ABCC7 p.Val302Cys
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 16236827
[PubMed]
Weber GJ et al: "Mercury and zinc differentially inhibit shark and human CFTR orthologues: involvement of shark cysteine 102."
No.
Sentence
Comment
76
For each mutant, both fragments carrying the desired mutation were amplified in the first PCR step using flanking and mutation-carrying primers (mutation-carrying primer: L101C-sense AGTACAGCCTCTCTGC- CTGGGAAGAA; L101C-antisense TTCTTCCCAGGCAGAGAG- GCTGTACT; V302C-sense GCCTATTGCAGATACTTCAATAGC; V302C-antisense AAGTATCTGCAATAGGCTGCCTTCCG; flanking primer: SacII TGTAAAACGACGGCCAGTGAG; BstZ17 I GTATACTGCTCTTGCTAAAGA).
X
ABCC7 p.Val302Cys 16236827:76:259
status: NEWX
ABCC7 p.Val302Cys 16236827:76:297
status: NEW200 Because the h-sMSD1 chimera fully reproduced the mercury sensitivity of sCFTR, we next mutated single residues in hCFTR (L101C and V302C) to the corresponding cysteines (C102 and C303) present in MSD1 of sCFTR.
X
ABCC7 p.Val302Cys 16236827:200:131
status: NEW212 Inhibition of forskolin ϩ IBMX stimulated conductances by 1 M HgCl2 in sCFTR, hCFTR, human-shark (h-s) MSD1, hL101, and V302C.
X
ABCC7 p.Val302Cys 16236827:212:134
status: NEW