ABCC7 p.Ile506Val

[switch to full view]
Comments [show]
Publications
PMID: 10627945 [PubMed] Gundry CN et al: "Rapid F508del and F508C assay using fluorescent hybridization probes."
No. Sentence Comment
148 Several sequence variants near codon 508 should be discriminated by this method, including the benign I506V (Kobayashi et al, 1990), and the disease-causing I507del and 1506del (Nelson et al, 1991).
X
ABCC7 p.Ile506Val 10627945:148:102
status: NEW
Login to comment

PMID: 10681187 [PubMed] Pallares-Ruiz N et al: "Is isolated idiopathic pancreatitis associated with CFTR mutations?"
No. Sentence Comment
51 Kimberg and coworkers1 2 and Klae- veman and colleagues3 have suggested that prostaglandins increase membrane bound adenylate cyclase activity in the small intestinal mucosa, and thus inhibit Na+ -K+ -ATPase activity of gut mucosa.4 5 Recently, Sundaram and colleagues6 reported that inflamed ileums (excess prostaglandin) express low levels of SGLT1 in rabbits, which indicates that Table 1 Characteristics of 10 patients with idiopathic pancreatitis Patient no Sex Current age Age at diagnosis CFTR genotypes Sequence changes IVS8 TGn-Tn 1540 A/G (M470V) 1 M 77 75 -/- TG11-T7/TG11-T7 G/G 2 F 52 41 3041-71A/G TG11-T7/TG11-T9 A/G 4002A/G 3 M 44 42 4404C/T TG10-T7/TG11-T7 A/G 4 F 70 69 875+40A/G TG11-T5/TG11-T7 A/G 5 M 62 61 125G/C TG11-T7/TG11-T7 G/G 6 F 52 50 1716G/A TG11-T5/TG10-T7 A/A 7 M 41 38 125G/C TG11-T7/TG12-T7 A/G 8 M 64 36 -/- TG10-T7/TG10-T9 A/A 9 M 72 69 I506V TG10-T7/TG11-T7 A/G 875+40A/G 10 F 18 NA -/- TG11-T7/TG12-T7 A/G NA, not available.
X
ABCC7 p.Ile506Val 10681187:51:874
status: NEW
Login to comment

PMID: 10746558 [PubMed] Bombieri C et al: "A new approach for identifying non-pathogenic mutations. An analysis of the cystic fibrosis transmembrane regulator gene in normal individuals."
No. Sentence Comment
80 Many (13 out of 20) of the missense mutations change highly conserved (5/5 species analyzed) amino acid residues (R75Q, G85E, I148T, I506V, R668C, G622D, L997F, I1027T, F1052V, L1096R, I1131V, R1162L, N1303K); others affect amino acid residues conserved in 4/5 species (K68 E, R170H, M470V, V562L, S1235R), or in 3/5 species (R31C and G576A; Tucker et al. 1992).
X
ABCC7 p.Ile506Val 10746558:80:133
status: NEW
Login to comment

96 Moreover, 1525-61 A/G (i 9) and 3601-65 C/A (i 18) were detected by SSCA performed in the Spanish sample only (14/82 and 12/80, respectively); these mutations were not identifiable by DGGE as used in the present work The totals are: a378; b362; c380; d356 genes eCertainly a CF-causing mutations fThe most common allele at this site is (TTGA)7 gThe most common allele at this site is T7 hThe frequency shown is that of the M allele Mutation Position North-Central Southern Spain Total East Italy Italy France 82 genes 100 genes 100 genes 100 genes 382 genes % 125 G/C 5`UTR 1 2 7 3 13 3.4 R31C 2 1 1 1 0 3 0.8 K68E 3 1 0 0 0 1 0.3 R75Q 3 1 1 2 0 4 1.0 G85Ee 3 0 1 0 0 1 0.3 406-6 T/C i 3 0 0 1 0 1 0.3 I148T 4 1 0 0 0 1 0.3 621+3 A/G i 4 0 1 0 0 1 0.3 R170H 5 1 0 0 0 1 0.3 875+40 A/G i 6a 11 5 5 2 23 6.0 (TTGA)6 f i 6a 17 11 7 13 48 12.6 1341+28 C/T i 8 1 0 0 0 1 0.3 IVS8-6g T5 i 8 8 2 4 3/78 17a 4.5 IVS8-6g T9 i 8 10 7 10 11/78 38a 10.0 M470Vh 10 42 30 39 27 138 36.1 I506V 10 1 0 0 0 1 0.3 ∆F508e 10 1 0 2 0 3 0.8 1716 G/A 10 2 1 0 5 8 2.1 V562L 12 0 0 1 0 1 0.3 G576A 12 1 0/80 1 0 2b 0.6 G622D 13 0 0/80 1 0 1b 0.3 R668C 13 1 0/80 1 0 2b 0.6 2082 C/T 13 1 0/80 0 0 1b 0.3 2377 C/T 13 0 0/80 0 1 1b 0.3 2694 T/G i 14a 33 23 33 14/80 103c 27.1 2752-15 C/G i 14b 0 3 0 0 3 0.8 3041-71 G/C i 15 0 1 2 0 3 0.8 L997F 17a 0 2 0 0 2 0.5 I1027T 17a 1 0 0 0 1 0.3 F1052V 17b 1 0 0 0 1 0.3 L1096R 17b 0 0 1 0 1 0.3 3417 A/T 17b 1 0 1 0 2 0.5 I1131V 18 0 1 0 0 1 0.3 R1162L 19 0 1 0 0 1 0.3 3690 A/G 19 0 0 0 1/80 1c 0.3 S1235R 19 1 0 0 0 1 0.3 4002 A/G 20 2 3 3 3/80 11c 2.9 4005+28insA i 20 0 1 0 0 0.3 4029 A/G 21 1 0 0 0 1 0.3 N1303Ke 21 1 0 0 0 1 0.3 4404 C/T 24 1 0 1 0 2 0.5 4521 G/A 24 21 16 14/80 15/76 66d 18.5 Total 165 113 137 98 513 encountered in the present survey are possible.
X
ABCC7 p.Ile506Val 10746558:96:973
status: NEW
Login to comment

PMID: 11025834 [PubMed] Wang X et al: "Mutation in the gene responsible for cystic fibrosis and predisposition to chronic rhinosinusitis in the general population."
No. Sentence Comment
30 Analysis of CFTR Genes Genomic DNA samples extracted from the blood of participants were screened for 16 mutations (R117H, 621+1G→T, R334W, R347P, A455E, ⌬I507, ⌬F508, 1717-1 G→A, G542X, S549N, G551D, R553X, R560T, 3849+10 Kb C→T, W1282X, and N1303K) that account for 85% of CF alleles in the white population using the multiplex reverse dot hybridization system (Roche Molecular Systems, Alameda, Calif).16,17 This test also identified the 5T, 7T, and 9T variants of the splice acceptor site in intron 8 and F508C, I507V, and I506V (exon 10) polymorphisms of the CFTR gene.
X
ABCC7 p.Ile506Val 11025834:30:562
status: NEW
Login to comment

PMID: 11388756 [PubMed] Heim RA et al: "Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel."
No. Sentence Comment
56 The 86-mutation assay distinguished ⌬F508 from the F508C, I506V, I506M, and I507V sequence variants.
X
ABCC7 p.Ile506Val 11388756:56:65
status: NEW
Login to comment

PMID: 11994102 [PubMed] Eaton TE et al: "Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis?"
No. Sentence Comment
55 Patients were also screened for CFTR variants in intron 8 (5T, 7T and 9T) and polymorphisms F508C, I506V and I507V.
X
ABCC7 p.Ile506Val 11994102:55:99
status: NEW
Login to comment

PMID: 12089190 [PubMed] Wang X et al: "Development and evaluation of a PCR-based, line probe assay for the detection of 58 alleles in the cystic fibrosis transmembrane conductance regulator (CFTR) gene."
No. Sentence Comment
68 Amplicon Size, bp Mutations (polymorphisms) Exon 13 598 2307 insA Intron 8, exon 09 548 A455E, 5T (7/9 T polymorphism) Exon 10 482 G480C, ⌬I507, ⌬F508 (F508C, I507V, I506V polymorphisms) Intron 10, exon 11 433 1717-1G3A, G542X, G551D, R553X, A559T, R560T Exon 19 420 R1162X, 3659delC Exon 21 397 N1303K Exon 20 359 S1255X, W1282X Exon 07 328 1078delT, R334W, R347P Exon 04, intron 4 288 R117H, 621ϩ1G3T Intron 14b 248 2789ϩ5G3A Intron 19 237 3849ϩ10kbC3T Exon 03 210 G85E, 405ϩ3A3C Intron 5 166 711ϩ1G3T Intron 16 139 3120ϩ1G3A Clinical Chemistry 48, No.
X
ABCC7 p.Ile506Val 12089190:68:180
status: NEW
Login to comment

88 The genotypes of each sample are as follows: lane 1, ϩ/ϩ (ϩ is the wild type); lane 2, 5T, R117H/3659delC; lane 3, G542X/ϩ; lane 4, I506V/ϩ; lane 5, I507V/ϩ; lane 6, F508C/⌬F508; lane 7, G85E/⌬F508; lane 8, 405ϩ3A3C/3120ϩ1G3C; lane 9, R117H/ϩ; lane 10, 621ϩ1G3T/⌬F508; lane 11, 711ϩ1G3T/⌬F508; lane 12, 1078delT/ϩ; lane 13, R334W/⌬F508; lane 14, R347P/⌬F508; lane 15, A455E/ϩ; lane 16, G480C/⌬F508; lane 17, ⌬I507/ϩ; lane 18, ⌬F508/ϩ; lane 19, 1717-1G3A/ϩ; lane 20, G542X/ϩ; lane 21, G551D/⌬F508; lane 22, R553X/ϩ; lane 23, R560T/⌬F508; lane 24, G551D/A559T; lane 25, 2307insA/ϩ; lane 26, 2789ϩ5G3A/⌬F508; lane 27, 3120ϩ1G3A/⌬F508; lane 28, R1162X/R1162X; lane 29, 3659delC/⌬F508; lane 30, 3849ϩ10kbC3T/⌬F508; lane 31, S1255X/⌬F508; lane 32, W1282X/G542X; lane 33, N1303K/ϩ.
X
ABCC7 p.Ile506Val 12089190:88:156
status: NEW
Login to comment

89 1122 Technical Briefs I506V/⌬F508 genotype showed a similar result.
X
ABCC7 p.Ile506Val 12089190:89:23
status: NEW
Login to comment

91 However, the other allele did not hybridize with the ⌬F508 probe because it did not contain that mutant sequence, nor did it hybridize with the wild-type probe because the A3G transition (data not shown), which gives rise to the I506V polymorphism, prevents hybridization to that sequence.
X
ABCC7 p.Ile506Val 12089190:91:236
status: NEW
Login to comment

98 On the other hand, the ⌬F508 mutation is the most common CF allele, and three polymorphisms (I506V, I507V, and F508C) can interfere with hybridization of the wild-type oligonucleotide sequence.
X
ABCC7 p.Ile506Val 12089190:98:100
status: NEW
Login to comment

99 Thus, the presence of oligonucleotides corresponding to the three polymorphisms in the Research Prototype Cystic Fibrosis Assay-31 test avoids misdiagnosis of ⌬F508/I506V, I507V, or F508C compound heterozygotes.
X
ABCC7 p.Ile506Val 12089190:99:172
status: NEW
Login to comment

PMID: 12437773 [PubMed] Huber K et al: "Survey of CF mutations in the clinical laboratory."
No. Sentence Comment
36 F508C, I507V, I506V polymorphism exon 11 1717-1G → A, G542X, S549N, G551D, R553X, R560T exon 20 W1282X exon 21 N1303K intron 19 3849+10kb C → T Innogenetics assay: exon 3 394delTT, G85E, E60X exon/intron 4 621+1G-T, R117H exon 7 1078delT, R347P, R334W exon 13 2143delT, 2183AA-G, 2184delA exon 19 R1162X, 3659delC intron 5 711+5G-A intron8/exon 9 A455E,, 5T,7T,9T intron 14b 2789+5G-A intron 19 3849+10kb C-T Table 2: Genotypes of patients with mutations, final results Group 1) (patients with symptoms typical for/indicative of CF) No.
X
ABCC7 p.Ile506Val 12437773:36:14
status: NEW
Login to comment

PMID: 15010427 [PubMed] Strom CM et al: "Direct visualization of cystic fibrosis transmembrane regulator mutations in the clinical laboratory setting."
No. Sentence Comment
178 The optimal spotting conditions for each probe are indicated by the boxes around spots in C. wild-type controls and heterozygotes for each ACMG mutation and polymorphism, DNA from 12 compound heterozygotes (⌬F508/1898 ϩ 1GϾA, 711 ϩ 1GϾT/⌬F508, G85E/621 ϩ 1GϾT, 3659delC/⌬F508, 3120 ϩ 1GϾA/ 621 ϩ 1GϾT, R347P/G551D, A455E/⌬F508, R560T/ dF508, R553X/⌬F508, 621 ϩ 1GϾT/⌬F508, 621 ϩ 1GϾT/ 711 ϩ 1GϾT, R117H/⌬F508, and I506V/⌬F508) and DNA from 4 homozygous patients (⌬F508 and 2789 ϩ 5GϾA, 3849 ϩ 10kbCϾT, and G542X) was used in validation experiments.
X
ABCC7 p.Ile506Val 15010427:178:560
status: NEW
Login to comment

181 Expected visual spot patterns, as is shown in Fig. 3C, were observed with the exception of a compound heterozygote (I506V/⌬F508) and a homozygous mutation ⌬F508/⌬F508 in exon 10.
X
ABCC7 p.Ile506Val 15010427:181:116
status: NEW
Login to comment

184 For example, wild-type probes for I506V and I507V share common sequences with the ⌬F508 probe, and ⌬I507 and F508C have identical wild-type sequence (see Table 2 in the online Data Supplement); this is not surprising because they detect mutations on three contiguous codons.
X
ABCC7 p.Ile506Val 15010427:184:34
status: NEW
Login to comment

185 As a consequence, when the ⌬F508/⌬F508 homozygous mutant sample was tested the F508C, ⌬I507, I506V, and I507V wild-type probes all lost activity, and in the case of the I506V/⌬F508 compound heterozygote, the I507V wild-type probe lost activity.
X
ABCC7 p.Ile506Val 15010427:185:114
status: NEW
X
ABCC7 p.Ile506Val 15010427:185:190
status: NEW
Login to comment

PMID: 15044340 [PubMed] Dempsey E et al: "Detection of five common CFTR mutations by rapid-cycle real-time amplification refractory mutation system PCR."
No. Sentence Comment
21 The F508del ARMS primers (CF-DFjN and CF-DFwM) are specific for this mutation and are not influenced by the benign I506V and F508C mutations.
X
ABCC7 p.Ile506Val 15044340:21:115
status: NEW
Login to comment

PMID: 15173476 [PubMed] Comeau AM et al: "Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections."
No. Sentence Comment
78 DNA Amplification and colorimetric detection on linear array strips with Analyte Specific Reagents for a 16-mutation assay (gift from Roche Molecular Systems, Alameda, CA) and a 27-mutation assay (Linear Array CF-31; Roche Molecular Biochemicals, Indianapolis, IN) were used.20 For both panels, the DNA assay assessed only CFTR mutations; detection of polymorphisms was incorporated as a reflex test for confirmation of putative ⌬F508 homozygotes (assay for F508C, I506V, and I507V) or for genotype elucidation on detection of 2 mutations including R117H (assay for IVS8polyT 5/7/9T).
X
ABCC7 p.Ile506Val 15173476:78:472
status: NEW
Login to comment

PMID: 15371908 [PubMed] Buyse IM et al: "Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation."
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively.
X
ABCC7 p.Ile506Val 15371908:77:907
status: NEW
Login to comment

PMID: 15371909 [PubMed] Edelmann L et al: "Cystic fibrosis carrier screening: validation of a novel method using BeadChip technology."
No. Sentence Comment
7 Key Words: cystic fibrosis, carrier screening, BeadChip technology Cystic fibrosis (CF) results from mutations in the CF transmembrane conductance regulator (CFTR) and is a common autosomal recessive disorder, particularly in individuals of Caucasian and Ashkenazi Jewish (AJ) ancestry.1,2 CF also affects individuals from other ethnic groups, including Hispanics, African Americans, and Asians with carrier frequencies ranging from 1in46to1in90.1 Morethan1000mutationshavebeendescribed in the CFTR gene and although many of them are private mutations, there are a number of mutations that are distributed worldwide and still others that are common to specific ethnic groups.3 In2001,theAmericanCollegesofMedicalGenetics(ACMG)and Obstetrics and Gynecologists (ACOG) established guidelines for prenatal carrier testing for CF that included a panel of 25 panethnic mutations with allele frequencies Ն 0.1% among CF patients inNorthAmerica.1,4 Inaddition,theyrecommendedthatcarriers of R117H be subsequently tested for the 5/7/9T polymorphic alleles in intron 8 and that individuals positive for delF508 and delI507 have reflex testing for interference from the benign variants F508C, I506V, and I507V.1 The ACMG/ACOG recommendations precipitated a dramatic increase in the number of CF tests performed in genetic testing laboratories.
X
ABCC7 p.Ile506Val 15371909:7:1188
status: NEW
Login to comment

105 Genomic DNA from an F508C and an I506V carrier were amplified with the Group I multiplex primer mix and analyzed using the BeadChip assay system.
X
ABCC7 p.Ile506Val 15371909:105:33
status: NEW
Login to comment

108 In addition, the PCR products amplified from the genomic DNA of F508C and I506V carriers and the single-stranded oligonucleotides for the I507V and I506M only elongated from the normal probe indicating that these variants did not interfere with allele discrimination.
X
ABCC7 p.Ile506Val 15371909:108:74
status: NEW
Login to comment

PMID: 15536480 [PubMed] Modiano G et al: "A large-scale study of the random variability of a coding sequence: a study on the CFTR gene."
No. Sentence Comment
33 In the Tajima`s test,19 the null hypothesis of neutrality is rejected if a statistically significant difference between p Common and rare nonsynonymous and synonymous cSNSs G Modiano et al European Journal of Human Genetics Table 1 List of the 61 cSNSsa encountered in the present survey The random samples of genes (and the technique utilized) cSNS variants found NE Italy (DGGE) Central Italy (DGGE) Southern France (DGGE) Northern France (DHPLC) Spain (SSCA) Czechia (DGGE) Hb  104 Exon Exon Length (bp) Ref. no. SNS SASc 1st 100d 2nd 500 1st 100d 2nde 1st 100d 2nd 500 1st 100 2nde 82d 72 Abs. Freq. Total sample size q  104 se  104 NSf Sf 1g 53 0 0 0 0 0/452 0 924 2 111 1 223C4T R31C 1 1 1/500 1 1 0 0/450 0 5 (11) 1 932 (2 432) 45.23 13.61 90 2 224G4T R31L 0 0 0/500 0 0 0 1/450 0 1 1 932 5.17 5.17 10 3 257C4T S42F 0 0 1/500 0 0 0 0/450 0 1 1 932 5.17 5.17 10 3 109 4 334A4G K68E 1 0 0 0/498 0 0 0 0/452 0 0 1 2 504 3.99 3.99 8 5 352C4T R74W 0 0 0 0/498 0 0 0 1/452 0 0 1 2 504 3.99 3.99 8 6 356G4A R75Q 1 7 1 7/498 2 9 2 9/452 0 2 40 (40) 2 504 (2 544) 157.23 24.66 310 7 386G4A G85E 0 0 1 1/498 0 0 0 0/452 0 0 2 2 504 7.99 5.65 16 4 216 8 482G4A R117H 0 0 0 0/292 0 2 0 1/456 0 0 3 2 302 13.03 7.52 26 9 528T4G I132M 0 0 0 0/292 0 0 0 1/456 0 0 1 2 302 4.34 4.34 8 10 575T4C I148T 1 2 0 1/292 0 0 0 1/456 0 1 6 2 302 26.06 10.63 52 5 90 11 640C4T R170C 0 0 0 0/6 0 0 1/448 0 1 1 436 6.96 6.96 14 12 641G4A R170H 1 1 0 0/6 0 0 2/448 0 4 (4) 1 436 (1 930) 20.73 10.35 41 6a 164 0 0 0/6 0 0 0/432 0 0 992 6b 126 0 0 0/6 0 0 0/454 0 942 7 247 0 0 0/6 0 0 0/796 0 1 284 8 93 13 1281G4A L383 0 0 0 0/6 0 0 1/456 0 0 1 1 516 6.60 6.60 13 9 183 14 1402G4A G424S 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 15 1459G4T D443Y 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 10 192 16 1540A4G M470Vh 42 197 30 37/96 39 199 (i) (i) 27 571(736) 1 484 (1 912) 3849.37 111.28 4 735 17 1598C4A S489X 0 0 0 0/96 0 0 0 1/796 0 1 2 374 4.21 4.21 8 18 1648A4G I506V 1 0 0 0/96 0 0 0 0/796 0 1 2 374 4.21 4.21 8 19 1655T4G F508C 0 1 0 0/96 0 0 0 1/796 0 2 2 038 8.42 5.96 17 20 1716G4A Q528 2 16 1 0/96 0 19 i I 5 43 (58) 1 478 (2 024) 286.56 37.08 557 11 95 21 1756G4T G542X 0 2 0 0/134 0 0 0/796 0 0 2 1 984 10.08 7.12 20 22 1764T4G G544 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 23 1784G4A G551D 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 12 87 24 1816G4A V562I 0 0 0 0 1 0 0/450 0 0 1 (1) 2 004 (2 504) 3.99 3.99 8 25 1816G4C V562L 0 0 0 1 0 0 1/450 0 0 2 (3) 2 004 (2 504) 11.98 6.91 24 26 1859G4C G576A 1 2 0 1 11 0 8/450 0 0 23 (27) 2 004 (2 538) 106.38 20.36 213 13 724j 449 27 1997G4A G622D 0 0 0/80 0/96 1 0 0 0/444 0 1 2 002 5.00 5.00 10 28 2082C4T F650 1 0 0/80 0/20 0 0 0 0/444 0 1 (1) 1 926 (2 412) 4.15 4.15 8 29 2134C4T R668C 1 2 0/80 0/96 1 11 0 12/444 0 27(32) 2 002 (2 558) 125.10 21.98 247 275 30 2377C4T L748 0 0 0/6 0 1 1 388 25.77 25.77 52 14a 129 31 2670G4A W846X 0 0 0/6 0 1 0/452 0/80 0 1 1 010 9.90 9.90 20 32 2694T4G T854 33 23 0/6 33 38 149/452 14/80 11 301 1 010 2980.20 143.92 4 184 33 2695G4A V855I 0 0 0/6 0 0 1/452 0/80 0 1 1 010 9.90 9.90 20 14b 38 0 0 0 0/520 0 0 0 0/446 0 2 448 15 251 34 2816G4C S895T 0 0 0/6 0 0 2/436 0 0 2 996 20.08 14.18 40 35 2831A4C N900T 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 36 2988G4C M952I 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 37 3030G4A T966 (2)k (1)k 0 6/436 0 6 (25)k 618 (1814)k 137.82 27.37 272 38 3032T4C L967S 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 16 80 0 0 0/498 0 0 0/450 0 0 1 502 17a 151 39 3123G4C L997F 0 2 2 1/494 0 7 1 4/454 0 0 17 2 502 67.95 16.42 135 40 3157G4A A1009T 0 2 0 0/494 0 0 0 0/454 0 0 2 2 502 7.99 5.65 16 41 3212T4C I1027T 1 0 0 0/494 0 0 0 0/454 0 0 1 2 502 4.00 4.00 8 17b 228 42 3286T4G F1052V 1 1 0 1/194 0 0 0 0/452 0 0 3 (3) 2 200 (2 240) 13.39 7.73 27 43 3337G4A G1069R 0 1 0 0/194 0 0 0 0/452 0 0 1 2 200 4.55 4.55 9 CommonandrarenonsynonymousandsynonymouscSNSs GModianoetal 186 EuropeanJournalofHumanGenetics 44 3345G4T Q1071H 0 0 0 0/194 0 1 0 0/452 0 0 1 2 200 4.55 4.55 9 45 3417A4T T1995 1 3 0 0/194 1 1 0 0/452 0 0 6 (8) 2 200 (2 506) 31.92 11.27 64 46 3419T4G L1096R 0 0 0 0/194 1 0 0 0/452 0 0 1 2 200 4.55 4.55 9 47 3477C4A T1115 0 0 0 0/194 0 0 0 1/452 0 0 1 2 200 4.55 4.55 9 18 101 48 3523A4G I1131V 0 0 1 0/10 0 0 0/448 0 0 1 (2) 1 512 (1 908) 10.48 7.07 21 49 3586G4C D1152H 0 0 0 0/10 0 0 1/448 0 0 1 1 512 6.61 6.61 13 19 249 50 3617G4T R1162L 0 0 1 1/494 0 0/260 0 0/454 0 0 2 2 262 8.84 6.25 18 51 3690A4G Q1186 0 0 0 0/494 0 0/260 0 0/454 1 0 1 2 262 4.42 4.42 9 52 3813A4G L1227 0 1 0 0/494 0 0/260 0 0/454 0 0 1 2 262 4.42 4.42 9 53 3837T4G S1235R 1 1 0 1/494 0 4/260 0 7/454 0 1 15 (15) 2 262 (2 310) 69.94 16.71 140 20 156 54 4002A4G P1290 2 3 0/6 3 5 18/454 3/80 2 36 1 012 357.73 58.22 690 21 90 55 4009G4A V1293I 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 56 4029A4G T1299 1 0 0/6 0 1/300 0 1/456 0 0 3 (8) 1 316 (2 330) 34.33 12.12 69 57 4041C4G N1303K 1 0 0/6 0 0/300 0 0/456 0 0 1 1 316 7.60 7.60 15 58 4085T4C V1318A 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 22 173 0 0 0/18 0 0 0/450 0 0 1 022 23 106 0 0 0 0/6 0 0 0/448 0 1 436 24l 198+3 59 4404C4T Y1424 1 0 0/6 1 2 5/420 0 2 11 (32) 980 (2 516) 127.19 22.34 251 60m 4521G4A Q1463 (21) (16) (3/32) (14/80) (30) (94/420) 15/76 (17) 15 (227) 76 (1052) 2142.86 131.07 3 367 61 4563T4C D1477 0 0 0/6 0 1 0/420 0 0 1 980 10.20 10.20 20 Totals 6 525 9 584 16 109 The bracketed figures include also the RFLP analysis data (see Materials and methods); the NE Italy, Central Italy, Southern and Northern France are each subdivided into two samples where the 1st is made up of 100 genes.
X
ABCC7 p.Ile506Val 15536480:33:1960
status: NEW
Login to comment

PMID: 15784035 [PubMed] Gallegos-Orozco JF et al: "Lack of association of common cystic fibrosis transmembrane conductance regulator gene mutations with primary sclerosing cholangitis."
No. Sentence Comment
55 CFTR Mutations and Associated Phenotype Classic Nonclassic Cystic Fibrosis Cystic Fibrosis Variant Normal 621 + 1G→T R117H G85E* 7T 711 + 1G→T R334W 5T† 9T 1078delT R347P M470V‡ F508C I507 A455E I507V F508 2789 + 5G → A I506V 1717 - 1G→A 3849 + 10kbC→T G542X G551D R553X R560T R1162X 3659delC W1282X N1303K * Classic cystic fibrosis and nonclassic cystic fibrosis.
X
ABCC7 p.Ile506Val 15784035:55:255
status: NEW
Login to comment

PMID: 15860566 [PubMed] Krafft AE et al: "Time-motion analysis of 6 cystic fibrosis mutation detection systems."
No. Sentence Comment
50 CFTR mutation detection system OLA, Ver. 3 INNO-LiPA CF Gold 1.0 Tag-It CF 40 ؉ 4 CF eMAP/ Bead Chip Invader Source Abbott (ABI/ Celera) Innogenetics Roche TM Biosciences BioArray Solutions Third Wave Assay type OLA Reverse slot-blot ASOa Reverse slot-blot ASO ASPE ASPE Invader technology Enzymatic reactions (n) Multiplex PCR (1); OLA (1) Multiplex PCR (2); SA-HRP (1) Multiplex PCR (1); SA-HRP (1) Multiplex PCR (1); Exo-SAP (1); ASPE (1) Multiplex PCR (1); Exo-SAP (2); ASPE (1) Cleavase (6) Special equipment ABI 3100 capillary electrophoresis Auto-LiPA I Gemini Twin shaking water bath Luminex 100 Array imaging system Tecan GENios plate reader Additional Mutations 7 11 6 16 12 Polymorphisms 5/7/9T 5/7/9T 5/7/9T Reflex tests required 5/7/9T Yes Nob Nob Nob Yes Yes I506V/I507V Yes Noc No No No Yes Automated allele calling Yes No No Yes Yes No a ASO, allele-specific oligonucleotides; SA-HRP, streptavidin-conjugated horseradish peroxidase; Exo-SAP, exonuclease plus shrimp alkaline phosphatase digestion.
X
ABCC7 p.Ile506Val 15860566:50:779
status: NEW
Login to comment

PMID: 17850636 [PubMed] Girardet A et al: "Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements."
No. Sentence Comment
28 CFTR mutations identified through the neonatal screening of 84 newborns Mutations Frequency (%) p.Phe508del* 59.52 p.Arg117His* 5.35 p.Gly542X* 2.98 [3849110 kbC.T]* 2.39 p.Arg334Trp* 1.19 p.Arg1162X* 1.19 [2183AA.G]* 1.19 [1717-1G.A]* 1.19 p.Arg1066Cys 1.19 p.Glu1104X 1.19 Total 77.38 Mutations found only once 22.62 Mutations found in a single cystic fibrosis allele: p.Arg75X*, p.Tyr122X*, 71111G.T*, 1078delT*, p.Ile507del*, p.Gly551Asp*, p.Ser1251Asn*, p.Trp1282X*, p.Asn1303Lys*, 62113A.G, p.Leu206Trp, p.Gln220X, p.Gln237Glu, 100115G.A, (TG)12T5, p.Ile506Val, p.Ile506Thr, 1717- 3T.C, p.Leu558Ser, 1802delC, p.Lys710X, p.Leu732X, 2380del8, p.Cys832X, 262211G.A, p.Arg851X, 2634delT, 3007delG, p.Leu997Phe, 3041-15T.G, 3121-1G.A, p.Arg1102X, p.Gly1127Glu, 3750delAG, 3850-1G.A, 400511G.A, and two large rearrangements c.54-5811_c.
X
ABCC7 p.Ile506Val 17850636:28:557
status: NEW
Login to comment

PMID: 18676584 [PubMed] Zhou L et al: "Snapback primer genotyping with saturating DNA dye and melting analysis."
No. Sentence Comment
102 All heterozygotes resolve into 2 melting peaks except for the I506V heterozygote; however, even the I506V heterozygote is clearly distinguished from other genotypes by the shape of its melting curve after high-resolution melting analysis.
X
ABCC7 p.Ile506Val 18676584:102:62
status: NEW
X
ABCC7 p.Ile506Val 18676584:102:100
status: NEW
Login to comment

193 Snapback 1 covered the F508del, I507del, F508C, and I506V variants with melting transitions between 46 and 60 °C.
X
ABCC7 p.Ile506Val 18676584:193:52
status: NEW
Login to comment

196 Samples included wild type (circles), compound F508del/Q493X heterozygote (connected small diamonds), I506V heterozygote (small diamonds), F508C heterozygote (small squares), I507del heterozygote (large squares), F508del heterozygote (connected large diamonds), and F508del homozygote (connected squares).
X
ABCC7 p.Ile506Val 18676584:196:102
status: NEW
Login to comment

PMID: 18685558 [PubMed] Dequeker E et al: "Best practice guidelines for molecular genetic diagnosis of cystic fibrosis and CFTR-related disorders--updated European recommendations."
No. Sentence Comment
144 A (T)5 variant can either be associated with (TG)11, (TG)12, (TG)13, and rarely (TG)15 repeats.74 When (T)5 is found in diagnostic testing, for example, for CBAVD or atypical presentation, determination of Table 4 Classification of CFTR mutations with regard to their potential for causing disease Mutation group Examples CF-causing F508del Mainly nonsense, frameshift, splicing (invariant dinucleotide): G542X, R553X, W1282X, 2183AA4G, 3659delC, 1717-1G4A, 3120+1G4A Missense that severely affects CFTR synthesis or function: G551D, N1303K, R347P 2789+5G4A, 3849+10kbC4T, 3272-26A4G, L206Wa , D1152Ha , (TG)13(T)5a CFTR-related disorders associated L206Wa , D1152Ha , (TG)13(T)5a [R117H;(T)7], (TG)12(T)5, L997F, V562I, [R668C;G576A;D443Y], [R74W;D1270N] (TG)11(T)5b , S1235Rb No clinical consequences 875+40A4G, M470V (1540A4G), I506V (1648A4G), F508C (1655T4G), 1716G4A, 2694T4G, 4002A4G, 2752-15G4C (TG)11(T)5b , S1235Rb Unproven or uncertain clinical relevance Mainly missense mutations G622D, R170H, V938G, I125T Putative splice mutations: 406-6T4C, 2752-26A4G, 3601-17T4C Only a fraction of mutations and patients have been characterized in detail and, with the exception of frequent mutations, only small numbers of patients have been available for the study of most mutations.
X
ABCC7 p.Ile506Val 18685558:144:831
status: NEW
Login to comment

PMID: 19372188 [PubMed] Bickmann JK et al: "A novel approach to CFTR mutation testing by pyrosequencing-based assay panels adapted to ethnicities."
No. Sentence Comment
113 The clinically irrelevant variants I506V, I507V,andF508C,whicharelocatedincloseproximityto these mutations, change the expected pyrograms dramatically (involving all peaks 3Ј of the base exchange), thereby virtually eliminating any chance of misdiagnosis.
X
ABCC7 p.Ile506Val 19372188:113:35
status: NEW
Login to comment

129 Furthermore, the PSQ-based first-level test avoids common pitfalls, as do the most recent assays: It correctly discriminates G551D and R553X, as well as I507del and F508del (Fig. 3; see Fig. 1 in the online Data Supplement), thus obviating reflex testing for benign sequence variations such as I506V, I507V, and F508C.
X
ABCC7 p.Ile506Val 19372188:129:294
status: NEW
Login to comment

148 Fig. 2 in the online Data Supplement illustrates the capability of the assay to discriminate I507del, F508del, 1677delTA, and the interfering benign variants I506V, I507V, and F508C.
X
ABCC7 p.Ile506Val 19372188:148:158
status: NEW
Login to comment

PMID: 20393308 [PubMed] Chandrasekharan S et al: "Impact of gene patents and licensing practices on access to genetic testing for cystic fibrosis."
No. Sentence Comment
184 I506V, I507V, and F508C are performed only as reflex tests for unexpected homozygosity for ⌬F508 and/or ⌬I507.
X
ABCC7 p.Ile506Val 20393308:184:0
status: NEW
Login to comment

PMID: 20638569 [PubMed] Goetzinger KR et al: "An update on cystic fibrosis screening."
No. Sentence Comment
53 Given that 5% of the general population will test positive for the 5T polymorphism alone, this test is recommended only as a reflex to a positive R117H result.22,23 Non CF-causing variants, including I506V, I507V, and F508C, can mistakenly cause a false-positive result based on laboratory and testing methodologies.
X
ABCC7 p.Ile506Val 20638569:53:200
status: NEW
Login to comment

54 For example, in patients who screen positive for DF508 carrier status and for one of the aforementioned mutations, a false-positive test for DF508 homozygosity may be obtained, although the patient is an otherwise healthy individual.22 Although F508C has been associated with CBAVD, neither I506V nor I507V have been associated with any phenotypic manifestations of classical CF or CBAVD.24 Therefore, reflex testing for I506V, I507V, and F508C should be performed in any healthy individual who tests positive for DF508 or DI507 homozygosity, but these mutations should not be otherwise used for a priori testing.
X
ABCC7 p.Ile506Val 20638569:54:291
status: NEW
X
ABCC7 p.Ile506Val 20638569:54:421
status: NEW
Login to comment

PMID: 21474639 [PubMed] Rohlfs EM et al: "Cystic fibrosis carrier testing in an ethnically diverse US population."
No. Sentence Comment
61 The mutation analysis discriminated between p.F508del and the benign polymorphisms p.F508C, p.I506V, and p.I507V.
X
ABCC7 p.Ile506Val 21474639:61:94
status: NEW
Login to comment

PMID: 9921909 [PubMed] Bombieri C et al: "Complete mutational screening of the CFTR gene in 120 patients with pulmonary disease."
No. Sentence Comment
62 Five mutations (G576A, R668C, R74W, R31C, and I506V) are not thought to be the cause of CF (CFGAC website): three of them (G576A, R668C, and R74W) have been found in CBAVD patients (Anguiano et al. 1992; Chillon et al. 1995; Mercier et al. 1995; Verlingue et al. 1996), R31C was described in a DBE patient (Girodon et al. 1997), and I506V was found in the normal allele in the father of a CF child (Ghanem et al. 1994).
X
ABCC7 p.Ile506Val 9921909:62:46
status: NEW
X
ABCC7 p.Ile506Val 9921909:62:333
status: NEW
Login to comment

88 of cases CFTR gene PolyTb status tested mutationa DBE 23 1 G576A-R668C/L997F 7/9 1 ∆F508/L997F 9/9 1 ∆F508/- 7/9 1 R1066C/- 5/7 1 3667ins4/- 5/7 1 R75Q/- 7/7 1 M1137V/- 7/7 1 -/- 5/5 3 -/- 5/7 10 -/- 7/7 2 -/- 7/9 CB 27 1 P111L/- 7/7 1 R117H/- 7/7 1 E585X/- 7/7 1 P1072L/- 7/7 1 -/- 5/7 15 -/- 7/7 6 -/- 7/9 1 -/- 9/9 E 25 1 R668C/- 7/7 6 -/- 5/7 16 -/- 7/7 6 -/- 7/9 S 8 1 E826K/- 7/7 1 ∆F508/- 7/9 1 4382delA/- 7/7 1 L997F/- 7/9 1 V754M/- 7/9 3 -/- 7/7 LC 26 1 I148T/- 5/7 1 D1270N-R74W 5/7 1 D651N/- 7/7 1 Y301C/- 7/7 1 -/- 5/7 16 -/- 7/7 5 -/- 7/9 TB 4 1 -/- 5/7 1 -/- 7/7 2 -/- 7/9 Pneumonia 5 4 -/- 7/7 1 -/- 5/7 Pnx 2 2 -/- 7/7 Controls 68 1 L997F/- 7/9 1 R31C/- 7/7 1 I506V/- 5/7 1 -/- 5/7 1 -/- 5/9 23 -/- 7/7 4 -/- 7/9 1 -/- 9/9 2 ?
X
ABCC7 p.Ile506Val 9921909:88:697
status: NEW
Login to comment

120 Three missense mutations were detected in 33 controls: L997F, which is present in two DBE and in one sarcoidosis patients; R31C, which was first described in an apparently unaffected 6-year-old child (Ghanem et al. 1994) and next in a DBE patient (Girodon et al. 1997); I506V, which was described in a healthy parent of a CF patient who bore ∆F508 on the other chromosome (Kobayashi et al. 1990).
X
ABCC7 p.Ile506Val 9921909:120:270
status: NEW
Login to comment

PMID: 15858154 [PubMed] Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."
No. Sentence Comment
26 Fourteen novel amino acid changing variants were identified in a total of 183 CFTR sequence changes (excluding the common M470V and I506V polymorphism and 5T/7T/9T variants in intron 8).
X
ABCC7 p.Ile506Val 15858154:26:132
status: NEW
Login to comment

PMID: 15681482 [PubMed] Chou LS et al: "Complete gene scanning by temperature gradient capillary electrophoresis using the cystic fibrosis transmembrane conductance regulator gene as a model."
No. Sentence Comment
75 Mutation Samples with Known Genotypes Scanned by TGCE* Exon Mutation† Amplicon size (bp) Location of mutation from 5Ј end (bp) Base change Detection‡ 3 G85E 234 124 G to A 1/1 3 394delTT 234 132 del TT 1/1 4 R117H 270 83 G to T 2/2 4 I148T 270 176 T to C 3/3 Intron 4 621 ϩ 1 G/T 270 233 G to T 1/1 5 663delT/663delT 186 75 del T 0/1 Intron 5 711 ϩ 1 G/T 186 124 G to T 1/1 7 R334W 345 208 C to T 1/1 7 R347P 345 248 G to C 1/1 9 A455E 263 155 C to A 2/2 10 I506V 292 168 A to G 1/1 10 ⌬I507 292 171 del ATC 2/2 10 ⌬F508 292 174 del TTT 2/2 10 ⌬F508/⌬F508 292 174 del TTT 0/1 10 F508C 292 175 T to G 1/1 10 V520F 292 210 G to T 1/1 Intron 10 1717-1 G/A 175 50 G to A 1/1 11 G542X 175 90 G to T 2/2 11 G542X/G542X 175 90 G to T 0/1 11 G551D 175 118 G to A 3/3 11 R553X 175 123 C to T 3/3 11 R560T 175 145 G to C 2/2 13 2184delA 834 356 del A 1/1 Intron 14b 2789 ϩ 5G/A 192 102 G to A 1/1 Intron 16 3120 ϩ 1G/A 216 111 G to A 1/1 19 R1162X 322 68 C to T 1/1 19 3659delC 322 111 del C 1/1 20 W1282X 206 154 G to A 1/1 21 N1303K 250 175 C to G 2/2 Total exon/intron Overall accuracy 17 93% *Samples were compared with their respective wild-type control (confirmed by sequencing).
X
ABCC7 p.Ile506Val 15681482:75:490
status: NEW
Login to comment

PMID: 16156102 [PubMed] Dunbar SA et al: "Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array."
No. Sentence Comment
104 Nucleotides were added to the 5' and 3' ends of the probe sequences to improve hybridization efficiency of the probe to its perfect-match target, thus 152 Dunbar and Jacobson Table 2 (Continued) Target Microsphere Probe sequence Modificationb Sequence 5' → 3' set 46B 1898+1G→A 5'-AmMC12 TATTTGAAAGATATGTTCTTTG 027 47B 3120+1G 5'-AmMC12 CTTCATCCAGGTATGTAAAAAT 043 48B 3120+1G→A 5'-AmMC12 CTTCATCCAGATATGTAAAAAT 055 Reflex panel R2B I506V 5'-AmMC12 CACCAAAGATGACATTTTC 009 R3B I507V 5'-AmMC12 CACCAAAGACGATATTTTC 021 R4B F508C 5'-AmMC12 AACACCACAGATGATATTT 024 R5B 5T 5'-AmMC12 TGTGTGTTTTTAACAGGG 029 R6B 7T 5'-AmMC12 GTGTGTTTTTTTAACAGG 033 R7C 9T 5'-AmMC12 GTGTGTTTTTTTTTAACAG 037 a The position and sequence of the mutation or variation is indicated in bold type. b 5'-Amino modifier C12.
X
ABCC7 p.Ile506Val 16156102:104:453
status: NEW
Login to comment

106 Table 3 Reverse Complementary Oligonucleotide Targetsa Target Target sequence Modification Sequence 5' → 3' Standard mutation panel C1b I507 & F508 5'-Biotin AAAATATCATCTTTGGTGTT C2 ΔI507 5'-Biotin AAAGAAAATATCTTTGGTGT C3 ΔF508 5'-Biotin AGAAAATATCATTGGTGTTT C4 W1282 5'-Biotin GGCTTTCCTCCACTGTTGC C5 W1282X 5'-Biotin GGCTTTCCTTCACTGTTGC C6 1717-1G 5'-Biotin TGGAGATGTCCTATTACCAA C7 1717-1G→A 5'-Biotin TGGAGATGTCTTATTACCAA C8 G542 5'-Biotin CCACCTTCTCCAAGAACTAT C9 G542X 5'-Biotin CCACCTTCTCAAAGAACTAT C10 G551 & R553 5'-Biotin CTTGCTCGTTGACCTCCACT C11 G551D 5'-Biotin CTTGCTCGTTGATCTCCACT C12 R553X 5'-Biotin CTTGCTCATTGACCTCCACT C13 R560 5'-Biotin AGTTATTCACCTTGATAAAG C14 R560T 5'-Biotin AGTTATTCACGTTGCTAAAG C15 R117 5'-Biotin CGCGATAGAGCGTTCCTCCT C16 R117H 5'-Biotin CGCGATAGAGTGTTCCTCCT C17 I148 5'-Biotin CTGCATTCCAATGTGATGAA C18 I148T 5'-Biotin CTGCATTCCAGTGTGATGAA C19 621+1G 5'-Biotin GGAAGTATTACCTTCTTATA C20 621+1G→T 5'-Biotin GGAAGTATTAACTTCTTATA C21 N1303 5'-Biotin TTAGAAAAAACTTGGATCCC C22 N1303K 5'-Biotin TTAGAAAAAAGTTGGATCCC C23 1078T 5'-Biotin CTCAGGGTTCTTTGTGGTGT C24 1078delT 5'-Biotin TCTCAGGGTTCTTGTGGTGT C25 R334 5'-Biotin AATCATCCTCCGGAAAATAT C26 R334W 5'-Biotin AATCATCCTCTGGAAAATAT C27 R347 5'-Biotin ATTGTTCTGCGCATGGCGGT C28 R347P 5'-Biotin ATTGTTCTGCCCATGGCGGT C29 711+1G 5'-Biotin TAGGTACATACTTCATCAAA C30 711+1G→T 5'-Biotin TAGGTACATAATTCATCAAA C31 G85 5'-Biotin TAAAAAGATTCCATAGAACA C32 G85E 5'-Biotin TAAAAAGATTTCATAGAACA C33 3849+10kbC 5'-Biotin ATTAAAATGGCGAGTAAGAC C34 3849+10kbC→T 5'-Biotin ATTAAAATGGTGAGTAAGAC C35 A455 5'-Biotin CAGTTGTTGGCGGTTGCTGG C36 A455E 5'-Biotin CAGTTGTTGGAGGTTGCTGG C37 R1162 5'-Biotin ATCTGTGAGCCGAGTCTTTA C38 R1162X 5'-Biotin ATCTGTGAGCTGAGTCTTTA (Continued) Rapid CF Screening by xMAPTM 153 Table 3 (Continued) Target Target sequence Modification Sequence 5' → 3' C39 3659C 5'-Biotin GGTAAACCTACCAAGTCAAC C40 3659delC 5'-Biotin AGGTAAACCTACAAGTCAAC C41 2789+5G 5'-Biotin ACATGGAATACTCACTTTCC C42 2789+5G→A 5'-Biotin ACATGGAATATTCACTTTCC C43 2184A 5'-Biotin AAGATTGTTTTTTTGTTTCT C44 2184delA 5'-Biotin AAGATTGTTTTTTGTTTCTG C45 1898+1G 5'-Biotin AAAGAACATACCTTTCAAAT C46 1898+1G→A 5'-Biotin AAAGAACATATCTTTCAAAT C47 3120+1G 5'-Biotin TTTTTACATACCTGGATGAA C48 3120+1G→A 5'-Biotin TTTTTACATATCTGGATGAA Reflex panel CR2 I506V 5'-Biotin GAAAATGTCATCTTTGGTGT CR3 I507V 5'-Biotin GAAAATATCGTCTTTGGTGT CR4 F508C 5'-Biotin AAAATATCATCTGTGGTGTT CR5 5T 5'-Biotin TCCCTGTTAAAAACACACAC CR6 7T 5'-Biotin CCCTGTTAAAAAAACACACA CR7 9T 5'-Biotin CCTGTTAAAAAAAAACACAC a The position and sequence of the mutation or variation is indicated in bold type. b Target C1 (I507 & F508) is also used in the reflex panel.
X
ABCC7 p.Ile506Val 16156102:106:2360
status: NEW
Login to comment

114 Using a small target DNA (approx 100-300 bp) minimizes the potential for steric hindrance to affect the xMAPTM Table 4 PCR Amplification Primers Size CFTR target Mutation(s) Primer 5' Modification Sequence 5' → 3' (bp) Exon 10 ΔI507, ΔF508, BE10U 5'-Biotin TTCTGTTCTCAGTTTTCCTGG 107 I506V, I507V, E10D None TTGGCATGCTTTGATGACG F508C Exon 20 W1282X E20U None TTGAGACTACTGAACACTGAAGG 126 BE20D 5'-Biotin TTCTGGCTAAGTCCTTTTGC Intron 10 1717-1G→A E11U None TCAGATTGAGCATACTAAAAGTGAC 89 BE11D2 5'-Biotin GAACTATATTGTCTTTCTCTGCAAAC Exon 11 G542X, G551D, E11U2 None AAGTTTGCAGAGAAAGACAATATAG 135 R553X, R560T BE11D 5'-Biotin GAATGACATTTACAGCAAATGC Exon 4 R117H E4U None TTTGTAGGAAGTCACCAAAGC 145 BE4D2 5'-Biotin GAGCAGTGTCCTCACAATAAAGAG Exon 4/intron 4 I148T, E4U2 None CTTCTCTTTATTGTGAGGACACTGC 169 621+1G→T BE4D 5'-Biotin ATGACATTAAAACATGTACGATACAG Exon 21 N1303K BE21U 5'-Biotin TGCTATAGAAAGTATTTATTTTTTCTGG 106 E21D None AGCCTTACCTCATCTGCAAC Exon 7 1078delT, BE7U 5'-Biotin GAACAGAACTGAAACTGACTCG 199 R334W, R347P E7D3 None CAGGGAAATTGCCGAGTG Intron 5 711+1G→T I5U None CAACTTGTTAGTCTCCTTTCC 99 BI5D2 5'-Biotin AGTTGTATAATTTATAACAATAGTGC Exon 3 G85E E3U None CTGGCTTCAAAGAAAAATCC 117 BE3D2 5'-Biotin TGAATGTACAAATGAGATCCTTACC Chromosome 7 3849+10kbC→T BC7U 5'-Biotin GACTTGTCATCTTGATTTCTGG 148 C7D None TTTGGTGCTAGCTGTAATTGC Exon 9 A455E BE9U 5'-Biotin TCACTTCTTGGTACTCCTGTCC 105 E9D None CAAAAGAACTACCTTGCCTGC Exon 19-I R1162X BE19U 5'-Biotin ATTGTGAAATTGTCTGCCATTC 167 E19Da None CAATAATCATAACTTTCGAGAGTTG Exon 19-II 3659delC BE19U2 5'-Biotin TTTAAGTTCATTGACATGCCAAC 91 E19Da None CAATAATCATAACTTTCGAGAGTTG Intron 14B 2789+5G→A I14BU None GTGTCTTGTTCCATTCCAGG 147 BI14BD 5'-Biotin TGGATTACAATACATACAAACATAGTGG Exon 13 2184delA E13U None AGATGCTCCTGTCTCCTGG 126 BE13D 5'-Biotin TGCACAATGGAAAATTTTCGTATAG Intron 12 1898+1G→A I12U None TTAGACTCTCCTTTTGGATACC 110 BI12D 5'-Biotin GTCTTTCTTTTATTTTAGCATGAGC Intron 16 3120+1G→A I16U None ATGACCTTCTGCCTCTTACC 118 BI16D 5'-Biotin ATGAAAACAAAATCACATTTGC Intron 8 5T/7T/9T I8U None TAATGGATCATGGGCCATGTGC 212 BI8D 5'-Biotin ACTGAAGAAGAGGCTGTCATCACC CFTR, cystic fibrosis transmembrane conductance regulator gene.
X
ABCC7 p.Ile506Val 16156102:114:305
status: NEW
Login to comment

119 Coriell Cell Repositories, NA12960 ΔI507/R347P Patient sample G551D/R347P Coriell Cell Repositories, NA12785 621+1G→T/711+1G→T Coriell Cell Repositories, NA11280 621+1G→T/G85E Coriell Cell Repositories, NA11282 3849+10kbC→T/3849+10kbC→T Coriell Cell Repositories, NA11860 A455E/normal Patient sample 621+1G→T/A455E Coriell Cell Repositories, NA11290 R1162X/normal Coriell Cell Repositories, NA12585 ΔF508/3659delC Coriell Cell Repositories, NA11275 2789+5G→A/2789+5G→A Coriell Cell Repositories, NA11859 2184delA/normal Patient sample 1898+1G→A/normal Patient sample 621+1G→T/3120+1G→A Coriell Cell Repositories, NA07441 3120+1G→A/3120+1G→A Patient sample F508C/normal Coriell Cell Repositories, NA13033 I506V/normal Coriell Cell Repositories, NA13032 R347H/normal Patient sample ΔF508/3120G→A Patient sample S549N/normal Patient sample S549R/normal Patient sample CFTR, cystic fibrosis transmembrane conductance regulator gene.
X
ABCC7 p.Ile506Val 16156102:119:807
status: NEW
Login to comment

124 The M1 reaction was also used for detection of the I506V, I507V, and F508C polymorphisms in the reflex panel.
X
ABCC7 p.Ile506Val 16156102:124:51
status: NEW
Login to comment

259 Table7(continued) 167 Table 8 Allelic Ratio Data for the Reflex Panela Genotype I507 & F508 I506V I507Vb F508C Exon 10 variants ΔF508/ΔF508c - - - - ΔF508/Normal 0.93 0.03 0.02 0.02 Normal/Normal 0.94 0.03 0.01 0.01 ΔI507/Normal 0.97 0.04 -0.03 0.01 I506V/Normal 0.45 0.01 -0.01 0.54 F508C/Normal 0.40 0.58 0.00 0.01 Intron 8 variants Genotype 5T 7T 9T 7T/7T -0.06 1.06 0.01 7T/7T -0.01 1.00 0.01 7T/7T -0.01 1.01 0.00 9T/9T 0.05 0.05 0.90 9T/9T 0.07 0.05 0.87 7T/9T 0.04 0.45 0.51 7T/9T 0.03 0.40 0.56 5T/7T 0.42 0.60 -0.01 5T/7T 0.45 0.59 -0.04 5T/9T 0.36 0.00 0.64 a Positive alleles are indicated in bold type. b Samples positive for the I507V allele were not available.
X
ABCC7 p.Ile506Val 16156102:259:95
status: NEW
X
ABCC7 p.Ile506Val 16156102:259:277
status: NEW
Login to comment

PMID: 15507674 [PubMed] Hadd AG et al: "Microsphere bead arrays and sequence validation of 5/7/9T genotypes for multiplex screening of cystic fibrosis polymorphisms."
No. Sentence Comment
197 Intron 8 Genotype by Coriell Number, Characterized CF Mutation and Allele Fraction for 5/7/9T Intron 8 genotype Coriell sample Characterized mutation Allele fraction by probe 5T 7T 9T 7T/7T NA09947 Normal 0.04 0.93 0.03 NA11277 ⌬I507/normal 0.06 0.90 0.04 NA11761 G551D/R553X 0.06 0.92 0.02 NA11859 2789ϩ5GϾA/2789ϩ5GϾA 0.02 0.96 0.02 NA11860 3849ϩ10kbCϾT/3849ϩ10kbCϾT 0.03 0.94 0.03 NA12444 1717-1GϾT/normal 0.06 0.87 0.07 NA12585 R1162X/normal 0.07 0.86 0.08 NA12785 R347P/G551D 0.04 0.92 0.05 NA12960 R334W/normal 0.06 0.92 0.02 NA12961 V520F/normal 0.06 0.89 0.05 NA13033 F508C/normal 0.03 0.93 0.04 9T/9T NA01531 ⌬F508/⌬F508 0.14 0.04 0.82 NA11281 621ϩ1GϾT/⌬F508 0.14 0.04 0.82 NA11283 A455E/⌬F508 0.13 0.05 0.82 NA11290 A455E/621ϩ1GϾT 0.12 0.01 0.87 NA11496 G542X/G542X 0.14 0.05 0.81 5T/7T NA11723 W1282X/normal 0.53 0.44 0.03 NA13032 I506V/normal 0.58 0.39 0.03 5T/9T NA11279 129GϾC/⌬F508 0.51 0.00 0.49 NA13591 R117H/⌬F508 0.52 0.00 0.48 7T/9T NA07441 3120ϩ1GϾA/621ϩ1GϾA 0.08 0.41 0.51 NA07552 R553X/⌬F508 0.09 0.36 0.55 NA07830 556dA/⌬F508 0.11 0.37 0.52 NA11275 3659dC/⌬F508 0.10 0.37 0.53 NA11278 Q493X/⌬F508 0.09 0.38 0.53 NA11280 711ϩ1GϾT/621ϩ1GϾA 0.09 0.37 0.54 NA11282 G85E/621ϩ1GϾA 0.07 0.39 0.53 NA11284 R560T/⌬F508 0.08 0.39 0.52 NA11472 N1303K/G1349D 0.08 0.39 0.54 Figure 3.
X
ABCC7 p.Ile506Val 15507674:197:954
status: NEW
Login to comment

PMID: 9511935 [PubMed] Bianchet MA et al: "Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR)."
No. Sentence Comment
33 Importantly, missense mutations such as F508C, I506V and I507V are benign and do not cause the disease [Kobayashi et al. (1990)].
X
ABCC7 p.Ile506Val 9511935:33:47
status: NEW
Login to comment

PMID: 7684943 [PubMed] Costes B et al: "Psoralen-modified oligonucleotide primers improve detection of mutations by denaturing gradient gel electrophoresis and provide an alternative to GC-clamping."
No. Sentence Comment
32 Analysis of the exon 10 nucleotide substitution 1648 A-G(I506V).
X
ABCC7 p.Ile506Val 7684943:32:57
status: NEW
Login to comment

33 Lane 1: an I506V heterozygous sample amplified with regular primers; Lane 2: a normal control; Lane 3: the I506V sample amplified with ChemiClamped primers and run without prior UV irradiation; Lanes 4 and 5:1506V sample and a normal control, respectively, amplified with ChemiClamped primers and run after 15 min of UV irradiation.
X
ABCC7 p.Ile506Val 7684943:33:11
status: NEW
X
ABCC7 p.Ile506Val 7684943:33:107
status: NEW
Login to comment

44 Two nucleotide substitutions lying in a single melting domain within CFTR exon 10 (1648 A-G named I506V) or exon 4 (482 G-A or R117H) were analysed with or without the chemical clamp at one end of the gene fragment.
X
ABCC7 p.Ile506Val 7684943:44:98
status: NEW
Login to comment

55 DGGE analysis of the I506V polymorphism in exoo 10 of the CFTR gene, using ChemiClamped (left) and GC-clamped (right) primers.
X
ABCC7 p.Ile506Val 7684943:55:21
status: NEW
Login to comment

65 the DGGE pattern of ChemiClamped exon 10 fragments from an I506V heterozygote, shows that homoduplexes and heteroduplexes can be distinguished unambiguously.
X
ABCC7 p.Ile506Val 7684943:65:59
status: NEW
Login to comment

PMID: 2210768 [PubMed] Vidaud M et al: "Three point mutations in the CFTR gene in French cystic fibrosis patients: identification by denaturing gradient gel electrophoresis."
No. Sentence Comment
44 One is probably a polymorphism, since the A-to-G substitution at position 1648 (exon 10), which replaces an isoleucine by a valine (I506V), was found in one instance on a normal chromosome.
X
ABCC7 p.Ile506Val 2210768:44:132
status: NEW
Login to comment

PMID: 22043142 [PubMed] Lilley M et al: "Newborn screening for cystic fibrosis in Alberta: Two years of experience."
No. Sentence Comment
47 If indicated, testing includes reflex analysis for the following variants: 5/7/9T exon 9 splice acceptor tracts, F508C, I507V and I506V.
X
ABCC7 p.Ile506Val 22043142:47:130
status: NEW
Login to comment

PMID: 24586523 [PubMed] Zietkiewicz E et al: "CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients."
No. Sentence Comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L).
X
ABCC7 p.Ile506Val 24586523:71:5336
status: NEW
Login to comment

PMID: 24631642 [PubMed] Fanen P et al: "Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies."
No. Sentence Comment
70 Group A Group B Group C Group D Classic-CF CF-causing mutations Non-classic CF CFTR-related disorder associated mutations No clinical consequence Unknown clinical relevance All mutations in Table 2 and 711 + 3A > G*, R117H-T5*, D1152H*, L206W*, TG13-T5* TG13-T5a , R117H-T5a , D1152Ha , L206Wa , L997F, M952I, D565Ga , TG11-T5b , R117H-T7b , D443Y-G576A-R668C, R74W-D1270N, R75Qb TG11-T5b , R117H-T7b , R75Qb , 875 + 40A/G, M470V, T854T, P1290P, I807M, I521F, R74W, F508C, I506V, I148T All mutations (mostly missense) not yet analyzed or undergoing functional analysis a Mutations that may belong either to Group A or to Group B. b Mutations that may belong either to Group B or to Group C.
X
ABCC7 p.Ile506Val 24631642:70:473
status: NEW
Login to comment