ABCMdb

ABCC7 p.Asp192Gly

None has been submitted yet.

Publications

PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."

No. Sentence Comment

369 H139R, G149R, D192G and R258G in the two first CLs inhibited maturation and transport of CFTR to the cell surface. Login to comment

PMID: 12007216 [PubMed] Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."

No. Sentence Comment

111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment

PMID: 9724537 [PubMed] Akabas MH et al: "Channel-lining residues in the M3 membrane-spanning segment of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

222 Several mutations of residues in and flanking the M3 membrane-spanning segment have been identified in patients with CF, including D192G, E193K, H199Y, P205S, and L206W (58, 60-63). Login to comment

PMID: 17662673 [PubMed] Alibakhshi R et al: "Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations."

No. Sentence Comment

37 1 c.406-3TNC I3 T to C at 406-3 mRNA splicing defect 1 p.R170H E5 G to A at 641 Arg to His at 170 1 p.D192G E5 A to G at 707 Asp to Gly at 192 2 p.R334W E7 C to T at 1132 Arg to Trp at 334 4 c.1525-1GNA I9 G to A at 1525-1 mRNA splicing defect 2 p.F508del E10 Deletion of CTT from 1653 Deletion of Phe at 508 25 p.S466X E10 C to G at 1529 Ser to stop at 466 8 c.1677delTA E10 Deletion of TA from 1677 Frame shift 2 p.G542X E11 G to T at 1756 Gly to stop at 542 5 p.S549R E11 T to G at 1779 Ser to Arg at 549 2 p.A566D E12 C to A at 1829 Ala to Asp at 566 2 c.1898+1GNT I12 G→T at 1898+1 mRNA splicing defect 2 c.2183_2184delAAinsG E13 A to G at 2183 and deletion of A at 2184 Frame shift 9 c.2576delA E13 Deletion of A at 2576 Frame shift 1 c.2043delG E13 Deletion of A at 2043 Frame shift 1 c.2184insA E13 Insertion of A after 2184 Frame shift 1 p.R785X E13 C to T at 2485 Arg to stop at 785 2 c.2752-1_2756delGGTGGCinsTTG I14a/ Deletion of GGTGGC mRNA splicing defect 2 E14b From 2752-1 to 2756 and insertion TTG c.2789+5GNA I14b G to A at 2789+5 mRNA splicing defect 6 p.S945L E15 C to Tat 2966 Ser to Leu at 945 2 c.3120+1GNA I16 G to A at 3120+1 mRNA splicing defect 5 c.3121-1GNA I16 G to A at 3121-1 mRNA splicing defect 2 c.3130delA E17a Deletion of A at 3130 Frame shift 4 p.T1036I E17a C to T at 3239 Thr to Ile at 1036 1 p.R1066C E17b C to T at 3328 Arg to Cys at 1066 1 p.L1077P E17b T to C at 3362 Leu to Pro at 1077 1 p.T1086I E17b C to T at 3389 Thr to Ile at 1086 1 p.R1162X E19 C to T at 3616 Arg to stop at 1162 2 p.K1177X E19 A to T at 3361 Lys to stop at 1177 2 c.3850-24GNA I19 G to A at 3850-24 mRNA splicing defect? Login to comment
66 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC→T mutation, and large deletions/ duplications. Login to comment
65 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC࢐T mutation, and large deletions/ duplications. Login to comment

PMID: 9305991 [PubMed] Seibert FS et al: "Disease-associated mutations in cytoplasmic loops 1 and 2 of cystic fibrosis transmembrane conductance regulator impede processing or opening of the channel."

No. Sentence Comment

107 The remaining amino acid substitutions significantly decreased the yield of band C, with relative amounts of "vector only" (background) < G149R-CFTR < H139R-CFTR < R258G-CFTR < D192G-CFTR , wild-type CFTR (Figure 2, bottom). Login to comment
120 In accordance with reduced levels of processing, the H139R, G149R, D192G, and R258G mutations significantly decreased the anion translocation capability of CFTR, whereas the properly processed I148T, I175V, and R297Q variants allowed iodide movement comparable to that of wild type. Login to comment
153 When reconstructed in heterologous expression systems, four of the amino acid substitutions (H139R, G149R, D192G, and R258G) inhibited maturation and transport of CFTR to the cell surface, so that the protein cannot carry out its regular functions at that location. Login to comment

PMID: 8968585 [PubMed] Xie J et al: "Human epithelial cystic fibrosis transmembrane conductance regulator without exon 5 maintains partial chloride channel function in intracellular membranes."

No. Sentence Comment

204 The facts that a splice mutation that deletes exon 5 was found to be a cystic fibrosis disease-causing mutant and that there is an array of cystic fibrosis mutations in the region encoded by exon 5 (L165S, K166E, R170C, 1175V, G178R, D192N, D192G, E193K; Fonknechten et al., 1992; Romey et al., 1994; Zielenski et al., 1991; Audrezet et al., 1994; Mercier et al., 1995; Cystic Fibrosis Mutation Data Base) suggest that exon 5 is important for the structure, function, or both of the CFTR chloride channel. Login to comment
205 The facts that a splice mutation that deletes exon 5 was found to be a cystic fibrosis disease-causing mutant and that there is an array of cystic fibrosis mutations in the region encoded by exon 5 (L165S, K166E, R170C, 1175V, G178R, D192N, D192G, E193K; Fonknechten et al., 1992; Romey et al., 1994; Zielenski et al., 1991; Audrezet et al., 1994; Mercier et al., 1995; Cystic Fibrosis Mutation Data Base) suggest that exon 5 is important for the structure, function, or both of the CFTR chloride channel. Login to comment

PMID: 7516305 [PubMed] Audrezet MP et al: "Identification of three novel mutations (457 TAT-->G, D192G, Q685X) in the Slovenian CF patients."

No. Sentence Comment

4 As a result of this survey 84% of the alleles are now clearly identified and we describe in this paper three novel mutations (457 TAT-->G, D192G, and Q685X). Login to comment
41 D192G The nucleotide variation is A---~Gat position 706 in exon 5, which leads to a glycine instead of an aspartic acid at codon 192. Login to comment
50 Some clinical data of patients with the three novel mutations Patient Exon Mutation Age of Age at Chloride sweat Pancreatic Lung Pseudomonas onset diagnostic test mmol/per 1 function disease aeruginosa CF-53 4 457 TAT--~G Birth 4 months 90.9-167.0 Insufficient Severe Yes 11 G542X CF-67 5 D192G 2 months 3 months 58.8-106.7 Insufficient Moderate No 10 AF508 CF-52 13 Q685X 3 months 6 years 113.4-177.2 Insufficient Severe Yes 10 AF508 Table 2. Login to comment
51 Mutations identified in the population of Slovenia Number of chromosomes Mutations 661 83 AF508 4 G542X 5 R1162X 2 3905 ins T 2 I148T 1 Q552X 1 Q685X 1 S4X 1 457 TAT---~G 1 D192G 1 R1066H 19 Unidentified 121 Exons Frequencies References 10 68.60% Kerem et al. (1989) 11 3.30% Kerem et al. (1990) 19 4.10% Gasparini et al. (1991) 20 1.65% Personal Communication 4 1.65% Personal Communication 11 0.85% Devoto et al. (1991) 13 0.85% This study 1 0.85% Glavac et al. (1993) 4 0.85% This study and Glavac et al. (1993) 5 0.85% This study 17b 0.85% Ftrec et al. (1992) 15.70% by 11 mutations, occurring in 9 exons of the gene (1, 4, 5, 10, 11, 13, 17b, 19, and 20). Login to comment
66 Of the three novel mutations reported here (Q685X, D192G, and 457TAT---~G), two are clearly pathogenic alleles. Login to comment
68 D192G is a missense mutation located in the transmembrane domain of the CFTR, changing a glycine for an aspartic acid. Login to comment
76 The third mutation (D192G) belongs to class 4, leading probably to abnormal conduction. Login to comment

PMID: 23977124 [PubMed] Cifani N et al: "Reactive-oxygen-species-mediated P. aeruginosa killing is functional in human cystic fibrosis macrophages."

No. Sentence Comment

50 Nine of them were F508del homozygous, one was W1282X homozygous, and two carried at least one delta F508del allele (F508del/D192G, F508del/P5L). Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment