ABCMdb

ABCC7 p.Glu116Lys

None has been submitted yet.

Publications

PMID: 11278813 [PubMed] Hammerle MM et al: "Disease-associated mutations in the extracytoplasmic loops of cystic fibrosis transmembrane conductance regulator do not impede biosynthetic processing but impair chloride channel stability."

No. Sentence Comment

75 TABLE I Oligonucleotide primers used to generate mutations Mutation Primer S108F GGAAGAATCATAGCTTtCTATGACCCGGATAAC Y109C AGAATCATAGCTTCCTgTGACCCGGATAACAAG D110H ATCATAGCTTCCTATcACCCGGATAACAAGGAG P111A ATAGCTTCCTATGACgCGGATAACAAGGAGGAA P111L ATAGCTTCCTATGACCtGGATAACAAGGAGGAA E116K CCGGATAACAAGGAGaAACGCTCTATCGCGATT R117C GATAACAAGGAGGAAtGCTCTATCGCGATTTAT R117H GATAACAAGGAGGAACaCTCTATCGCGATTTAT R117L GATAACAAGGAGGAACtCTCTATCGCGATTTAT R117P GATAACAAGGAGGAACcCTCTATCGCGATTTAT E217G ATGGGGCTAATCTGGGgGTTGTTACAGGCGTCT T908N TATGCAGTGATTATCAaCAGCACCAGTTCGTAT P1013L GTCGCAGTTTTACAACtCTACATCTTTGTTGCA FIG. 2. Login to comment
86 However, in the case of E116K the surface signal is disproportionally weaker relative to the immunoblot indicating that it could be somewhat impeded in transport to the cell surface. Login to comment
118 B, squares, P111A; circles, P111L; triangles, E116K. Login to comment
135 The mutation five residues further in the C-terminal direction resulted in a charge reversal (E116K). Login to comment
142 Both R117C and R117L had very unstable open states like S108F and E116K with the cysteine substitution able to maintain openings FIG. 4. Login to comment
171 For example a nucleotide binding domain mutation, G551D, precludes virtually all TABLE II Relative charge transport capacity of mutants Mutants S108F Y109C D110H P111L P111A E116K R117H R117C R117L R117P E217G T908N P1013L Imutant/Iwt 100% 11 15 27 173 105 12 80 27 5 11 10 48 170 FIG. 5. Login to comment
183 The charge-reversal mutation, E116K, at the immediately preceding position had a remarkably similar effect to that of the most perturbing substitutions of Arg-117. Login to comment

PMID: 19843100 [PubMed] Burgel PR et al: "Non-classic cystic fibrosis associated with D1152H CFTR mutation."

No. Sentence Comment

98 Diagnostic features in 42 D1152H subjects according to the other CFTR mutation class Subject Sex (M/F) Other CFTR mutation Sweat Cl- mean (mmol/l) Age at diagnosis (years) Presentation at diagnosis Class I mutations 1 F W1282X 58 4 Pneumonia recurrent bronchitis 2 F W1282X 25 74 Bronchiectasis 3 M W1282X 43 33 CBAVD 4 M G542X 48 39 CBAVD 5 M G542X 72 27 CBAVD 6 F S1206X 18 13 Recurrent bronchitis+ diarrhea 7 F 394delTT 19 41 Bronchiectasis 8 F 394delTT 25 18 Bronchiectasis 9 F Q552X 56 43 Bronchiectasis Class II mutations 10 F F508del 13 42 Bronchiectasis 11 F F508del 40 32 Bronchiectasis 12 F F508del 52 23 Bronchiectasis 13 M F508del 51 15 Bronchiectasis 14 F F508del 100 24 Bronchiectasis 15 M F508del 79 26 Bronchiectasis 16 F F508del - 43 Bronchiectasis 17 M F508del - 23 Bronchiectasis 18 F F508del 19 55 Bronchiectasis 19 F F508del 25 33 Bronchiectasis 20 F F508del 78 15 Bronchiectasis 21 M F508del 90 40 Bronchiectasis 22 F F508del 44 42 Bronchiectasis 23 M F508del 88 11 Bronchiectasis 24 F F508del 63 47 Bronchiectasis 25 F F508del 43 33 Bronchiectasis 26 M F508 del 62 49 Bronchiectasis 27 M F508del 20 - CBAVD 28 M F508del - 27 CBAVD 29 M F508del 42 36 CBAVD 30 M F508del 36 34 CBAVD 31 M F508del 40 36 CBAVD 32 M F508del 41 30 CBAVD 33 M F508del 82 9 Asymptomatic genetic counseling 34 M F508del - 0 Neonatal screening 35 F F508del 53 0 Neonatal screening 36 F F508del 35 0 Neonatal screening 37 M F508del 35 0 Neonatal screening Class III mutation 38 F S549N 75 31 Bronchiectasis Class IV mutations 39 M E116K 80 41 ABPA+ diarrhea 40 M D1152H 34 34 CBAVD 41 M R1070Q 56 38 CBAVD Class V mutation 42 M 3849+10kbC>T 31 40 Asymptomatic genetic counseling ABPA, allergic bronchopulmonary aspergillosis; CBAVD, congenital bilateral absence of the vas deferens. Login to comment

PMID: 22658665 [PubMed] Ooi CY et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis."

No. Sentence Comment

855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

PMID: 15858154 [PubMed] Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."

No. Sentence Comment

83 While ⌬F508 was homozygous in six subjects, seven other less common alleles (G542X, W1204X, R75X, V232D, E116K, T501A, 3272-26 AϾG) were also seen in the homozygous state. Login to comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

108 g D44G, 300delA, W57X, 405+1G>A, D110H, E116K, 541del4, 542del7, L137R, 621+2T>G, I175V, H199R, H199Y, C225X, V232D, Q290X, E292X, G314V, T338I, 1221delCT, W401X, Q452P, I502T, 1716+2T>C, G544S, R560S, A561E, V562I, Y569D, 1898+3A>G, 1898+5G>A, G628R(G>A), 2143delT, G673X, R851X, Q890X, S977F, 3129del4, 3154delG, 3271+1G>A, G1061R, R1066L, R1070W, 3601-17T>C, S1196X, 3732delA, G1249R, 3898insC, 4374+1G>A, del25kb. Login to comment

PMID: 9417117 [PubMed] Lu Y et al: "Co- and posttranslational translocation mechanisms direct cystic fibrosis transmembrane conductance regulator N terminus transmembrane assembly."

No. Sentence Comment

47 CFTR mutations ⌬;E115, E116K, E115K/E116K, and G126D were engineered by PCR overlap extension (35) using sense primers: 1) CCGGATAA- CAAGGAACGCTCTATC, 2) GATAACAAGGAGAAACGCTCTATCGCG, 3) AACAAGAAAAAACGGTCCATCGCGATTTATCTAGGC, 4) GATTTATC- TAGGCATAGACTTATGCCTTCTC, respectively, and complimentary antisense primers (not shown) to generate overlapping 5Ј and 3Ј PCR fragments. Login to comment
52 Plasmids TM1-2.P encoding mutations E116K/G126D and E115K/E116K/G126D were constructed by PCR overlap extension using primers 2 and 3 and pSPCFTR(G126D) template. Login to comment
53 Similarly, plasmids TM1-2.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (5Ј template pSPCFTR(E92A/K95A) and 3Ј template pSPCFTR(G126D); (c) primer 3 (5Ј template pSPCFTR(E92A/ K95A) 3Ј template pSPCFTR(G126D)). Login to comment
55 Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 5Ј PCR reactions. Login to comment
120 To better define the role of TM2 in directing CFTR topology, we attempted to decrease TM2 signal sequence activity by introducing three mutations previously identified in cystic fibrosis patients (G126D, ⌬E115, and E116K) (39). Login to comment
122 Mutations ⌬E115 or E116K had only minor effects on TM2 signal sequence activity based on the fraction of glycosylated chains (Fig. 3A, lanes 1-6). Login to comment
123 However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment
126 PK digestion of mutant ggTM2.P chains (⌬E115, E116K, and E115K/E116K) indicated that the introduction of basic residues flanking the N terminus of TM2, altered TM2 translocation specificity and enabled TM2 to translocate C terminus flanking sequences in a subset of chains. Login to comment
127 This was particularly evident for the E115K/E116K mutant (Fig. 3B, lanes 1-9, upward ar- FIG. 2. Login to comment
139 For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment
143 CFTR cDNA encoding mutations, ⌬;E115, E116K, E115K/E116K, E116K/G126D or E115K/E116K/G126D was therefore truncated at codon Asn186 , and the topology of chains was determined in RRL (Fig. 4). Login to comment
154 However, TM2 mutations E116K/G126D and E115K/E116K/G126D had a relatively minor but reproducible effect on CFTR N terminus topology, 82 and 79% of WT translocation activity, respectively (Fig. 4B, lanes 16-24 and Fig. 5, A and B). Login to comment
155 When the TM1 mutation G85E was introduced into chains containing E116K/G126D or E115K/E116K/G126D mutations, translocation efficiency was further reduced to 45% and 48% of WT levels, respectively (Fig. 5, A and B). Login to comment
159 Thus an efficient signal sequence in either the TM1 or the TM2 position was sufficient to ensure proper CFTR N terminus topology. We also observed that the E115K/E116K mutation, which partially reversed TM2 translocation specificity, was more disruptive than other TM2 mutations. Login to comment
160 Only 55% of truncated E115K/E116K chains achieved correct topology (Fig. 5C), and the G85E mutation had little effect on these chains. Login to comment
54 Similarly, plasmids TM12.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (59 template pSPCFTR(E92A/K95A) and 39 template pSPCFTR(G126D); (c) primer 3 (59 template pSPCFTR(E92A/ K95A) 39 template pSPCFTR(G126D)). Login to comment
56 Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 59 PCR reactions. Login to comment
121 To better define the role of TM2 in directing CFTR topology, we attempted to decrease TM2 signal sequence activity by introducing three mutations previously identified in cystic fibrosis patients (G126D, DE115, and E116K) (39). Login to comment
124 However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment
128 This was particularly evident for the E115K/E116K mutant (Fig. 3B, lanes 1-9, upward ar- FIG. 2. Login to comment
140 For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment

PMID: 25024266 [PubMed] Cui G et al: "Three charged amino acids in extracellular loop 1 are involved in maintaining the outer pore architecture of CFTR."

No. Sentence Comment

15 Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability. Login to comment
31 H&#e4;mmerle et al. (2001) reported that mutations D110H, E116K, and R117H induce no trafficking defect when expressed in baby hamster kidney (BHK) cells but affect channel function significantly. Login to comment
32 When studied in planar lipid bilayers, R117H-CFTR had gating kinetics similar to WT-CFTR, but a reduced single-channel conductance, whereas D110H- and E116K- CFTR displayed unstable channel openings, leading the authors to propose that ECL1 might contribute to maintaining the open pore architecture of CFTR (H&#e4;mmerle et al., 2001). Login to comment
36 CF-causing mutations have been identified in ECL1, including S108F, Y109C/N, D110H/ Y/N,P111A/L,E116K/Q,andR117C/G/H/P/L.Among these residues, D110, E116, and R117 are charged amino acids fully conserved among nine species (Fig. 1 A). Login to comment