ABCMdb

ABCC7 p.Val302Cys

Predicted by SNAP2:	A: N (53%), C: N (87%), D: D (71%), E: D (71%), F: N (66%), G: D (71%), H: D (75%), I: N (78%), K: D (80%), L: N (87%), M: N (78%), N: D (66%), P: D (80%), Q: D (71%), R: D (80%), S: D (63%), T: N (53%), W: D (80%), Y: D (71%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Mercury and zinc differentially inhibit shark and ... Am J Physiol Cell Physiol. 2006 Mar;290(3):C793-801. Epub 2005 Oct 19. Weber GJ, Mehr AP, Sirota JC, Aller SG, Decker SE, Dawson DC, Forrest JN Jr
Mercury and zinc differentially inhibit shark and human CFTR orthologues: involvement of shark cysteine 102.
Am J Physiol Cell Physiol. 2006 Mar;290(3):C793-801. Epub 2005 Oct 19., [PMID:16236827]

Abstract [show]
The apical membrane is an important site of mercury toxicity in shark rectal gland tubular cells. We compared the effects of mercury and other thiol-reacting agents on shark CFTR (sCFTR) and human CFTR (hCFTR) chloride channels using two-electrode voltage clamping of cRNA microinjected Xenopus laevis oocytes. Chloride conductance was stimulated by perfusing with 10 microM forskolin (FOR) and 1 mM IBMX, and then thio-reactive species were added. In oocytes expressing sCFTR, FOR + IBMX mean stimulated Cl(-) conductance was inhibited 69% by 1 microM mercuric chloride and 78% by 5 microM mercuric chloride (IC(50) of 0.8 microM). Despite comparable stimulation of conductance, hCFTR was insensitive to 1 microM HgCl(2) and maximum inhibition was 15% at the highest concentration used (5 microM). Subsequent exposure to glutathione (GSH) did not reverse the inhibition of sCFTR by mercury, but dithiothreitol (DTT) completely reversed this inhibition. Zinc (50-200 microM) also reversibly inhibited sCFTR (40-75%) but did not significantly inhibit hCFTR. Similar inhibition of sCFTR but not hCFTR was observed with an organic mercurial, p-chloromercuriphenylsulfonic acid (pCMBS). The first membrane spanning domain (MSD1) of sCFTR contains two unique cysteines, C102 and C303. A chimeric construct replacing MSD1 of hCFTR with the corresponding sequence of sCFTR was highly sensitive to mercury. Site-specific mutations introducing the first but not the second shark unique cysteine in hCFTR MSD1 resulted in full sensitivity to mercury. These experiments demonstrate a profound difference in the sensitivity of shark vs. human CFTR to inhibition by three thiol-reactive substances, an effect that involves C102 in the shark orthologue.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 For each mutant, both fragments carrying the desired mutation were amplified in the first PCR step using flanking and mutation-carrying primers (mutation-carrying primer: L101C-sense AGTACAGCCTCTCTGC- CTGGGAAGAA; L101C-antisense TTCTTCCCAGGCAGAGAG- GCTGTACT; V302C-sense GCCTATTGCAGATACTTCAATAGC; V302C-antisense AAGTATCTGCAATAGGCTGCCTTCCG; flanking primer: SacII TGTAAAACGACGGCCAGTGAG; BstZ17 I GTATACTGCTCTTGCTAAAGA). Login to comment
200 Because the h-sMSD1 chimera fully reproduced the mercury sensitivity of sCFTR, we next mutated single residues in hCFTR (L101C and V302C) to the corresponding cysteines (C102 and C303) present in MSD1 of sCFTR. Login to comment
212 Inhibition of forskolin ϩ IBMX stimulated conductances by 1 ␮M HgCl2 in sCFTR, hCFTR, human-shark (h-s) MSD1, hL101, and V302C. Login to comment