ABCC7 p.Ala923Asp
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 19019984
[PubMed]
Pitonzo D et al: "Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon."
No.
Sentence
Comment
46
Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A).
X
ABCC7 p.Ala923Asp 19019984:46:35
status: NEW226 We therefore moved the aspartate group 1 residue toward the N terminus to position 923 (A923D and D924V), which would be located at approxi- Figure 8.
X
ABCC7 p.Ala923Asp 19019984:226:88
status: NEW255 A923D, D924V mutations decreased Sec61␣ photocross-linking (to residue 913) after puromycin treatment (compare lane 4 with lane 10) but significantly increased the peptidyl-tRNA-independent photocross-linking to residue 912 (lanes 2 and 8).
X
ABCC7 p.Ala923Asp 19019984:255:0
status: NEW