ABCC7 p.Arg29Lys
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 15765539
[PubMed]
Amaral MD et al: "Processing of CFTR: traversing the cellular maze--how much CFTR needs to go through to avoid cystic fibrosis?"
No.
Sentence
Comment
50
Although the simultaneous substitution of all four arginines by lysine (K) residues (4RK: R29K þ R516K þ R555K þ R766K) causes F508del-CFTR to function about one-third as efficiently as wt-CFTR, individual R/K substitutions at some of these positions, i.e., R29K30 and R555K,31 were also described as restoring F508del-CFTR function.
X
ABCC7 p.Arg29Lys 15765539:50:90
status: NEW
PMID: 17098864
[PubMed]
Roxo-Rosa M et al: "Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms."
No.
Sentence
Comment
0
Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms Mo´ nica Roxo-Rosa*† , Zhe Xu‡ , Andre´ Schmidt*† , Ma´rio Neto*, Zhiwei Cai‡ , Cla´udio M. Soares§ , David N. Sheppard‡ , and Margarida D. Amaral*†¶ *Department of Chemistry and Biochemistry, Faculty of Sciences, University of Lisbon, Campo Grande, 1749-016 Lisbon, Portugal; †Centre of Human Genetics, National Institute of Health Dr. Ricardo Jorge, Avenida Padre Cruz, 1649-016 Lisbon, Portugal; ‡Department of Physiology, School of Medical Sciences, University of Bristol, Bristol BS8 1TD, United Kingdom; and §Institute of Chemistry and Biological Technology, New University of Lisbon, 2781-901 Oeiras, Portugal Communicated by Michael J. Welsh, University of Iowa College of Medicine, Iowa City, IA, September 22, 2006 (received for review June 9, 2006) The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation.
X
ABCC7 p.Arg29Lys 17098864:0:1094
status: NEW22 Moreover, Chang et al. (25) rescued the trafficking and function of F508del-CFTR with the simultaneous mutation of the four arginine-framed tripeptides (AFTs) (R29QR31, R516YR518, R553AR555, and R764RR766) present in CFTR termed 4RK (R29K, R516K, R555K, and R766K).
X
ABCC7 p.Arg29Lys 17098864:22:234
status: NEW190 Of note, the work of Hegedus et al. (40), who studied F508del-CFTR in cis with R29K and R555K (called 2RK), suggests that the stability of F508del-2RK-CFTR is temperature-dependent.
X
ABCC7 p.Arg29Lys 17098864:190:79
status: NEW
PMID: 20032308
[PubMed]
Roy G et al: "Interplay between ER exit code and domain conformation in CFTR misprocessing and rescue."
No.
Sentence
Comment
52
To construct pcDNA3.1(ϩ)-CFTR-⌬F508/R29K, an NdeI-BspeI fragment including the 5Ј untranslated region, the amino terminal tail (NT) and MSD1 of CFTR was used as a cassette, and R29K substitution was introduced into pcDNA3.1(ϩ)-CFTR-⌬F508 using this cassette.
X
ABCC7 p.Arg29Lys 20032308:52:49
status: NEWX
ABCC7 p.Arg29Lys 20032308:52:196
status: NEW53 Finally, the pcDNA3.1(ϩ)- CFTR-⌬F508/R29K/R555K was constructed by replacing the BspeI-HpaI fragment of pcDNA3.1(ϩ)-CFTR-⌬F508/R29K with the corresponding fragment from pcDNA3.1(ϩ)-CFTR-⌬F508/R555K.
X
ABCC7 p.Arg29Lys 20032308:53:50
status: NEWX
ABCC7 p.Arg29Lys 20032308:53:153
status: NEW207 R555K Rescues ⌬F508 CFTR by Improving Both Export and Post-ER Stability R555K, alone (Teem et al., 1996) or in combination with R29K (Hegedus et al., 2006) rescues ⌬F508 CFTR.
X
ABCC7 p.Arg29Lys 20032308:207:135
status: NEW208 We found that R29K does not improve ⌬F508 processing, nor does it contribute to ⌬F508 rescue when combined with R555K (2RK) in HEK293 cells and this is true at both 37 and 30°C (Figure 7A).
X
ABCC7 p.Arg29Lys 20032308:208:14
status: NEW209 In BHK cells, R29K alone inhibits ⌬F508 processing but only slightly enhances ⌬F508 processing when combined with R555K at 37°C (Supplemental Figure 2).
X
ABCC7 p.Arg29Lys 20032308:209:14
status: NEW285 (A) HEK293 cells were transiently transfected with ⌬F, ⌬F/ R29K, ⌬F/R555K and ⌬F/R29K/R555K (⌬F/ 2RK) and cultured at 37°C for 20 h (37°C), or further switched to 30°C and incubated for an additional 16 h (30°).
X
ABCC7 p.Arg29Lys 20032308:285:73
status: NEWX
ABCC7 p.Arg29Lys 20032308:285:109
status: NEW337 We found that R29K does not contribute to ⌬F508 rescue in HEK 293 cells (Figure 7A) but slightly improves ⌬F508 rescue only in combination with R555K in BHK cells (Supplemental Figure 2).
X
ABCC7 p.Arg29Lys 20032308:337:14
status: NEW
PMID: 21182301
[PubMed]
Loo TW et al: "The W232R suppressor mutation promotes maturation of a truncation mutant lacking both nucleotide-binding domains and restores interdomain assembly and activity of P-glycoprotein processing mutants."
No.
Sentence
Comment
121
Suppressor mutations can rescueΔF508-CFTRbya variety ofmechanisms.Examplesinclude removal of the ER retention signals (arginine-framed trafficking motif mutations; R29K, R516K, R555K, and R766K) (61, 62), introduction of a combination of CFTR suppressor mutations (F949/Q637R or F29S/F494N/Q637R) that increase solubility of NBD1(63),orintroductionofsuppressormutationssuchasV510D (TMD1) (64) and R1070W(TMD2) (65) that restore NBD1-TMD2 interactions.
X
ABCC7 p.Arg29Lys 21182301:121:170
status: NEW
PMID: 21965669
[PubMed]
Wang W et al: "Thermally unstable gating of the most common cystic fibrosis mutant channel (DeltaF508): "rescue" by suppressor mutations in nucleotide binding domain 1 and by constitutive mutations in the cytosolic loops."
No.
Sentence
Comment
46
For example, Hegedus et al. have shown that eliminating two arginine-based motifs (RXR) from ⌬F508-CFTR (e.g. R29K and R555K) promotes maturation of ⌬F508, but channel activity in lipid bilayers is highly thermally unstable (i.e. inactivates at physiologic temperature) (42).
X
ABCC7 p.Arg29Lys 21965669:46:117
status: NEW
PMID: 18215773
[PubMed]
Pissarra LS et al: "Solubilizing mutations used to crystallize one CFTR domain attenuate the trafficking and channel defects caused by the major cystic fibrosis mutation."
No.
Sentence
Comment
155
Comparison with Other Revertants Using the same cellular system employed to investigate the solubilizing mutations, we recently examined the mechanism of action of two other F508del-CFTR revertants, G550E and 4RK, the simultaneous mutation of four arginine-framed tripeptides (AFTs), R29K, R516K, R555K, and R766K (Roxo-Rosa et al., 2006).
X
ABCC7 p.Arg29Lys 18215773:155:284
status: NEW
PMID: 10445036
[PubMed]
Chang XB et al: "Removal of multiple arginine-framed trafficking signals overcomes misprocessing of delta F508 CFTR present in most patients with cystic fibrosis."
No.
Sentence
Comment
40
This band remains prominent in 3 of the 4 R→K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12).
X
ABCC7 p.Arg29Lys 10445036:40:133
status: NEW42 Arginine-Framed Tripeptide Trafficking Signals in CFTR significantly, however, bands of lower mobility are pro- (A) Schematic depiction of CFTR protein indicating approximate duced by the R29K and 4RK variants (lanes 8 and 12).
X
ABCC7 p.Arg29Lys 10445036:42:188
status: NEW82 With ⌬F508/R29K, low rates of 36 Cl- efflux occurred at considerably delayed times after stimulation.
X
ABCC7 p.Arg29Lys 10445036:82:18
status: NEW127 The following oligonu-peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA.
X
ABCC7 p.Arg29Lys 10445036:127:108
status: NEW128 R29K, CAATTTTGAGGAAAGGATACAAA shall et al., 1994; Zerhusen et al., 1999).
X
ABCC7 p.Arg29Lys 10445036:128:0
status: NEW41 This band remains prominent in 3 of the 4 RK variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12).
X
ABCC7 p.Arg29Lys 10445036:41:132
status: NEW43 Arginine-Framed Tripeptide Trafficking Signals in CFTR significantly, however, bands of lower mobility are pro- (A) Schematic depiction of CFTR protein indicating approximate duced by the R29K and 4RK variants (lanes 8 and 12).
X
ABCC7 p.Arg29Lys 10445036:43:188
status: NEW85 With DF508/R29K, low rates of 36 Cl2 efflux occurred at considerably delayed times after stimulation.
X
ABCC7 p.Arg29Lys 10445036:85:11
status: NEW130 The following oligonu- peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA.
X
ABCC7 p.Arg29Lys 10445036:130:109
status: NEW131 R29K, CAATTTTGAGGAAAGGATACAAA shall et al., 1994; Zerhusen et al., 1999).
X
ABCC7 p.Arg29Lys 10445036:131:0
status: NEW
PMID: 14596935
[PubMed]
Owsianik G et al: "Rescue of functional DeltaF508-CFTR channels by co-expression with truncated CFTR constructs in COS-1 cells."
No.
Sentence
Comment
33
The base pair substitutions (underlined) were introduced using following oligonucleotides: for R29K mutation: 5P-GAAAGGATACAAACAGC- GCCTGGA (sense) and 5P-TCCAGGCGCTGTTTGTATCCTTTC (antisense); for R516K mutation: 5P-CTATGATGAATATAAATA- CAGAAGCGTC (sense) and 5P-GACGCTTCTGTATTTATATTC- ATCATAG (antisense); for R555K mutation: 5P-GGTCAACGAG- CAAAAATTTCTTTAGC (sense) and 5P-GCTAAAGAAATTTT- TGCTCGTTGACC (antisense).
X
ABCC7 p.Arg29Lys 14596935:33:95
status: NEW95 Surprisingly, the R29K mutation did not signi'cantly a&#a1;ect the rescuing properties of WF1 as well as WF2 (Table 1), suggesting the presence of another retention/retrieval motif in the N-terminal tail of CFTR.
X
ABCC7 p.Arg29Lys 14596935:95:18
status: NEW
PMID: 16624253
[PubMed]
Hegedus T et al: "F508del CFTR with two altered RXR motifs escapes from ER quality control but its channel activity is thermally sensitive."
No.
Sentence
Comment
3
Now we have mutated these four AFTs in all possible combinations and found that simultaneous inactivation of two of them (R29K and R555K) is necessary and sufficient to overcome F508del CFTR retention.
X
ABCC7 p.Arg29Lys 16624253:3:122
status: NEW41 The PCR was performed according to standard Stratagene protocols using the same oligonucleotides employed to make the R29K and R555K substitutions previously [32].
X
ABCC7 p.Arg29Lys 16624253:41:118
status: NEW85 We reported earlier that among the single mutants only the R29K substitution produced a very low level maturation and this is not visible on the exposure in Fig. 2A.
X
ABCC7 p.Arg29Lys 16624253:85:59
status: NEW177 However as shown we could not detect any maturation with this mutation alone despite a substantial amount when it was combined with R29K.
X
ABCC7 p.Arg29Lys 16624253:177:132
status: NEW178 We had originally detected a slight effect of R29K alone as well [32].
X
ABCC7 p.Arg29Lys 16624253:178:46
status: NEW
PMID: 23890012
[PubMed]
Farinha CM et al: "Revertants, low temperature, and correctors reveal the mechanism of F508del-CFTR rescue by VX-809 and suggest multiple agents for full correction."
No.
Sentence
Comment
231
EXPERIMENTAL PROCEDURES Cells and Culture Conditions BHK cell lines expressing F508del-4RK (R29K/R516K/R555K/R716K)-, F508del-G550E-, F508del-R1070W-, F508del-V510D-, F508del-R555K-, F508del-V510D/G550E-, F508del-G550E/R1070W-, DAA (D567A)-, 4RK- DAA-, DD/AA (D565A, D567A)-, 4RK-DD/AA-, and R560T-CFTR were produced and cultured as previously described (Roxo-Rosa et al., 2006).
X
ABCC7 p.Arg29Lys 23890012:231:92
status: NEW