ABCMdb

ABCC7 p.Glu92Ala

None has been submitted yet.

Publications

PMID: 16977321 [PubMed] Carlson EJ et al: "p97 functions as an auxiliary factor to facilitate TM domain extraction during CFTR ER-associated degradation."

No. Sentence Comment

133 The TM1-2 E92A/K95A mutations had a striking effect, decreasing the initial degradation rate by B2.5-fold (0.2870.03/min) in the presence of p97 (Figure 6E and F), and further decreasing the degradation rate by an additional 2.3-fold following p97 depletion (0.1270.01/min). Login to comment
160 (B) Carbonate extraction of wild-type and E92A/K95A polypeptides. Login to comment
179 This also held true in the absence of p97 where the degradation rate of isolated NBD1 and NBD1-R domains was significantly faster than TMD1 and TM12(E92A/K95A). Login to comment
205 deg. rate -p97 (%/min) %increasewithp97 CFTR TMD1 TM1-2wt NBD-R NBD140 80 120 0 160 TM1-2 (E92A/K95A ) Figure 8 P97 effect is inversely related to the rate of degradation. Login to comment
221 Thus, p97 may play a key role in stimulating TM1-2 E92A/K95A degradation by providing a second step for substrate partitioning, thereby generating a locally unfolded domain that preferentially engages the AAA-ATPase ring of the 19S RC. Login to comment
237 Before pelleting, TM1-2 E92A/K95A was released from ribosomes by addition of 1 mM puromycin. Login to comment

PMID: 9417117 [PubMed] Lu Y et al: "Co- and posttranslational translocation mechanisms direct cystic fibrosis transmembrane conductance regulator N terminus transmembrane assembly."

No. Sentence Comment

8 Mutating charged residues Glu92 and Lys95 to alanine improved TM1 signal sequence activity as well as the ability of TM1 to independently direct CFTR N terminus topology. Login to comment
41 MATERIALS AND METHODS cDNA Construction-E92A and K95A mutations were engineered into CFTR by site-directed mutagenesis using a single stranded (M-13) (plasmid pBQ 4.7) template and oligonucleotides TATATTTAGGCGCCGTCAC- CAAAGCAGT and GAAGTCACCGCTGCAGTACAGCCT as described (33). Login to comment
42 AvaI/XbaI fragments containing the engineered mutations were then ligated into an AvaI/XbaI-digested pSPCFTR vector (34), generating plasmids pSPCFTR(E92A) and pSPCFTR(K95A). Login to comment
43 Plasmid pSPCFTR(E92A/ K95A) was generated by PCR amplification of pSPCFTR(E92A) (sense primer (SP6 promoter) ATTTAGGTGACACTATAG, and antisense primer TACTGCAGCGGTGACGGCGCCTAA), digestion of the PCR fragment with AvaI/PstI (PstI encoded in antisense oligonucleotides) and ligation of the fragment into an AvaI/PstI digested pSPCFTRK95A vector. Plasmids pSPCFTR(G85E) and pSPCFTR(G91R) are described elsewhere (33). Login to comment
44 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(E95A), and TM1.P(E92A/E95A) were constructed by PCR amplification of WT or corresponding mutant CFTR plasmids (sense primer (SP6 promoter), antisense primer TAGATAGGTCACCATAGAGCGTTCCTCCT) and ligation of HindIII/BstEII-digested PCR fragments into a HindIII/BstEII-digested vector, S.L.ST.gG.P (described in Ref. Login to comment
53 Similarly, plasmids TM1-2.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (5Ј template pSPCFTR(E92A/K95A) and 3Ј template pSPCFTR(G126D); (c) primer 3 (5Ј template pSPCFTR(E92A/ K95A) 3Ј template pSPCFTR(G126D)). Login to comment
88 We therefore examined translocation efficiency of polypeptides generated from plasmids TM1.P(E92A), TM1.P(K95A) and TM1.P(E92A/K95A). Login to comment
89 As shown in Fig. 1A, lanes 10-18, the E92A and E92A/K95A mutations both improved TM1 signal sequence activity (43% and 79% of P translocated, respectively), whereas the K95A mutation by itself had little effect (10% of P translocated). Login to comment
95 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(K95A), and TM1.P- (E92A/K95A) were expressed in rabbit reticulocyte lysate supplemented with canine pancreas microsomal membranes (A) or in microinjected Xenopus oocytes (B) as described under "Materials and Methods." Login to comment
103 located); (ii) G85E and G91R mutations essentially abolished TM1 signal sequence activity (Ͻ5% of chains translocated); and (iii) E92A and E92A/K95A mutations improved TM1 signal sequence activity (36% and 70% of chains translocated, respectively). Login to comment
158 This conclusion was further supported by the observation that improving TM1 signal sequence activity using the mutant E92A/ K95A completely restored N terminus translocation in TM2 mutants (Fig. 5). Login to comment
161 Furthermore, even an efficient TM1 signal sequence (E92A/K95A) restored translocation efficiency to only 69% of WT levels. Login to comment
234 Consistent with this view, we observed that full-length CFTR encoding E92A or the double mutation, E92A/ K95A, exhibited markedly reduced chloride channel activity when expressed in Xenopus oocytes.3 In addition, scanning cysteine accessibility studies have revealed that Lys95 resides on a hydrophilic surface of TM1 and likely faces the CFTR chloride channel pore, whereas Glu92 appears to face 40° away from the pore surface, suggesting that it contributes to ionic interactions within the plane of the bilayer (67). Login to comment
45 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(E95A), and TM1.P(E92A/E95A) were constructed by PCR amplification of WT or corresponding mutant CFTR plasmids (sense primer (SP6 promoter), antisense primer TAGATAGGTCACCATAGAGCGTTCCTCCT) and ligation of HindIII/BstEII-digested PCR fragments into a HindIII/BstEII-digested vector, S.L.ST.gG.P (described in Ref. 18). Login to comment
54 Similarly, plasmids TM12.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (59 template pSPCFTR(E92A/K95A) and 39 template pSPCFTR(G126D); (c) primer 3 (59 template pSPCFTR(E92A/ K95A) 39 template pSPCFTR(G126D)). Login to comment
90 As shown in Fig. 1A, lanes 10-18, the E92A and E92A/K95A mutations both improved TM1 signal sequence activity (43% and 79% of P translocated, respectively), whereas the K95A mutation by itself had little effect (10% of P translocated). Login to comment
96 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(K95A), and TM1.P- (E92A/K95A) were expressed in rabbit reticulocyte lysate supplemented with canine pancreas microsomal membranes (A) or in microinjected Xenopus oocytes (B) as described under "Materials and Methods." Login to comment
104 located); (ii) G85E and G91R mutations essentially abolished TM1 signal sequence activity (,5% of chains translocated); and (iii) E92A and E92A/K95A mutations improved TM1 signal sequence activity (36% and 70% of chains translocated, respectively). Login to comment

PMID: 23248597 [PubMed] Kim SJ et al: "Mechanisms of CFTR Folding at the Endoplasmic Reticulum."

No. Sentence Comment

110 For example, replacement of ionizable residues in TM1 (E92A and K95A) converts TM1 to a strong signal anchor sequence, thus favoring cotranslational topogenesis, but disrupts CFTR function (Lu et al., 1998; Patrick et al., 2011). Login to comment