ABCB1 p.Arg492Cys

[switch to full view]
Comments [show]
Publications
PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."
No. Sentence Comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis.
X
ABCB1 p.Arg492Cys 16259577:115:129
status: NEW
Login to comment

124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity.
X
ABCB1 p.Arg492Cys 16259577:124:39
status: NEW
Login to comment

129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2.
X
ABCB1 p.Arg492Cys 16259577:129:55
status: NEW
Login to comment

PMID: 16399366 [PubMed] Ishikawa T et al: "High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics."
No. Sentence Comment
167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis.
X
ABCB1 p.Arg492Cys 16399366:167:78
status: NEW
Login to comment

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."
No. Sentence Comment
761 0.09d c. 61 A>G N21D 0.11d IVS 5-35 G>C intronic 0.006c IVS 5-25 G>T intronic 0.16c IVS 6+139 C>T intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T synonymous 0.41d IVS 12+44 C>T intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17-76 T>A intronic 0.46d IVS 17+137 A>G intronic 0.006c c. 2650 C>T synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T synonymous 0.54e c. 4030 G >C synonymous 0.005b c. 4036 A>G synonymous 0.30b a Taniguchi et al. (2003).
X
ABCB1 p.Arg492Cys 16766035:761:230
status: NEW
Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."
No. Sentence Comment
52 Functional Significance of ABCB1 SNPs Table6.3 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies (134) Position Amino acid or effect Frequency of the variant allele 5'-Flanking -2903 T>C 0.02a 5'-Flanking -2410 T>C 0.10a 5'-Flanking -2352 G>A 0.28a 5'-Flanking -1910 T>C 0.10a 5'-Flanking -1717 T>C 0.02a 5'-Flanking -1325 A>G 0.02a 5'-Flanking -934 A>G 0.10a 5'-Flanking -692 T>C 0.10a 5'-Flanking -41 A>G 0.09b IVS 1a -145 C>G 0.02b IVS 1b -129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 -1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 -35 G>C Intronic 0.006c IVS 5 -25 G>T Intronic 0.16c IVS 6 +139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 1199 G>A S400N 0.05d c. 1236 C>T Synonymous 0.41d IVS 12 +44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 -76 T>A Intronic 0.46d IVS 17 +137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d c. 4030 Synonymous 0.005b c. 4036 Synonymous 0.30b References: a [42], b [26], c [25], d [28], e [23] with lower activity or expression in Caucasians.
X
ABCB1 p.Arg492Cys 19949922:52:776
status: NEW
Login to comment

PMID: 11503014 [PubMed] Kim RB et al: "Identification of functionally variant MDR1 alleles among European Americans and African Americans."
No. Sentence Comment
104 In addition, a number of detected SNPs, such as A548G (Asn183Ser), C1472T (Arg492Cys), and T3421A (Ser1141Thr), represented previously undescribed nonsynonymous SNPs.
X
ABCB1 p.Arg492Cys 11503014:104:75
status: NEW
Login to comment

PMID: 12359865 [PubMed] Schwab M et al: "Genetic polymorphisms of the human MDR1 drug transporter."
No. Sentence Comment
54 Further SNPs of the MDR1 gene were identified in Asians, an A to G transversion 41 bases upstream from the initial position of exon 1a (A-41aG) and a C to G transversion at -145 in exon 1a (C-145G) (28), as well as three nonsynonymous mutations A548G (Asn183Ser), C1474T (Arg492Cys), and T3421A (Ser1141Thr) in different ethnic populations (29, 30).
X
ABCB1 p.Arg492Cys 12359865:54:272
status: NEW
Login to comment

60 In a Northern Italian population, the extent of linkage disequilibrium TABLE 2 Summary of MDR1 genetic variants in different ethnic groups Location Position Allele Effect Reference promotor 5 flanking/-41a A (28) G exon 1a exon 1a/-145 C (28) G exon 1b exon 1b/-129 T (25, 33) C intron 1 exon 2/-4 C (29) T intron 1 exon 2/-1 G initiation of translation (25, 27, 29) A exon 2 exon 2/61 A Asn21Asp (25-27, 29) G intron 4 exon 5/-35 G (25) C intron 4 exon 5/-25 G (25) T exon 5 exon 5/307 T Phe103Leu (25) C intron 6 exon 6/+139 C (25, 27) T intron 6 exon 6/+145 C (25) T exon 7 exon 7/548 A Asn183Ser (29) G exon 11 exon 11/1199 G Ser400Asn (25, 27, 29) A exon 12 exon 12/1236 C wobble (23, 25, 27, 29) T (Gly412Gly) intron 12 exon 12/+44 C (25, 27) T exon 13 exon 13/1474 C Arg492Cys (29) T intron 16 exon 17/-76 T (25, 27) A intron 17 exon 17/137 A (25) G exon 21 exon 21/2650 C wobble (29) T (Leu884Leu) (Continued ) TABLE 2 (Continued) Location Position Allele Effect Reference exon 21 exon 21/2677 G (22, 23, 27, 29) T Ala893Ser A Ala893Thr exon 24 exon 24/2956 A Met986Val (33) G exon 24 exon 24/2995 G Ala999Thr (22) A exon 26 exon 26/3320 A Gln1107Pro (27) C exon 26 exon 26/3396 C wobble (25) T exon 26 exon 26/3421 T Ser1141Thr (29, 30) A exon 26 exon 26/3435 C wobble (23, 25, 29) T (Ile1145Ile) exon 28 exon 28/4030 G (33) C exon 28 exon 28/4036 A (23, 33) G The positions of the polymorphisms correspond to positions of MDR1 cDNA with the first base of the ATG start codon set to 1 (GenBank accession # M14758).
X
ABCB1 p.Arg492Cys 12359865:60:776
status: NEW
Login to comment

PMID: 12419946 [PubMed] Sakaeda T et al: "MDR1 genotype-related pharmacokinetics and pharmacodynamics."
No. Sentence Comment
52 Kim et al. defined 15 alleles based on the frequencies of 11 polymorphisms of C-4T (noncoding), G-1A (noncoding), A61G (Asn21Asp), A548G (Asn183Ser), G1199A (Ser400Asn), C1236T (silent), C1474T (Arg492Cys), C2650T (silent), G2677T (Ala893Ser), T3421A (Ser1141Thr) and C3435T (silent).54) Six of 11 accompanied an amino acid change, and the others were conservative mutations.
X
ABCB1 p.Arg492Cys 12419946:52:195
status: NEW
Login to comment

56 In 2001, Hitzl et al. also indicated that healthy Caucasian subjects with T/T3435 had a more decreased efflux of rhodamine from CD56ϩ NK cells and a lower MDR1 mRNA expression in leukocytes than those with C/C3435 .65) In renal tissues, the C3435T polymorphism is reported to be associated with reduced MDR1 expression.31) However, Tanabe et al. suggested that C3435T had no effect on the placental MDR1 expression based on 89 subjects and Western blotting.53) We determined MDR1 mRNA levels in biopsy specimens of the duodenum obtained from 13 healthy Japanese subjects by real time quantitative RT-PCR and found that MDR1 mRNA expression was higher in T/T3435 than C/C3435 or C/T3435 (Fig. 1).66) The discrepancies between the reports might be ex- November 2002 1393 Table 2. Summary of Genetic Polymorphisms in MDR1 Position Location Effect A1a/-41G Intron Noncoding C-145G Exon 1a Noncoding T-129C (T12C) Exon 1b Noncoding C-4T Exon 2 Noncoding G-1A Exon 2 Noncoding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/ϩ139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/ϩ44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/ϩ137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent This list was based on the literature (refs. 49-54).
X
ABCB1 p.Arg492Cys 12419946:56:1180
status: NEW
Login to comment

PMID: 12831320 [PubMed] Sakaeda T et al: "Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmacodynamics of drugs."
No. Sentence Comment
75 Position Location Effect A1a/-41G Intron Non-coding C-145G Exon 1a Non-coding T-129C (T12C) Exon 1b Non-coding C-4T Exon 2 Non-coding G-1A Exon 2 Non-coding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/+139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/+44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/+137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent See references [34-39].
X
ABCB1 p.Arg492Cys 12831320:75:348
status: NEW
Login to comment

PMID: 14576852 [PubMed] Ambudkar SV et al: "P-glycoprotein: from genomics to mechanism."
No. Sentence Comment
85 Kioka et al. (1989) showed a slight increase in resistance to doxorubicin, but no effect on colchicine or vinblastine Table 2 Common MDR1 exonic polymorphisms Exon number Polymorphic nucleotide variant Change in amino acid References 1 À145 - Ito et al. (2001) 1 À129 - Hoffmeyer et al. (2000); Tanabe et al. (2001) 2 61 N21D Cascorbi et al. (2001); Decleves et al. (2000); Hoffmeyer et al. (2000); Kim et al. (2001) 5 307 F103L Hoffmeyer et al. (2000) 7 548 N183S Kim et al. (2001) 10 1107 G369P Hoffmeyer et al. (2000) 11 1199 S400N Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001) 12 1236 Wobble Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 13 1474 R492C Kim et al. (2001) 21 2650 Wobble Kim et al. (2001) 21 2677 893A, S, or T Cascorbi et al. (2001); Kim et al. (2001); Kioka et al. (1989); Mickley et al. (1998) 24 2956 M986V Tanabe et al. (2001) 24 2995 A999T Mickley et al. (1998) 26 3320 Q1107P Cascorbi et al. (2001) 26 3396 Wobble Hoffmeyer et al. (2000) 26 3421 S1141T Kim et al. (2001) 26a 3435 Wobble Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 28 4030 - Tanabe et al. (2001) 28 4036 - Kioka et al. (1989); Tanabe et al. (2001) a The only polymorphism that correlates with changes in drug delivery and disposition P-glycoprotein SV Ambudkar et al resistance in the SNP located on exon 21, position 2677, Ser893 (Kioka et al., 1989).
X
ABCB1 p.Arg492Cys 14576852:85:723
status: NEW
Login to comment

PMID: 14646693 [PubMed] Sai K et al: "Haplotype analysis of ABCB1/MDR1 blocks in a Japanese population reveals genotype-dependent renal clearance of irinotecan."
No. Sentence Comment
103 746Pharmacogenetics2003,Vol13No12 Copyright(c)LippincottWilliams&Wilkins.Unauthorizedreproductionofthisarticleisprohibited. Table 3 Classification of major ABCB1 haplotypes Site Exon 2 Exon 5 Exon 7 Exon 11 Exon 12 Exon 13 Exon 21 Exon 21 Exon 21 Exon 26 Exon 26 Exon 27 Exon 28 Positionà Exon 1 Exon 1 61A.G 325G.A 548A.G 1199G.A 1236C.T 1474C.T 2650C.T 2677G.T 2677G.A 3421T.A 3435C.T 3587T.G 3751G.A Effect on protein À4C.T À1G.A N21D E109K N183S S400N G412G R492C L884L A893S A893T S1141T I1145I I1196S V1251I Classification by Kim et al. [12] Ã1 - - - - - - - - - - - Ã1A - - - - A - - - - - - Ã1B T - - - - - - - - - - Ã1C - - - - - - - - - A - Ã1D - - - G - - - - - - - Ã2 - - - - - T - - T - T Ã2A - - G - - T - - T - T Ã2B - - - - - T - T T - T Ã2C - - - - - T T - T - T Ã3 - - - - - - - - T - T Ã4 - - - - - T - - - - T Ã5 - A - - - - - - - - T Ã6 - - - - - - - - - - T Ã7 - - - - - - - - T - - Ã8 - - - - - T - - - - - Classification of haplotype group detected in this paperÃà Block 1 Ã1 - - - - Ã2 - - G - Block 2 Ã1 - - - - - - - - - Ã2 - - T - - T - - T Ã4 - - T - - - - - T Ã6 - - - - - - - - T Ã8 - - T - - - - - - Ã9 - - - - - - - - - Ã10 - - - - - - A - - Ã11 - - T - - - A - - Block 3 Ã1 - - Ã2 - A Ã3 G - ÃAdenine of the initiation codon ATG in exon 2 was numbered +1.
X
ABCB1 p.Arg492Cys 14646693:103:478
status: NEW
Login to comment

PMID: 14749689 [PubMed] Marzolini C et al: "Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance."
No. Sentence Comment
75 Summary of genetic polymorphisms in MDR1 Location Position Mutation Effect Mutant allele frequency (%) Hoffmeyer et al89 : C Cascorbi et al90 : C Siegmund et al91 : C Promotor 5' flanking/-41 A/G Noncoding Exon 1a Exon 1a/-145 C/G Noncoding Exon 1b Exon 1b/-129 T/C Noncoding 5.9 Intron 1 Exon 2/-4 C/T Noncoding Intron 1 Exon 2/-1 G/A Initial translation 5.6 9 3.7 Exon 2 Exon 2/61 A/G Asn21Asp 9.3 11.2 8.9 Intron 4 Exon 5/-35 G/C 0.6 Intron 4 Exon 5/-25 G/T 16.5 Exon 5 Exon 5/307 T/C Phe103Leu 0.6 0 Intron 6 Exon 6/ϩ139 C/T 40.6 37.2 35.8 Intron 6 Exon 6/ϩ145 C/T 1.2 Exon 7 Exon 7/548 A/G Asn183Ser Exon 11 Exon 11/1199 G/A Ser400Asn 6.5 5.5 2.9 Exon 12 Exon 12/1236 C/T Silent 37.8 41 34.3 Intron 12 Exon 12/ϩ44 C/T 5.9 4.9 7.5 Exon 13 Exon 13/1474 C/T Arg492Cys Intron 16 Exon 17/-76 T/A 45.3 46.2 49.3 Intron 17 Exon 17/ϩ137 A/G 0.6 Exon 21 Exon 21/2650 C/T Silent Exon 21 Exon 21/2677 G/T Ala893Ser 41.6 40.3 G/A Ala893Thr 1.9 3.7 Exon 24 Exon 24/2956 A/G Met986Val Exon 24 Exon 24/2995 G/A Ala999Thr Exon 26 Exon 26/3320 A/C Gln1107Pro 0.2 Exon 26 Exon 26/3396 C/T Silent 0.3 Exon 26 Exon 26/3421 T/A Ser1141Thr Exon 26 Exon 26/3435 C/T Silent 48.1 53.9 50.7 Exon 28 Exon 28/4030 G/C Exon 28 Exon 28/4036 A/G The positions of the polymorphisms were established with the first base of the ATG start codon set to 1.
X
ABCB1 p.Arg492Cys 14749689:75:778
status: NEW
Login to comment

PMID: 15379652 [PubMed] Sakaeda T et al: "Pharmacogenetics of drug transporters and its impact on the pharmacotherapy."
No. Sentence Comment
127 Position Location Effect A1a/-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G G5/-25T G5/-35C exon 2 intron intron Asn21Asp T307C C6/+139T exon 5 intron Phe103Leu A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T C12/+44T exon 12 intron silent C1474T T17/-76A A17/+137G exon 13 intron intron Arg492Cys C2650T exon 21 silent G2677(A,T) exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent The list was based on the reports [67,68,71-74].
X
ABCB1 p.Arg492Cys 15379652:127:376
status: NEW
Login to comment

PMID: 16370938 [PubMed] Dey S et al: "Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition."
No. Sentence Comment
123 Location Position Mutation Effect Promoter 5`/-41 A→G Noncoding Exon 1a Exon 1a/-145 C→G Noncoding Exon 1b Exon 1b/-129 T→C Noncoding Intron 1 Exon 2/-4 C→T Noncoding Intron 1 Exon 2/-1 G→A Initiation of translation Exon 2 Exon 2/61 A→G Asn21Asp Intron 4 Exon 5/-35 G→C Intron 4 Exon 5/-25 G→T Exon 5 Exon 5/307 T→C Phe103Leu Intron 6 Exon 6/+139 C→T Intron 6 Exon 6/+145 C→T Exon 7 Exon 7/548 A→G Asn183Ser Exon 11 Exon 11/1119 G→A Ser400Asn Exon 12 Exon 12/1236 C→T Silent base change Intron 12 Exon 12/+44 C→T Exon 13 Exon 13/1474 C→T Arg492Cys Intron 16 Exon 17/-76 T→A Intron 17 Exon 17/+137 A→G Exon 21 Exon 21/2650 C→T Silent base change Exon 21 Exon 21/2677 G→T G→A Ala893Ser Ala893Thr Exon 24 Exon 24/2956 A→G Met986Val Exon 24 Exon 24/2995 G→A Ala999Thr Exon 26 Exon 26/3320 A→C Gln1107Pro Exon 26 Exon 26/3396 C→T Silent base change Exon 26 Exon 26/3421 T→A Ser1141Thr Exon 26 Exon 26/3435 C→T Silent base change Exon 28 Exon 28/4030 G→C Exon 28 Exon 28/4036 A→G The positions of the polymorphism are from the first base of the ATG start codon set to 1.
X
ABCB1 p.Arg492Cys 16370938:123:650
status: NEW
Login to comment

129 Lastly, rare SNPs located in exon 7 (A548G, Asn183Ser), exon 13 (C1474T, Arg492Cys) and exon 26 (A3320C, Gln1107Pro) leading to amino acid changes have been reported [76,79,96,97].
X
ABCB1 p.Arg492Cys 16370938:129:73
status: NEW
Login to comment

PMID: 16415525 [PubMed] Sakaeda T et al: "MDR1 genotype-related pharmacokinetics: fact or fiction?"
No. Sentence Comment
29 Representative genetic polymorphisms in MDR1 Position Location EŠect A1aW-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G exon 2 Asn21Asp G5W-25T intron G5W-35C intron T307C exon 5 Phe103Leu C6W+139T intron C6W+145T intron A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T exon 12 silent C12W+44T intron C1474T exon 13 Arg492Cys T17W-76A intron A17W+137G intron C2650T exon 21 silent G2677A,T exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent See references 27, 32-36.
X
ABCB1 p.Arg492Cys 16415525:29:430
status: NEW
Login to comment

PMID: 17559192 [PubMed] Sakurai A et al: "Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1)."
No. Sentence Comment
1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells.
X
ABCB1 p.Arg492Cys 17559192:1:143
status: NEW
Login to comment

38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis.
X
ABCB1 p.Arg492Cys 17559192:38:122
status: NEW
Login to comment

53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944).
X
ABCB1 p.Arg492Cys 17559192:53:99
status: NEW
Login to comment

80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse.
X
ABCB1 p.Arg492Cys 17559192:80:354
status: NEW
Login to comment

142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures.
X
ABCB1 p.Arg492Cys 17559192:142:110
status: NEW
Login to comment

180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts.
X
ABCB1 p.Arg492Cys 17559192:180:78
status: NEW
Login to comment

186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6).
X
ABCB1 p.Arg492Cys 17559192:186:85
status: NEW
Login to comment

187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6.
X
ABCB1 p.Arg492Cys 17559192:187:215
status: NEW
Login to comment

189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6.
X
ABCB1 p.Arg492Cys 17559192:189:214
status: NEW
Login to comment

269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function.
X
ABCB1 p.Arg492Cys 17559192:269:93
status: NEW
Login to comment

273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance).
X
ABCB1 p.Arg492Cys 17559192:273:187
status: NEW
Login to comment

293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5.
X
ABCB1 p.Arg492Cys 17559192:293:71
status: NEW
Login to comment

316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1.
X
ABCB1 p.Arg492Cys 17559192:316:50
status: NEW
Login to comment

340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined.
X
ABCB1 p.Arg492Cys 17559192:340:363
status: NEW
Login to comment

PMID: 21103972 [PubMed] Cascorbi I et al: "P-glycoprotein: tissue distribution, substrates, and functional consequences of genetic variations."
No. Sentence Comment
13 Absence of the gene, as being the case in double-knockout mice, is conformable N21D S400N A893S/T Q1107P 3435C>T1236T>C N183S R492C S1141T NBD1 NBD2 Intracellular (e.g. lymphocyte) Extracellular M986V Fig. 1 Two-dimensional structure of ABCB1 with locations of amino acid replacements and two frequent synonymous SNPs, NBD ¼ nucleotide binding domain [adapted from Cascorbi and Haenisch (2010)] Inducer intra cellular ABCB1 Transkription Translation ABCB1 (P-gp) luminal Fig. 2 Induction of ABCB1 via the nuclear PXR/RXR receptor leading to accelerated extrusion of P-glycoprotein substrates with life.
X
ABCB1 p.Arg492Cys 21103972:13:126
status: NEW
Login to comment

81 Table 2 Frequency of ABCB1 genetic variants in Caucasians, position on DNA, putative effect, and frequencies [according to Cascorbi (2006) and Cascorbi and Haenisch (2010)] Position Amino acid or effect Frequency of the variant allele Association to expression, kinetics or drug response 50 -flanking À2903 T>C 0.02a 50 -flanking À2410 T>C 0.10a Decreased mRNAa 50 -flanking À2352 G>A 0.28a 50 -flanking À1910 T>C 0.10a 50 -flanking À1717 T>C 0.02a 50 -flanking À1325 A>G 0.02a 50 -flanking À934 A>G 0.10a 50 -flanking À692 T>C 0.10a Decreased mRNAa 50 -flanking À41 A>G 0.09b IVS 1a À145 C>G 0.02b IVS 1b À129 T>C 0.06b IVS 1b 12 T>C 0.06c IVS 2 À1 G>A 0.09d c. 61 A>G N21D 0.11d IVS 5 À35 G>C Intronic 0.006c IVS 5 À25 G>T Intronic 0.16c IVS 6 þ139 C>T Intronic 0.37d c. 548 A>G N183S 0.01e c. 571 G>A G191R 0.07f Reduced chemotherapy resistancef c. 1199 G>A S400N 0.05d c. 1199 C>T S400I 0.02g Elevated activityg c. 1236 C>T Synonymous 0.41d Increased imatinib disposition and therapy responseh IVS 12 þ44 C>T Intronic 0.05d c. 1474 C>T R492C 0.01e IVS 17 À76 T>A Intronic 0.46d IVS 17 þ137 A>G Intronic 0.006c c. 2650 C>T Synonymous 0.03e c. 2677 G>T/A A893S/T 0.42d /0.02d In vitro increased vmax,i increased imatinib response in CMLh c. 2956 A>G M986V 0.005b c. 3320 A>C Q1107P 0.002d c. 3396 C>T Synonymous 0.03c c. 3421 T>A S1141T 0.00c c. 3435 C>T Synonymous 0.54d Decreased mRNA and protein expression,e, k decreased in vitro transport,l no effect on expression and bioavailability of talinolol,m no effect on in vitro transport,n, o decreased digoxin (continued) 4.2.1 Digoxin The heart glycoside digoxin is widely accepted as typical P-glycoprotein substrate.
X
ABCB1 p.Arg492Cys 21103972:81:1120
status: NEW
Login to comment

PMID: 20504109 [PubMed] Choong E et al: "The permeability P-glycoprotein: a focus on enantioselectivity and brain distribution."
No. Sentence Comment
209 Different SNPs were associated with the phenotype of remission, and carriers of the C allele for the rs2032583 genotype had higher odds ratio for remission (7.72, 95% CI 2.8 -- 21.3) at 4 weeks Exon 7 Exon 13 Exon 11Exon 2 Exon 8 Exon 6 Exon 3 Exon 4 Exon 9 Exon 17 Exon 10 Exon 14 Exon 12 Exon 15 Exon 16 Exon 19 Exon 21 Exon 18 Exon 23 Exon 24 Exon 28 Exon 27 Exon 20 Exon 22 A893S Exon 25 Exon 26 Exon 5 N21D N183S N400S Variant (548G, Ser183) MDR1*1 (548A, Asn183) Variant (2677T, Ser893) S1141T ATP-binding domain ATP-binding domain MDR1*1 (2677g, Ala893) R492C A. B. Figure 2.
X
ABCB1 p.Arg492Cys 20504109:209:561
status: NEW
Login to comment

PMID: 20138191 [PubMed] Ishikawa T et al: "Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1)."
No. Sentence Comment
478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells.
X
ABCB1 p.Arg492Cys 20138191:478:144
status: NEW
Login to comment

500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6.
X
ABCB1 p.Arg492Cys 20138191:500:142
status: NEW
Login to comment

533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007).
X
ABCB1 p.Arg492Cys 20138191:533:71
status: NEW
Login to comment

476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells.
X
ABCB1 p.Arg492Cys 20138191:476:144
status: NEW
Login to comment

498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6.
X
ABCB1 p.Arg492Cys 20138191:498:135
status: NEW
Login to comment

502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const.
X
ABCB1 p.Arg492Cys 20138191:502:77
status: NEW
Login to comment

534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007).
X
ABCB1 p.Arg492Cys 20138191:534:71
status: NEW
Login to comment

PMID: 16529292 [PubMed] Li YH et al: "MDR1 gene polymorphisms and clinical relevance."
No. Sentence Comment
40 Additional mutations were identified in Asians including 5`-flanking A-41G, C-145G (exon la)"", as well as three nonsynonymous mutations (A548G: Asnl83Ser; C1474T: Arg492Cys; and T3421A: Serll41Thr) in different ethnic populations'".
X
ABCB1 p.Arg492Cys 16529292:40:164
status: NEW
Login to comment

42 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp .
X
ABCB1 p.Arg492Cys 16529292:42:604
status: NEW
Login to comment

47 This SNP is located on the cytoplasmic side just ahead of the first ATP-binding domain'291.C1236T in exon 12, the synonymous polymorphism, is one of the SNPs with the highest freq~encies[~".G2677T/A, a missense mutation in exon 21 that results in an amino acid change from Ala 893 to Ser or Thr, has also been associated with altered P-gp expre~sion"~,~~'.Another polymorphism, G2995A in exon 24 changes Ala 999 to Thr in the second transmembrance domain closer to the ATP-binding domain[361.Finally, MDR is another wobble mutation that doesn't alter the amino acid Ile at the position 1145.The potential functional significance of these polymorphisms can be deduced by pinpointingthem on the domain structureof P-gp.
X
ABCB1 p.Arg492Cys 16529292:47:164
status: NEW
Login to comment

49 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp .
X
ABCB1 p.Arg492Cys 16529292:49:604
status: NEW
Login to comment