PMID: 16236827

Weber GJ, Mehr AP, Sirota JC, Aller SG, Decker SE, Dawson DC, Forrest JN Jr
Mercury and zinc differentially inhibit shark and human CFTR orthologues: involvement of shark cysteine 102.
Am J Physiol Cell Physiol. 2006 Mar;290(3):C793-801. Epub 2005 Oct 19., [PubMed]
Sentences
No. Mutations Sentence Comment
76 ABCC7 p.Leu101Cys
X
ABCC7 p.Leu101Cys 16236827:76:171
status: NEW
view ABCC7 p.Leu101Cys details
ABCC7 p.Leu101Cys
X
ABCC7 p.Leu101Cys 16236827:76:213
status: NEW
view ABCC7 p.Leu101Cys details
ABCC7 p.Val302Cys
X
ABCC7 p.Val302Cys 16236827:76:259
status: NEW
view ABCC7 p.Val302Cys details
ABCC7 p.Val302Cys
X
ABCC7 p.Val302Cys 16236827:76:297
status: NEW
view ABCC7 p.Val302Cys details
 For each mutant, both fragments carrying the desired mutation were amplified in the first PCR step using flanking and mutation-carrying primers (mutation-carrying primer: L101C-sense AGTACAGCCTCTCTGC- CTGGGAAGAA; L101C-antisense TTCTTCCCAGGCAGAGAG- GCTGTACT; V302C-sense GCCTATTGCAGATACTTCAATAGC; V302C-antisense AAGTATCTGCAATAGGCTGCCTTCCG; flanking primer: SacII TGTAAAACGACGGCCAGTGAG; BstZ17 I GTATACTGCTCTTGCTAAAGA). Login to comment 200 ABCC7 p.Leu101Cys
X
ABCC7 p.Leu101Cys 16236827:200:121
status: NEW
view ABCC7 p.Leu101Cys details
ABCC7 p.Val302Cys
X
ABCC7 p.Val302Cys 16236827:200:131
status: NEW
view ABCC7 p.Val302Cys details
 Because the h-sMSD1 chimera fully reproduced the mercury sensitivity of sCFTR, we next mutated single residues in hCFTR (L101C and V302C) to the corresponding cysteines (C102 and C303) present in MSD1 of sCFTR. Login to comment 212 ABCC7 p.Val302Cys
X
ABCC7 p.Val302Cys 16236827:212:134
status: NEW
view ABCC7 p.Val302Cys details
 Inhibition of forskolin ϩ IBMX stimulated conductances by 1 ␮M HgCl2 in sCFTR, hCFTR, human-shark (h-s) MSD1, hL101, and V302C. Login to comment