ABCMdb

ABCC7 p.Lys370*

None has been submitted yet.

Publications

PMID: 9813087 [PubMed] Jiang Q et al: "Cystic fibrosis transmembrane conductance regulator-associated ATP release is controlled by a chloride sensor."

No. Sentence Comment

92 The COOH-terminal truncation mutant, TMD1 CFTR, was constructed by introducing a stop codon at K370X followed by an EcoRV restriction site using the mutagenic oligonucleotide 5Ј-GCAATAAACTAAATACAG- GATATCTTAC-3Ј. Login to comment

PMID: 9482946 [PubMed] Schwiebert EM et al: "Chloride channel and chloride conductance regulator domains of CFTR, the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

172 More importantly, results with T-N-R CFTR suggest that the region of CFTR important for regulatory interaction with ORCCs lies Table 2. cAMP-stimulated Cl- efflux in CFTR cDNA-transfected IB3-1 CF cells cDNA transfected n Cl- efflux, % lost per min Paired P valueBefore agonists After agonists Mock 42 33.01 Ϯ 3.12 29.53 Ϯ 2.22 NS Wild-type 37 22.99 Ϯ 1.47 46.51 Ϯ 6.53* Ͻ0.005 ⌬259-M265 30 21.85 Ϯ 1.43 47.67 Ϯ 5.95* Ͻ0.005 ⌬259-M265V 18 24.55 Ϯ 1.17 29.25 Ϯ 2.23** Ͻ0.05 TMD-1 (K370X) 24 16.63 Ϯ 1.80 53.51 Ϯ 9.50* Ͻ0.005 TMD-1 (K370EcoRV) 24 19.54 Ϯ 1.67 41.27 Ϯ 5.22* Ͻ0.005 T-N-R 18 19.21 Ϯ 1.89 28.05 Ϯ 3.35** Ͻ0.05 R334W-R347P 18 19.85 Ϯ 3.20 31.16 Ϯ 6.79** Ͻ0.05 R334W-R347P-TMD-1 18 23.12 Ϯ 2.60 26.26 Ϯ 3.42 NS The Before agonists value is the rate of 36Cl- efflux immediately prior to stimulation with cAMP agonists (2.5 ␮M forskolin, 250 ␮M CPT-cAMP, and 250 ␮M 8-bromo-cAMP). Login to comment
174 For mutants ⌬259-M265V, T-N-R, and R334W-R347P, the magnitude of cAMP stimulation is significantly less (P Ͻ 0.05, versus paired control value as denoted by two asterisks) than that for the wild type and other responding mutants [⌬259-M265, TMD-1 (K370X), TMD-1 (K370EcoRV), P Ͻ 0.005 as denoted by one asterisk], as determined by ANOVA followed by the Bonferroni ad hoc test. Login to comment
171 More importantly, results with T-N-R CFTR suggest that the region of CFTR important for regulatory interaction with ORCCs lies Table 2. cAMP-stimulated Cl2 efflux in CFTR cDNA-transfected IB3-1 CF cells cDNA transfected n Cl2 efflux, % lost per min Paired P value Before agonists After agonists Mock 42 33.01 6 3.12 29.53 6 2.22 NS Wild-type 37 22.99 6 1.47 46.51 6 6.53* ,0.005 D259-M265 30 21.85 6 1.43 47.67 6 5.95* ,0.005 D259-M265V 18 24.55 6 1.17 29.25 6 2.23** ,0.05 TMD-1 (K370X) 24 16.63 6 1.80 53.51 6 9.50* ,0.005 TMD-1 (K370EcoRV) 24 19.54 6 1.67 41.27 6 5.22* ,0.005 T-N-R 18 19.21 6 1.89 28.05 6 3.35** ,0.05 R334W-R347P 18 19.85 6 3.20 31.16 6 6.79** ,0.05 R334W-R347P-TMD-1 18 23.12 6 2.60 26.26 6 3.42 NS The Before agonists value is the rate of 36Cl2 efflux immediately prior to stimulation with cAMP agonists (2.5 mM forskolin, 250 mM CPT-cAMP, and 250 mM 8-bromo-cAMP). Login to comment
173 For mutants D259-M265V, T-N-R, and R334W-R347P, the magnitude of cAMP stimulation is significantly less (P , 0.05, versus paired control value as denoted by two asterisks) than that for the wild type and other responding mutants [D259-M265, TMD-1 (K370X), TMD-1 (K370EcoRV), P , 0.005 as denoted by one asterisk], as determined by ANOVA followed by the Bonferroni ad hoc test. Login to comment

PMID: 9374850 [PubMed] McNicholas CM et al: "A functional CFTR-NBF1 is required for ROMK2-CFTR interaction."

No. Sentence Comment

14 However, in oocytes coinjected with ROMK2 and a CFTR mutant truncated immediately before NBF1 (CFTR-K370X), glibenclamide inhibited Kϩ currents by 12%. Login to comment
69 The oligonucleotides used for mutagenesis were CFTR-G551D:5Ј GAGTGGAGAT- CAACGAG 3Ј, CFTR-A455E:5Ј GTTGTTGGAGGTTGCTGG 3Ј, CFTR-K370X:5Ј GCAATAAACTAAATACAGGATATCTTAC 3Ј, and CFTR-K593X:5Ј CTGTTAACTGATGGCTAGCAAACTAGG 3Ј. Login to comment
84 To test our hypothesis, we measured the glibenclamide sensitivity of the Kϩ currents (using the experimental protocol described above) when ROMK2 was coexpressed with two engineered CFTR-mutant constructs, CFTR-K593X or CFTR-K370X, or two naturally occurring CFTR-mutant constructs, CFTR-G551D or CFTR-A455E (see Fig. 2). Login to comment
87 In our initial experiments with the mutant CFTR constructs, we coexpressed ROMK2 with either CFTR truncated after NBF1 (CFTR-K593X, Fig. 2) or CFTR truncated before NBF1 (CFTR-K370X, Fig. 2). Login to comment
92 Therefore, the mutant CFTR-K593X is similar to CFTR-WT in conferring glibenclamide sensitivity on ROMK2. Login to comment
97 C: CFTR-K370X is truncated at residue 370 prior to NBF1. Login to comment
100 To examine whether CFTR-NBF1 is the important region for this interaction and not the transmembrane domains, we coexpressed ROMK2 with CFTR-K370X (Fig. 2). Login to comment
102 When ROMK2 and CFTR-K370X were coexpressed, the observed Ba2ϩ- sensitive Kϩ currents decreased by only 12.3 Ϯ 3.3% (n ϭ 12) after oocytes were exposed to glibenclamide. Login to comment
110 Sensitivity of CFTR Cl- currents to glibenclamide Construct Whole Cell Current, nA %Inhibition By Glibenclamide n P CFTR-WT 560Ϯ150 51.9 9 CFTR-K593X 190Ϯ31 50.1 8 NS CFTR-K370X 183Ϯ85 44.1 5 NS CFTR-G551D 334Ϯ80 49.6 7 NS CFTR-A455E 299Ϯ27 63.2 5 NS Uninjected 26Ϯ10 0 5 0.02 Values are means Ϯ SE; n is no. of experiments. Login to comment
8 However, in oocytes coinjected with ROMK2 and a CFTR mutant truncated immediately before NBF1 (CFTR-K370X), glibenclamide inhibited K1 currents by 12%. Login to comment
62 The oligonucleotides used for mutagenesis were CFTR-G551D:58 GAGTGGAGAT- CAACGAG 38, CFTR-A455E:58 GTTGTTGGAGGTTGCTGG 38, CFTR-K370X:58 GCAATAAACTAAATACAGGATATCTTAC 38, and CFTR-K593X:58 CTGTTAACTGATGGCTAGCAAACTAGG 38. Login to comment
77 To test our hypothesis, we measured the glibenclamide sensitivity of the K1 currents (using the experimental protocol described above) when ROMK2 was coexpressed with two engineered CFTR-mutant constructs, CFTR-K593X or CFTR-K370X, or two naturally occurring CFTR-mutant constructs, CFTR-G551D or CFTR-A455E (see Fig. 2). Login to comment
80 In our initial experiments with the mutant CFTR constructs, we coexpressed ROMK2 with either CFTR truncated after NBF1 (CFTR-K593X, Fig. 2) or CFTR truncated before NBF1 (CFTR-K370X, Fig. 2). Login to comment
89 C: CFTR-K370X is truncated at residue 370 prior to NBF1. Login to comment
94 When ROMK2 and CFTR-K370X were coexpressed, the observed Ba21-sensitive K1 currents decreased by only 12.3 6 3.3% (n 5 12) after oocytes were exposed to glibenclamide. Login to comment