ABCMdb

ABCB1 p.Gly185Cys

None has been submitted yet.

Publications

PMID: 10681495 [PubMed] Loo TW et al: "The packing of the transmembrane segments of human multidrug resistance P-glycoprotein is revealed by disulfide cross-linking analysis."

No. Sentence Comment

77 In these cross-linking experiments, the amount of oxidant was lowered by 10-fold (0.2 mM), and the minimum temperature required to induce cross-TABLE I Cross-linking analysis of P-gp Cross-linking of S993C (TM12) with residues in the following TM: TM1 TM2 TM3 TM4 TM5 M51C -a Y130C - G185C - G226C - I293C - V52C - I131C - I186C - L227C ϩb T294C - V53C - Q132C - G187C - S228C - A295C ϩ G54C - V133C - D188C - A229C - N296C - T55C - S134C - K189C - A230C - I297C - L56C - F135C - I190C - V231C ϩ S298C - A57C - W136C - G191C - W232C ϩ I299C ϩ A58C - C137C - M192C - A233C ϩ G300C - I59C - L138C - F193C - K234C - A301C - I60C - A139C - F194C - I235C ϩ A302C - H61C - A140C - Q195C - L236C ϩ F303C - G141C - S196C - S237C - L304C - Cross-linking of P350C (TM6) with residues in the following TM: TM7 TM8 TM9 TM10 TM11 F711C - F770C - A828C - I867C - A935C - V712C - F771C - I829C - I868C - H936C - V713C - L772C - G830C - A869C - I937C - G714C - Q773C - S831C - I870C - F938C - V715C - G774C - R832C - A871C - G939C ϩ F716C - F775C - L833C - G872C - I940C - C717C - T776C - A834C - V873C - T941C - A718C - F777C - V835C - V874C ϩ F942C - I719C - G778C - I836C - E875C ϩ S943C - I720C - K779C - T837C - M876C ϩ F944C - N721C - A780C - Q838C - K877C - T945C - G722C - G781C - N839C - M878C - Q946C - G723C - E782C - I840C - L879C - A947C - I783C - a -, no cross-linked product detected in SDS-PAGE. b ϩ, cross-linked product detected in SDS-PAGE. Login to comment

PMID: 15049699 [PubMed] Omote H et al: "Improved energy coupling of human P-glycoprotein by the glycine 185 to valine mutation."

No. Sentence Comment

11 EPR analysis of the spin-labeled G185C enzyme in a cysteine-less background and kinetic parameters of the G185C enzyme indicate that position 185 is surrounded by other residues and is volume sensitive. Login to comment
58 YEpMDR1His∆CysG185C (glycine 185 to cysteine) and YEpMDR1His∆CysR588C (arginine 588 to cysteine) were generated by PCR mutagenesis using a set of primers (AAGATTAATGAATGTATTGGTGACAAA and TTTGT- CACCAATACATTCTTATAATTC, forward and reverse, respectively, for G185C, GTGATAGCTCATTGTTTGTC- TACAGTT and AACTGTAGACAAACAATGAGCTAT- CAC for R588C). Login to comment
185 100% basal ATPase activity values (Vb) were 0.90, 0.25, 0.55, and 0.18 µmol (mg of P-glycoprotein)-1 min-1 for WT, G185V, Cys(-), and G185C/Cys(-) P-glycoproteins, respectively. Login to comment
187 Panel B: 0, WT plus etoposide; 9, G185V plus etoposide; ], Cys(-) plus colchicine; [, G185C/Cys(-) plus colchicine. Login to comment
188 Table 1: Apparent Kinetic Constants of ATPase Activity of WT, Cysteine-less, and G185 Mutant P-glycoproteinsa verapamil valinomycinb colchicine etoposideb enzyme Km D (µM) Vd (U/mg)d Vd/Vb c (fold) Ki (mM) Km D (µM) Vd (U/mg) Vd/Vb (fold) Km D (µM) Vd (U/mg) Vd/Vb (fold) Ki (mM) Km D (µM) Vd (U/mg) Vd/Vb (fold) WT 62 5.7 6.4 0.64 2.0 3.7 4.1 680 2.5 2.8 18 145 1.3 1.4 G185V 64 1.6 6.4 1.0 3.3 1.1 4.2 5800 3.6 15 20 33 1.7 6.8 Cys(-)e 2.1 0.96 1.6 0.87 0.60 1.3 2.3 410 1.4 2.8 30 G185C/Cys(-) 5.3 0.46 2.6 1.5 1.2 0.30 1.7 1900 0.71 3.9 18 a Conditions were as follows: Standard ATPase activities were measured at 37 °C, pH 7.4, and 10 mM Mg‚ATP. Login to comment
199 The intrinsic Gibb`s free energy Table 2: Intrinsic Drug-Transport Rates and Corrected Transition State Thermodynamic Parameters for Steady-State Activity of WT, Cysteine-less, and G185 Mutant P-glycoproteinsa enzyme lipid typeb transport drug transport ratec (s-1) basal rate (Vb) (s-1) stimulationd (Vd/Vb) (fold) ∆Hq (kJ mol-1) T∆Sq (kJ mol-1) ∆Gq (kJ mol-1) WT type 1 none (basal) 1.9 104.8 30.9 73.9 WT type 1 colchicine 2.2 1.2 121.8 48.3 73.5 WT type 1 etoposide 2.1 1.1 159.5 85.8 73.7 G185V type 1 none (basal) 0.77 67.2 -9.0 76.2 G185V type 1 colchicine 6.6 8.6 105.4 (-16.4)e 34.7 (-13.6) 70.7 (-2.8) G185V type 1 etoposide 4.3 5.6 93.1 (-66.4) 21.3 (-64.5) 71.8 (-1.9) Cys(-) type 1 none (basal) 1.6 127.3 53.0 74.3 Cys(-) type 1 colchicine 3.6 2.2 145.6 73.3 72.2 G185C/Cys(-) type 1 none (basal) 2.0 68.0 -5.7 73.3 G185C/Cys(-) type 1 colchicine 5.2 2.6 98.6 (-47.0) 27.3 (-46.0) 71.3 (-0.9) WT type 2 none (basal) 3.7 134.9 62.7 72.2 WT type 2 colchicine 4.3 1.2 136.2 64.4 71.8 G185V type 2 none (basal) 2.9 107.9 35.1 72.8 G185V type 2 colchicine 8.5 2.9 111.9 (-24.3) 41.8 (-22.6) 70.1 (-1.7) WT type 3 none (basal) 2.6 102.4 29.3 73.1 WT type 3 colchicine 5.6 2.1 121.5 50.4 71.1 G185V type 3 none (basal) 5.5 97.6 26.5 71.1 G185V type 3 colchicine 12.2 2.2 104.5 (-17.0) 35.4 (-15.0) 69.1 (-2.0) a Intrinsic values were calculated at 35 °C, pH 7.5, with saturating Mg‚ATP and saturating transport drug if present. Login to comment
210 Large symbols: shaded O, WT basal; O, WT plus colchicine; 0, WT plus etoposide; 4, WT plus valinomycin; 3, WT plus verapamil; shaded thick O, G185V basal activity; thick O, G185V plus colchicine; thick 0, G185V plus etoposide; shaded ], Cys(-) basal; ], Cys(-) plus colchicine; shaded ] (thick line), G185C/Cys(-) basal; ] (thick line), G185C/ Cys(-) plus colchicine. Login to comment
221 Symbols: b, WT with colchicine; 9, WT with etoposide; 2, WT with valinomycin; 1, WT with verapamil; shaded O, G185V with colchicine; shaded 0, G185V with etoposide; [, Cys(-) with colchicine; shaded ], G185C/Cys(-) with colchicine. Login to comment
249 The G185C mutant enzyme was made on the Cys(-) background in which all seven cysteines were changed to alanines (11). Login to comment
250 Colchicine-dependent activities of G185C/Cys(-) and Cys(-) enzymes are shown in Figure 2B and are qualitatively similar to the pattern seen with G185V when compared to wild-type P-glycoprotein (Figure 2A). Login to comment
251 Kinetic constants of G185C/Cys(-) and Cys(-) enzymes are summarized in Table 1. Login to comment
256 Nonetheless, replacing glycine 185 with cysteine in this Cys(-) background (containing a total of eight other point substitutions) still increased Km D for colchicine and also increased the extent of ATPase activation (Table 1). Login to comment
258 Furthermore, G185C/Cys(-) when compared to the parental Cys(-) enzyme behaved in a fashion similar to G185V compared to wild-type Pgp on the LFER plot (Figure 3). Login to comment
260 Thus, G185C/Cys(-) Pgp transports colchicine more efficiently than Cys(-) Pgp, as can be discerned in Figure 4. Login to comment
263 Figure 5 shows a representative EPR spectrum of spin-labeled G185C/Cys(-). Login to comment
265 The center peak width of spin-labeled G185C/Cys(-) enzyme was approximately 4.2 ( 0.14 G ((standard error). Login to comment
266 FIGURE 5: EPR spectra of spin-labeled G185C. Login to comment
267 G185C/Cys(-) P-glycoprotein was spin-labeled with proxylmaleimide as described in Materials and Methods, and the EPR spectrum was measured. Login to comment
271 In the case of the G185C-SL enzyme there was no significant change in spin-label motional freedom on the addition of ATP, drug, or ATP plus drug, further demonstrating the restricted position of the G185C residue. Login to comment