotein SV Ambudkar et al resistance in the SNP located on exon 21, position 2677, Ser893 (Kioka et al., 1989).
X
ABCB1 p.Arg492Cys 14576852:85:723
status: NEW[hide] Haplotype analysis of ABCB1/MDR1 blocks in a Japan... Pharmacogenetics. 2003 Dec;13(12):741-57. Sai K, Kaniwa N, Itoda M, Saito Y, Hasegawa R, Komamura K, Ueno K, Kamakura S, Kitakaze M, Shirao K, Minami H, Ohtsu A, Yoshida T, Saijo N, Kitamura Y, Kamatani N, Ozawa S, Sawada J
Haplotype analysis of ABCB1/MDR1 blocks in a Japanese population reveals genotype-dependent renal clearance of irinotecan.
Pharmacogenetics. 2003 Dec;13(12):741-57., [PMID:14646693]
Abstract [show]
We performed comprehensive haplotyping of ABCB1/MDR1 gene blocks using 49 genetic polymorphisms, including seven novel ones, obtained from 145 Japanese subjects. The ABCB1/MDR1 gene was divided into four blocks (Blocks -1, 1, 2, and 3) based on linkage disequilibrium analysis of polymorphisms. Using an expectation-maximization based program, 1, 2, 8, and 3 haplotype groups (3, 12, 32, and 18 haplotypes) were identified in Blocks -1, 1, 2, and 3, respectively. Within Block 2, haplotype groups *1, *2, *4, *6, and *8 reported by Kim and colleagues (Clin Pharmacol Ther 2001; 70:189-199) were found, and additional three groups (*9 to *11) were newly defined. We analyzed the association of haplotypes with the renal clearance of irinotecan and its metabolites in 49 Japanese cancer patients given irinotecan intravenously. There was a significant association of the *2 haplotype in Block 2, which includes 1236C>T, 2677G>T and 3435C>T, with a reduced renal clearance of those compounds. Moreover, tendencies of reduced and increased renal clearance were also observed with *1f in Block 2 and *1b in Block 3, respectively. These findings suggest that the P-glycoprotein encoded by ABCB1/MDR1 in the proximal tubules plays a substantial role in renal exclusion of drugs and, moreover, that block-haplotyping is valuable for pharmacogenetic studies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
103 746Pharmacogenetics2003,Vol13No12 Copyright(c)LippincottWilliams&Wilkins.Unauthorizedreproductionofthisarticleisprohibited. Table 3 Classification of major ABCB1 haplotypes Site Exon 2 Exon 5 Exon 7 Exon 11 Exon 12 Exon 13 Exon 21 Exon 21 Exon 21 Exon 26 Exon 26 Exon 27 Exon 28 Positionà Exon 1 Exon 1 61A.G 325G.A 548A.G 1199G.A 1236C.T 1474C.T 2650C.T 2677G.T 2677G.A 3421T.A 3435C.T 3587T.G 3751G.A Effect on protein À4C.T À1G.A N21D E109K N183S S400N G412G R492C L884L A893S A893T S1141T I1145I I1196S V1251I Classification by Kim et al. [12] Ã1 - - - - - - - - - - - Ã1A - - - - A - - - - - - Ã1B T - - - - - - - - - - Ã1C - - - - - - - - - A - Ã1D - - - G - - - - - - - Ã2 - - - - - T - - T - T Ã2A - - G - - T - - T - T Ã2B - - - - - T - T T - T Ã2C - - - - - T T - T - T Ã3 - - - - - - - - T - T Ã4 - - - - - T - - - - T Ã5 - A - - - - - - - - T Ã6 - - - - - - - - - - T Ã7 - - - - - - - - T - - Ã8 - - - - - T - - - - - Classification of haplotype group detected in this paperÃà Block 1 Ã1 - - - - Ã2 - - G - Block 2 Ã1 - - - - - - - - - Ã2 - - T - - T - - T Ã4 - - T - - - - - T Ã6 - - - - - - - - T Ã8 - - T - - - - - - Ã9 - - - - - - - - - Ã10 - - - - - - A - - Ã11 - - T - - - A - - Block 3 Ã1 - - Ã2 - A Ã3 G - ÃAdenine of the initiation codon ATG in exon 2 was numbered +1.
X
ABCB1 p.Arg492Cys 14646693:103:478
status: NEW[hide] Polymorphisms in human MDR1 (P-glycoprotein): rece... Clin Pharmacol Ther. 2004 Jan;75(1):13-33. Marzolini C, Paus E, Buclin T, Kim RB
Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance.
Clin Pharmacol Ther. 2004 Jan;75(1):13-33., [PMID:14749689]
Abstract [show]
Drug transporters are increasingly recognized to be important to drug disposition and response. P-glycoprotein, the encoded product of the human MDR1 (ABCB1) gene, is of particular clinical relevance in that this transporter has broad substrate specificity, including a variety of structurally divergent drugs in clinical use today. Moreover, expression of this efflux transporter in certain tissue compartments such as the gastrointestinal tract and brain capillary endothelial cells limits oral absorption and central nervous system entry of many drugs. Recently, a number of single-nucleotide polymorphisms (SNPs) in MDR1 have been identified. An increasing number of studies have also implicated certain commonly occurring SNPs in MDR1 in problems including altered drug levels and host susceptibility to diseases such as Parkinson's disease, inflammatory bowel disease, refractory seizures, and CD4 cell recovery during human immunodeficiency virus therapy. However, in many such cases, the reported effects of MDR1 SNPs have been inconsistent and, in some cases, conflicting. In this review SNPs in MDR1 in relation to population frequencies, drug levels, and phenotypes are outlined. In addition, issues relating to MDR1 haplotypes, environmental factors, and study design, as potential confounding factors of the observed MDR1 polymorphism effect in vivo, are also discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
75 Summary of genetic polymorphisms in MDR1 Location Position Mutation Effect Mutant allele frequency (%) Hoffmeyer et al89 : C Cascorbi et al90 : C Siegmund et al91 : C Promotor 5' flanking/-41 A/G Noncoding Exon 1a Exon 1a/-145 C/G Noncoding Exon 1b Exon 1b/-129 T/C Noncoding 5.9 Intron 1 Exon 2/-4 C/T Noncoding Intron 1 Exon 2/-1 G/A Initial translation 5.6 9 3.7 Exon 2 Exon 2/61 A/G Asn21Asp 9.3 11.2 8.9 Intron 4 Exon 5/-35 G/C 0.6 Intron 4 Exon 5/-25 G/T 16.5 Exon 5 Exon 5/307 T/C Phe103Leu 0.6 0 Intron 6 Exon 6/ϩ139 C/T 40.6 37.2 35.8 Intron 6 Exon 6/ϩ145 C/T 1.2 Exon 7 Exon 7/548 A/G Asn183Ser Exon 11 Exon 11/1199 G/A Ser400Asn 6.5 5.5 2.9 Exon 12 Exon 12/1236 C/T Silent 37.8 41 34.3 Intron 12 Exon 12/ϩ44 C/T 5.9 4.9 7.5 Exon 13 Exon 13/1474 C/T Arg492Cys Intron 16 Exon 17/-76 T/A 45.3 46.2 49.3 Intron 17 Exon 17/ϩ137 A/G 0.6 Exon 21 Exon 21/2650 C/T Silent Exon 21 Exon 21/2677 G/T Ala893Ser 41.6 40.3 G/A Ala893Thr 1.9 3.7 Exon 24 Exon 24/2956 A/G Met986Val Exon 24 Exon 24/2995 G/A Ala999Thr Exon 26 Exon 26/3320 A/C Gln1107Pro 0.2 Exon 26 Exon 26/3396 C/T Silent 0.3 Exon 26 Exon 26/3421 T/A Ser1141Thr Exon 26 Exon 26/3435 C/T Silent 48.1 53.9 50.7 Exon 28 Exon 28/4030 G/C Exon 28 Exon 28/4036 A/G The positions of the polymorphisms were established with the first base of the ATG start codon set to 1.
X
ABCB1 p.Arg492Cys 14749689:75:778
status: NEW[hide] Pharmacogenetics of drug transporters and its impa... Curr Top Med Chem. 2004;4(13):1385-98. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of drug transporters and its impact on the pharmacotherapy.
Curr Top Med Chem. 2004;4(13):1385-98., [PMID:15379652]
Abstract [show]
Most drug responses are determined by the interplay of several gene products that influence pharmacokinetics and pharmacodynamics, i.e., drug metabolizing enzymes, drug transporters, and drug targets. With the sequencing of the human genome, it has been estimated that approximately 500-1200 genes code for drug transporters. Concerning the effects of genetic polymorphisms on pharmacotherapy, the best characterized drug transporter is the multidrug resistant transporter P-glycoprotein/MDR1, the gene product of MDR1. Little such information is available on other drug transporters. MDR1 is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily, and is expressed mainly in intestines, liver, kidneys and brain. A number of various types of structurally unrelated drugs are substrates for MDR1, and their intestinal absorption, hepatobiliary secretion, renal secretion and brain transport are regulated by MDR1. The first investigation on the effects of MDR1 genotypes on pharmacotherapy was reported in 2000: a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. At present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical investigations on the association of MDR1 genotypes with the expression and function of MDR1 in tissues, and with pharmacokinetics and pharmacodynamics have mainly focused on C3435T; however, there are still discrepancies in the results, suggesting that the haplotype of the gene should be analyzed instead of a SNP. C3435T is also reported to be a risk factor for a certain class of diseases including the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this also might be explained by the effects on MDR1 expression and function. In this review, the latest reports on the effects of genetic polymorphisms of MDR1 on pharmacotherapy are summarized, and the pharmacogenetics of other transporters is briefly introduced.
Comments [show]
None has been submitted yet.
No. Sentence Comment
127 Position Location Effect A1a/-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G G5/-25T G5/-35C exon 2 intron intron Asn21Asp T307C C6/+139T exon 5 intron Phe103Leu A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T C12/+44T exon 12 intron silent C1474T T17/-76A A17/+137G exon 13 intron intron Arg492Cys C2650T exon 21 silent G2677(A,T) exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent The list was based on the reports [67,68,71-74].
X
ABCB1 p.Arg492Cys 15379652:127:376
status: NEW[hide] Single nucleotide polymorphisms in human P-glycopr... Expert Opin Drug Deliv. 2006 Jan;3(1):23-35. Dey S
Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition.
Expert Opin Drug Deliv. 2006 Jan;3(1):23-35., [PMID:16370938]
Abstract [show]
Drug efflux pumps belong to a large family of ATP-binding cassette transporter proteins. These pumps bind their substrate and export it through the membrane using energy derived from ATP hydrolysis. P-glycoprotein, the main efflux pump in this family, is expressed not only in tumour cells but also in normal tissues with excretory function (liver, kidney and the intestine). It has a broad specificity of substrates and plays an important role in drug delivery and disposition. Recently, genetic screening of P-glycoprotein has yielded multiple single nucleotide polymorphisms, which seem to alter transporter function and expression. This review discusses the various polymorphisms of this gene and its impact on drug disposition and diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
123 Location Position Mutation Effect Promoter 5`/-41 A→G Noncoding Exon 1a Exon 1a/-145 C→G Noncoding Exon 1b Exon 1b/-129 T→C Noncoding Intron 1 Exon 2/-4 C→T Noncoding Intron 1 Exon 2/-1 G→A Initiation of translation Exon 2 Exon 2/61 A→G Asn21Asp Intron 4 Exon 5/-35 G→C Intron 4 Exon 5/-25 G→T Exon 5 Exon 5/307 T→C Phe103Leu Intron 6 Exon 6/+139 C→T Intron 6 Exon 6/+145 C→T Exon 7 Exon 7/548 A→G Asn183Ser Exon 11 Exon 11/1119 G→A Ser400Asn Exon 12 Exon 12/1236 C→T Silent base change Intron 12 Exon 12/+44 C→T Exon 13 Exon 13/1474 C→T Arg492Cys Intron 16 Exon 17/-76 T→A Intron 17 Exon 17/+137 A→G Exon 21 Exon 21/2650 C→T Silent base change Exon 21 Exon 21/2677 G→T G→A Ala893Ser Ala893Thr Exon 24 Exon 24/2956 A→G Met986Val Exon 24 Exon 24/2995 G→A Ala999Thr Exon 26 Exon 26/3320 A→C Gln1107Pro Exon 26 Exon 26/3396 C→T Silent base change Exon 26 Exon 26/3421 T→A Ser1141Thr Exon 26 Exon 26/3435 C→T Silent base change Exon 28 Exon 28/4030 G→C Exon 28 Exon 28/4036 A→G The positions of the polymorphism are from the first base of the ATG start codon set to 1.
X
ABCB1 p.Arg492Cys 16370938:123:650
status: NEW129 Lastly, rare SNPs located in exon 7 (A548G, Asn183Ser), exon 13 (C1474T, Arg492Cys) and exon 26 (A3320C, Gln1107Pro) leading to amino acid changes have been reported [76,79,96,97].
X
ABCB1 p.Arg492Cys 16370938:129:73
status: NEW[hide] MDR1 genotype-related pharmacokinetics: fact or fi... Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414. Sakaeda T
MDR1 genotype-related pharmacokinetics: fact or fiction?
Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414., [PMID:16415525]
Abstract [show]
Multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics. The first investigation of the effects of MDR1 genotypes on pharmacotherapy was reported in 2000; a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. In the last 5 years, clinical studies have been conducted around the world on the association of MDR1 genotype with MDR1 expression and function in tissues, and with the pharmacokinetics and pharmacodynamics of drugs; however, there are still discrepancies in the results on C3435T. In 1995, a novel concept to predict in vivo oral pharmacokinetic performance from data on in vivo permeability and in vitro solubility has been proposed, and this Biopharmaceutical Classification System strongly suggested that the effects of intestinal MDR1 on the intestinal absorption of substrates is minimal in the case of commercially available oral drugs, and therefore MDR1 genotypes are little associated with the pharmacokinetics after oral administration. This review summarizes the latest reports for the future individualization of pharmacotherapy based on MDR1 genotyping, and attempts to explain discrepancies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 Representative genetic polymorphisms in MDR1 Position Location EŠect A1aW-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G exon 2 Asn21Asp G5W-25T intron G5W-35C intron T307C exon 5 Phe103Leu C6W＋139T intron C6W＋145T intron A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T exon 12 silent C12W＋44T intron C1474T exon 13 Arg492Cys T17W-76A intron A17W＋137G intron C2650T exon 21 silent G2677A,T exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent See references 27, 32-36.
X
ABCB1 p.Arg492Cys 16415525:29:430
status: NEW[hide] Quantitative structure--activity relationship anal... Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9. Sakurai A, Onishi Y, Hirano H, Seigneuret M, Obanayama K, Kim G, Liew EL, Sakaeda T, Yoshiura K, Niikawa N, Sakurai M, Ishikawa T
Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1).
Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9., 2007-07-03 [PMID:17559192]
Abstract [show]
Several preclinical and clinical studies suggest the importance of naturally occurring polymorphisms of drug transporters in the individual difference of drug response. To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. The kinetic properties (Km and Vmax) of those variants were analyzed by measuring the ATPase activity to obtain the ATPase profile for each variant toward structurally unrelated substrates. On the basis of the experimental data, we determined the substrate specificity of ABCB1 WT and its variants by the quantitative structure-activity relationship (QSAR) analysis method. While several SNP variants appeared to influence the substrate specificity of ABCB1, the nonsynonymous polymorphisms of 2677G > T, A, or C at amino acid position 893 (Ala > Ser, Thr, or Pro) have great impacts on both the activity and the substrate specificity of ABCB1. The A893P variant (2677G > C), a rare mutation, exhibited markedly high activity of ATPase toward different test compounds. Molecular dynamics (MD) simulation based on a three-dimensional structural model of human ABCB1 revealed that multiple kinks are formed in the intracellular loop between transmembrane domains 10 and 11 of the A893P variant (2677G > C) protein. The polymorphisms of 2677G, 2677T, and 2677A exhibit wide ethnic differences in the allele frequency, and these nonsynonymous polymorphisms are suggested to be clinically important because of their altered ATPase activity and substrate specificity toward different drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells.
X
ABCB1 p.Arg492Cys 17559192:1:143
status: NEW38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis.
X
ABCB1 p.Arg492Cys 17559192:38:122
status: NEW53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944).
X
ABCB1 p.Arg492Cys 17559192:53:99
status: NEW80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse.
X
ABCB1 p.Arg492Cys 17559192:80:354
status: NEW142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures.
X
ABCB1 p.Arg492Cys 17559192:142:110
status: NEW180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts.
X
ABCB1 p.Arg492Cys 17559192:180:78
status: NEW186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6).
X
ABCB1 p.Arg492Cys 17559192:186:85
status: NEW187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6.
X
ABCB1 p.Arg492Cys 17559192:187:215
status: NEW189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6.
X
ABCB1 p.Arg492Cys 17559192:189:214
status: NEW269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function.
X
ABCB1 p.Arg492Cys 17559192:269:93
status: NEW273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance).
X
ABCB1 p.Arg492Cys 17559192:273:187
status: NEW293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5.
X
ABCB1 p.Arg492Cys 17559192:293:71
status: NEW316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1.
X
ABCB1 p.Arg492Cys 17559192:316:50
status: NEW340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined.
X
ABCB1 p.Arg492Cys 17559192:340:363
status: NEW[hide] P-glycoprotein: tissue distribution, substrates, a... Handb Exp Pharmacol. 2011;(201):261-83. Cascorbi I
P-glycoprotein: tissue distribution, substrates, and functional consequences of genetic variations.
Handb Exp Pharmacol. 2011;(201):261-83., [PMID:21103972]
Abstract [show]
P-glycoprotein (ABCB1, MDR1) belongs to the ABC transporter family transporting a wide range of drugs and xenobiotics from intra- to extracellular at many biological interfaces such as the intestine, liver, blood-brain barrier, and kidney. The ABCB1 gene is highly polymorphic. Starting with the observation of lower duodenal protein expression and elevated digoxin bioavailability in relation to the 3435C>T single nucleotide polymorphism, hundreds of pharmacokinetic and outcome studies have been performed, mostly genotyping 1236C>T, 2677G>T/A, and 3435C>T. Though some studies pointed out that intracellular concentrations of anticancer drugs, for example, within lymphocytes, might be affected by ABCB1 variants resulting in differential outcome, current knowledge of the functional significance genetic variants of ABC membrane transporters does not allow selection of a particular SNP to predict an individual's pharmacokinetics.
Comments [show]
None has been submitted yet.
No. Sentence Comment
13 Absence of the gene, as being the case in double-knockout mice, is conformable N21D S400N A893S/T Q1107P 3435C>T1236T>C N183S R492C S1141T NBD1 NBD2 Intracellular (e.g. lymphocyte) Extracellular M986V Fig. 1 Two-dimensional structure of ABCB1 with locations of amino acid replacements and two frequent synonymous SNPs, NBD ¼ nucleotide binding domain [adapted from Cascorbi and Haenisch (2010)] Inducer intra cellular ABCB1 Transkription Translation ABCB1 (P-gp) luminal Fig. 2 Induction of ABCB1 via the nuclear PXR/RXR receptor leading to accelerated extrusion of P-glycoprotein substrates with life.
X
ABCB1 p.Arg492Cys 21103972:13:126
status: NEW81 Table 2 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies [according to Cascorbi (2006) and Cascorbi and Haenisch (2010)] Position Amino acid or effect Frequency of the variant allele Association to expression, kinetics or drug response 50 -flanking À2903 T>C 0.02a 50 -flanking À2410 T>C 0.10a Decreased mRNAa 50 -flanking À2352 G>A 0.28a 50 -flanking À1910 T>C 0.10a 50 -flanking À1717 T>C 0.02a 50 -flanking À1325 A>G 0.02a 50 -flanking À934 A>G 0.10a 50 -flanking À692 T>C 0.10a Decreased mRNAa 50 -flanking À41 A>G 0.09b IVS 1a À145 C>G 0.02b IVS 1b À129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 À1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 À35 G>C Intronic 0.006c IVS 5 À25 G>T Intronic 0.16c IVS 6 þ139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 571 G>A G191R 0.07f Reduced chemotherapy resistancef c. 1199 G>A S400N 0.05d c. 1199 C>T S400I 0.02g Elevated activityg c. 1236 C>T Synonymous 0.41d Increased imatinib disposition and therapy responseh IVS 12 þ44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 À76 T>A Intronic 0.46d IVS 17 þ137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d In vitro increased vmax,i increased imatinib response in CMLh c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d Decreased mRNA and protein expression,e, k decreased in vitro transport,l no effect on expression and bioavailability of talinolol,m no effect on in vitro transport,n, o decreased digoxin (continued) 4.2.1 Digoxin The heart glycoside digoxin is widely accepted as typical P-glycoprotein substrate.
X
ABCB1 p.Arg492Cys 21103972:81:1120
status: NEW[hide] The permeability P-glycoprotein: a focus on enanti... Expert Opin Drug Metab Toxicol. 2010 Aug;6(8):953-65. Choong E, Dobrinas M, Carrupt PA, Eap CB
The permeability P-glycoprotein: a focus on enantioselectivity and brain distribution.
Expert Opin Drug Metab Toxicol. 2010 Aug;6(8):953-65., [PMID:20504109]
Abstract [show]
IMPORTANCE OF THE FIELD: The permeability glycoprotein (P-gp) is an important protein transporter involved in the disposition of many drugs with different chemical structures, but few studies have examined a possible stereoselectivity in its activity. P-gp can have a major impact on the distribution of drugs in selected organs, including the brain. Polymorphisms of the ABCB1 gene, which encodes for P-gp, can influence the kinetics of several drugs. AREAS COVERED IN THIS REVIEW: A search including publications from 1990 up to 2009 was performed on P-gp stereoselectivity and on the impact of ABCB1 polymorphisms on enantiomer brain distribution. WHAT THE READER WILL GAIN: Despite stereoselectivity not being expected because of the large variability of chemical structures of P-gp substrates, structure-activity relationships suggest different P-gp-binding sites for enantiomers. Enantioselectivity in the activity of P-gp has been demonstrated by in vitro studies and in animal models (preferential transport of one enantiomer or different inhibitory potencies towards P-gp activity between enantiomers). There is also in vivo evidence of an enantioselective drug transport at the human blood-brain barrier. TAKE HOME MESSAGE: The significant enantioselective activity of P-gp might be clinically relevant and must be taken into account in future studies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
209 Different SNPs were associated with the phenotype of remission, and carriers of the C allele for the rs2032583 genotype had higher odds ratio for remission (7.72, 95% CI 2.8 -- 21.3) at 4 weeks Exon 7 Exon 13 Exon 11Exon 2 Exon 8 Exon 6 Exon 3 Exon 4 Exon 9 Exon 17 Exon 10 Exon 14 Exon 12 Exon 15 Exon 16 Exon 19 Exon 21 Exon 18 Exon 23 Exon 24 Exon 28 Exon 27 Exon 20 Exon 22 A893S Exon 25 Exon 26 Exon 5 N21D N183S N400S Variant (548G, Ser183) MDR1*1 (548A, Asn183) Variant (2677T, Ser893) S1141T ATP-binding domain ATP-binding domain MDR1*1 (2677g, Ala893) R492C A. B. Figure 2.
X
ABCB1 p.Arg492Cys 20504109:209:561
status: NEW[hide] Emerging new technologies in Pharmacogenomics: rap... Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4. Ishikawa T, Sakurai A, Hirano H, Lezhava A, Sakurai M, Hayashizaki Y
Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1).
Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4., [PMID:20138191]
Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters as well as drug-metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and, by extension, their overall pharmacological effects. There are an increasing number of reports addressing genetic polymorphisms of drug transporters. A key requirement for the development of individualized medicine or personalized therapy is the ability to rapidly and conveniently test patients for genetic polymorphisms and/or mutations. We have recently developed a rapid and cost-effective method for single nucleotide polymorphism (SNP) detection, named Smart Amplification Process 2 (SmartAmp2), which enables us to detect genetic polymorphisms or mutations in 30 to 45min under isothermal conditions without DNA isolation and PCR amplification. Furthermore, high-speed functional screening, quantitative structure-activity relationship (QSAR) analysis, and molecular dynamic (MD) simulation methods have been developed to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function and substrate specificity. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. This review addresses such new methods for validating genetic polymorphisms of human ABC transporter ABCB1 (P-gp/MDR1) which is critically involved in the pharmacokinetics of drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells.
X
ABCB1 p.Arg492Cys 20138191:478:144
status: NEW500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6.
X
ABCB1 p.Arg492Cys 20138191:500:142
status: NEW533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007).
X
ABCB1 p.Arg492Cys 20138191:533:71
status: NEW476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells.
X
ABCB1 p.Arg492Cys 20138191:476:144
status: NEW498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6.
X
ABCB1 p.Arg492Cys 20138191:498:135
status: NEW502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const.
X
ABCB1 p.Arg492Cys 20138191:502:77
status: NEW534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007).
X
ABCB1 p.Arg492Cys 20138191:534:71
status: NEW[hide] MDR1 gene polymorphisms and clinical relevance. Yi Chuan Xue Bao. 2006 Feb;33(2):93-104. Li YH, Wang YH, Li Y, Yang L
MDR1 gene polymorphisms and clinical relevance.
Yi Chuan Xue Bao. 2006 Feb;33(2):93-104., [PMID:16529292]
Abstract [show]
In vivo and in vitro studies have demonstrated that P-glycoprotein (P-gp) plays a very significant role in the ADME processes (absorption, distribution, metabolism, excretion) and drug-drug interaction (DDI) of drugs in humans. P-gp is the product of multidrug resistance gene (MDR1/ABCB1). Pharmacogenomics and pharmacogenetics studies have revealed that genetic polymorphisms of MDR1 are associated with alteration in P-gp expression and function in different ethnicities and subjects. By now, 50 single nucleotide polymorphisms (SNPs) and 3 insertion/deletion polymorphisms have been found in the MDR1 gene. Some of them, such as C3435T, have been identified to be a risk factor for numerous diseases. It is believed that further understanding of the physiology and biochemistry of P-gp with respect to its genetic variations may be important for individualized pharmacotherapy. Therefore, based on the latest public information and our studies, this review focuses on the following four aspects: 1) the impact of P-gp on pharmacokinetics; 2) MDR1 genetic polymorphisms and their impacts on pharmacogenetics; 3) relationship between altered P-gp expression and function and the MDR1(C3435T) SNP, and 4) relevance of MDR1 polymorphisms to certain human diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
40 Additional mutations were identified in Asians including 5`-flanking A-41G, C-145G (exon la)"", as well as three nonsynonymous mutations (A548G: Asnl83Ser; C1474T: Arg492Cys; and T3421A: Serll41Thr) in different ethnic populations'".
X
ABCB1 p.Arg492Cys 16529292:40:164
status: NEW42 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp .
X
ABCB1 p.Arg492Cys 16529292:42:604
status: NEW47 This SNP is located on the cytoplasmic side just ahead of the first ATP-binding domain'291.C1236T in exon 12, the synonymous polymorphism, is one of the SNPs with the highest freq~encies[~".G2677T/A, a missense mutation in exon 21 that results in an amino acid change from Ala 893 to Ser or Thr, has also been associated with altered P-gp expre~sion"~,~~'.Another polymorphism, G2995A in exon 24 changes Ala 999 to Thr in the second transmembrance domain closer to the ATP-binding domain[361.Finally, MDR is another wobble mutation that doesn't alter the amino acid Ile at the position 1145.The potential functional significance of these polymorphisms can be deduced by pinpointingthem on the domain structureof P-gp.
X
ABCB1 p.Arg492Cys 16529292:47:164
status: NEW49 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp .
X
ABCB1 p.Arg492Cys 16529292:49:604
status: NEW