ABCMdb

ABCC7 p.Leu206Trp

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications

PMID: 10229049 [PubMed] Lecoq I et al: "Blood immunoreactive trypsinogen concentrations are genetically determined in healthy and cystic fibrosis newborns."

No. Sentence Comment

61 Twins or unrelated patients with identical genotype had very similar neonatal IRT concentrations: DF508/I148T (twins), 1040 and 1055 mg LÀ1 ; N1303K/G149R (twins), 1600 and 1725 mg LÀ1 ; DF508/E585X, 900 and 945 mg LÀ1 ; DF508/ G542X, 1535 and 1660 mg LÀ1 ; DF508/L206W, 980, 1090 and 1100 mg LÀ1 . Login to comment
72 In this study, CF newborns with one mutation in an exon encoding for either NBD1 or NBD2 (DF508, G542X, G551D, E585X, N1303K, etc.) and the other affecting one of the MSD (R117H, 574delA, I148T, G149R, L206W, etc.) had significantly lower IRT concentrations than CF neonates with both mutations located in NBD. Login to comment

PMID: 10376575 [PubMed] Mak V et al: "Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia."

No. Sentence Comment

45 (%) Men With 2 Mutations ⌬F508/IVS8-5T 7 (11) ⌬F508/IVS8-5T 1 (10) ⌬F508/IVS8-5T 1 (1.8) ⌬F508/R117H 6 (9) W1282X/IVS8-5T 1 (1.8) ⌬F508/L206W 1 (1.6) G544S/IVS8-5T 1 (1.8) ⌬F508/M952T 1 (1.6) V754M/-741T→G 1 (1.8) ⌬F508/P67L 1 (1.6) R75Q/R258G 1 (1.8) ⌬F508/S549R 1 (1.6) R334W/R334W 1 (1.6) R117H/R117H 1 (1.6) R117H/IVS8-5T 1 (1.6) R347P/IVS8-5T 1 (1.6) N1303K/IVS8-5T 1 (1.6) 1677delTA/IVS8-5T 1 (1.6) R117L/IVS8-5T 1 (1.6) D979A/IVS8-5T 1 (1.6) IVS8-5T/IVS8-5T 1 (1.6) Men With 1 Mutation IVS8-5T/N 10 (16) ⌬F508/N 1 (10) IVS8-5T/N 9 (16) ⌬F508/N 1 (2) ⌬F508/N 6 (9) IVS8-5T/N 1 (10) ⌬F508/N 1 (1.8) G542X/N 1 (2) W1282X/N 2 (3) R75Q/N 1 (1.8) IVS8-5T/N 5 (10) L206W/N 1 (1.6) W1282X/N 1 (1.8) 4016insT/N 1 (1.6) R117H/N 1 (1.8) 2423delG/N 1 (1.8) Men With No Mutations 18 (28) 7 (70) 37 (66) 42 (86) *N indicates that no CFTR mutations or variants were detected. Login to comment
50 Of the 8 additional CFTR gene sequence alterations detected using extensive CFTR exon screening, 5 have been described rarely in the CF population (L206W [identified in 2 subjects], P67L, 1677delTA, R117L, and 4016insT).60 One mutation, D979A, was previously identified in a Vietnamese CBAVD patient.60 Interestingly, our CBAVD subject with D979A (also a carrier of IVS8-5T) was of Vietnamese descent as well. Login to comment
58 (%) 31 Mutation panel† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1 (1) R117H 9 (7) W1282X 2 (1.8) G542X 1 (1) W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) Extensive screen† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1Mutations included in R117H 9 (7) W1282X 2 (1.8) G542X 131 mutation panel W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) L206W 2 (1.6)‡ R75Q 2 (1.8)‡Mutations not included in P67L 1 (0.8)‡ G544S 1 (0.9)‡31 mutation panel 1677delTA 1 (0.8)‡ 2423delG 1 (0.9)‡ R117L 1 (0.8)‡ V754M 1 (0.9)‡ 4016insT 1 (0.8)‡ -741T→G 1 (0.9)‡ D979A 1 (0.8)§ R258G 1 (0.9)§ M952T 1 (0.8)¶ IVS8-5T 25 (20)# 2 (10) 12 (11) 5 (5) Detectable mutations 72 (56)# 4 (20) 24 (21)# 7 (7) Detectable mutations missed by 31 mutation panel 33 (46) 2 (50) 19 (79) Detectable non-IVS8-5T mutations missed by 31 mutation panel 8 (17) 0 (0) 7 (58) *Percentages indicate allele frequency. Login to comment
85 These mild CFTR gene mutations are associated with pancreatic sufficiency and tend to be class 4 through 5 mutations: R117H, R334W, R347P, L206W,andP67L.Thethirdgroupcon- sists of mutations identified exclusively in some men with obstructive azoospermia; however, because these sequencealterationsareextremelyrare, it is only speculated that they contribute to this phenotype.7,10,12 These CFTR genesequencechangesincludeD979A, R258G, and M952T. Login to comment

PMID: 10794365 [PubMed] Bernardino AL et al: "Molecular analysis in Brazilian cystic fibrosis patients reveals five novel mutations."

No. Sentence Comment

6 Another fifteen mutations (previously reported) were detected: G542X, R1162X, N1303K, R334W, W1282X, G58E, L206W, R553X, 6211 1GRT, V232D, 1717-1GRA, 2347 delG, R851L, 27891 5GRA, and W1089X. Login to comment
51 The next most common mutations were: G542X (8.8%), R1162X (2.5%), N1303K (2.5%), R334W (2.5%), W1282X (1.3%), G58E (1.3%), L206W (0.6%), and R553X (0.6%). Login to comment
81 In this study, 16 mutations were identified: D F508, G542X, R1162X, N1303K, R334W, W1282X, G58E, L206W, R553X, 6211 1GRT, V232D, 1717-1GRA, 2347 delG, R851L, 27891 5GRA, and W1089X. Login to comment
84 GEN OTYPES, FREQUENCIES, AN D PRESENCE OF PI FRO M 160 CF PATIE NTS (320 CF CHROM OSOM ES) Number and frequency (%) Genotype Number Frequency (%) of patients with PI D F508/D F508 47 29.40 47 (100%) D F508/G542X 13 8.10 13 (100%) D F508/R1162X 6 3.80 6 (100%) D F508/R334W 5 3.10 3 (60%) D F508/N1303K 3 1.90 3 (100%) D F508/W1282X 2 1.20 2 (100%) D F508/G58E 2 1.20 1 (50%) D F508/L206W 1 0.62 0 D F508/R553X 1 0.62 1 (100%) D F508/R851L 1 0.62 0 D F508/2789 1 5g ® A 1 0.62 0 D F508/3617delGA 1 0.62 1 (100%) D F508/3171delC 1 0.62 1 (100%) D F508/2686insT 1 0.62 1 (100%) D F508/Y275X 1 0.62 1 (100%) D F508/U 22 13.80 14 (64%) G542X/G542X 3 1.90 3 (100%) G542X/N1303K 3 1.90 2 (67%) G542X/R1162X 1 0.62 1 (100%) G542X/U 5 3.10 4 (80%) N1303K/R1162X 1 0.62 1 (100%) N1303K/G58E 1 0.62 0 2347delG/2347delG 1 0.62 1 (100%) R334W/V232D 1 0.62 0 R334W/W1089X 1 0.62 1 (100%) R334W/U 1 0.62 1 (100%) W1282X/U 1 0.62 1 (100%) G58E/U 1 0.62 1 (100%) R553X/U 1 0.62 1 (100%) L206W/U 1 0.62 0 621 1 1G ® T/U 1 0.62 1 (100%) 1717-1G ® A/U 1 0.62 Not known V201M/U 1 0.62 0 U/U 27 16.90 12 (44%) Total 160 100 - U, Unknown CF mutation. Login to comment

PMID: 10875853 [PubMed] Casals T et al: "Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens."

No. Sentence Comment

57 In contrast, mutations L206W and R117H, Molecular analysis of the CFTR gene was performed in all 134 each causing a mild CF phenotype (Dean et al., 1990; patients. Login to comment
62 Recently, direct analysis of 31 CFTR mutations (PCR/OLA Cystic Fibrosis Assay; Perkin Elmer, Foster City) was 6(5T), ∆F508, G542X, L206W and R117H are the most performed in 30 of these infertile men. Login to comment
71 Six polymorphisms: 125G/C, 1525-61A/G, L206W 9 (6) 0 9 (5) 1898ϩ152T/A, 1716G/A, G576A and 875ϩ40A/G presented R117H 8 (5) 0 8 (5) frequencies of between 2.5% and 4.0%. Login to comment
95 CFTR genotypes in 24 patients with congenital unilateral absenceTable III. CFTR genotypes in 110 patients with congenital bilateral absence of the vas deferens of the vas deferens Mutations IVS8-6(T) n (%)Mutations IVS8-6(T) n (%) Two CFTR mutations 62 (56) Two CFTR mutations 5 (21) ∆F508/- 5T/9T 2 (8)∆F508/- 5T/9T 17 (15) G542X/- 5T/9T 6 (5) G542X/- 5T/9T 1 3732delA/- 5T/7T 1∆F508/L206W 9T/9T 6 (5) ∆F508/D1270NϩR74W 7T/9T 3 (3) L383S/- 5T/7T 1 One CFTR mutation 4 (17)∆F508/R117H 7T/7T 1 ∆F508/P1021S 7T/9T 1 ∆F508/-a 7T/9T 1 3732delA/-a 7T/7T 1∆F508/M952T 7T/9T 1 ∆F508/D110Y 7T/9T 1 Q890R/- 7T/7T 1 -/-a 5T/7T 1∆F508/S50P 5T/9T 1 ∆F508/2751ϩ3A→G 5T/9T 1 Negative CFTR mutations 15 (62) -/- 7T/7T 10 (42)G542X/R117H 7T/9T 1 G542X/2789ϩ5G→A 7T/9T 1 -/- 7T/9T 3 (12) -/- 9T/9T 2 (8)R117H/2789ϩ5G→A 7T/7T 1 R117H/712-1G→T 7T/9T 1 R117H/∆I507 7T/7T 1 aThree carrier patients with renal agenesis. Login to comment
96 L206W/- 5T/9T 1 L206W/3121-1G→A 7T/9T 1 L206W/1949del84 7T/9T 1 transrectal ultrasonography was significantly smaller in∆E115/S50P 7T/7T 1 2869insG/R1070W 7T/7T 1 CBAVD than in CUAVD (F ϭ 8.1, P ϭ 0.005). Login to comment
201 Desgeorges, M., Dodier, M., Piot, M. et al. (1995) Four adult patients with the missense mutation L206W and a mild cystic fibrosis phenotype. Login to comment

PMID: 10922396 [PubMed] Teder M et al: "Distribution of CFTR gene mutations in cystic fibrosis patients from Estonia."

No. Sentence Comment

7 First, several known mutations were tested directly by the heteroduplex analysis (HA; F508, 394delTT, polyT variants in IVS8), restriction digestion (RD; G551D, R553X, 1811+1.6kbA→G, L206W, 3849+10kbC→T), and amplification refractory mutation system (ARMS, kits from Cellmark Diagnostics, UK; G542X, 621+1G→T, N1303K). Login to comment

PMID: 11345141 [PubMed] Modolell I et al: "Gastrointestinal, liver, and pancreatic involvement in adult patients with cystic fibrosis."

No. Sentence Comment

46 Mutations L206W and 2789+5G>A were identified in five patients each. Login to comment
50 In the remaining 14 patients, ⌬F508 was carried with G542X, R1162X, N1303K, L206W, 1717-1G>A, 711+1G>T, or an unidentified mutation. Login to comment
54 ⌬F508 was present in only 21 of the 50 patients and was in heterozygosis in all cases, carried together with L206W, 2789+5G>A, 3272-26A>G, R117H, 5T, R334W, or an unidentified mutation. Login to comment
56 5T, G542X, R334W, N1303K, L206W, 3659-C, and G85E were identified in the remaining nine patients. Login to comment
64 Other genotypes present in our series ⌬F508/711+1G>T 2A 5T/5T 1B ⌬F508/5T 2B ⌬1507/- 1A ⌬F508/R117H 2B R1162X/1898+1G>A 1A ⌬F508/R1162X 1A 2183A/- 1A ⌬F508/N1303K 1A 1609-CA/1811+1.6kbA>G 1A ⌬F508/3272-26A>G 1B 1609-CA/R347P 1A ⌬F508/D836Y 1B Q890X/- 1A ⌬F508/1717-1G>A 1A R334W/- 1B G542X/W1282X 1A N1303K/2789+5G>A 1B G542X/2789+5G>A 1B 3659-C/- 1B G542X/P205S 1B G85E/- 1B G542X/D1270N 1B Negative 1A, 20B L206W/- 1B Unknown 2A creatic insufficiency was highly prevalent, affecting 33 patients (84.6%). Login to comment
137 Interestingly, of the eight group B pancreatic-insufficient patients, four were carriers of ⌬F508, in three cases with known mutations: 2789+5G>A and L206W; another patient was 5T homozygote. Login to comment

PMID: 11466205 [PubMed] Larriba S et al: "Adenosine triphosphate-binding cassette superfamily transporter gene expression in severe male infertility."

No. Sentence Comment

87 Phenotypical and genotypical description of CAVD and non-CAVD infertile patients.a No. patient Phenotype FSH (U/L) Non-CFTR infertility-associated factors Testicular biopsy CFTR mutation M470V polymorphism CAVD infertility 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CUAVD CUAVD CUAVD CUAVD 3.1 7.3 3.1 2.4 1.9 3.5 5.7 4.3 3.6 ND 2.2 4.8 11.3 2.1 ND 7.6 5.3 6.5 3.9 21.4 None None None None None None None None None None None None None None None None None None None Yes 1 Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes V232D/V232D F508del/R117H F508del/R117H G542X/2789ϩ5GϾA F508del/D1270N ϩ R74W F508del/D1270N ϩ R74W S945L/R258G F508del/5T F508del/5T L206W/5T R117H/N F508del/N Y1014C/N 5T/N N/N N/N Y1092X/R258G 621ϩ1GϾT/5T Q890R/N N/N M/M M/M M/M M/M M/V M/V M/V M/M M/V M/V M/V M/V M/V M/V M/M V/V V/V M/V V/V M/M Non-CAVD infertility 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SA) TF (SA) TF (SSO) OA OA OA OA OA OA OA OA 42.0 15.9 34.8 8.9 26.3 6.4 7.8 15.6 8.7 3.2 3.9 12.6 4.7 1.3 5.6 3.9 6.1 9.3 8.8 19.3 9.6 ND 3.3 5.9 6.6 3.6 1.9 4.2 2.0 4.4 None None None None None None None None None None None None None None None None Yes 2 Yes 2 Yes 2, 3 Yes 4 Yes 5 Yes 6 None None None None None Yes 1 Yes 7 Yes 8 Yes Yes Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes No No No No No No Yes Yes Yes Yes Yes Yes Yes No Yes Yes Yes F508del/N R334W/N N/N N/N N/N N/N N/N N/N N/N R75Q/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N 5T/5T N/N N/N N/N N/N N/N N/N N/N M/M V/V M/V M/V M/V M/V V/V V/V V/V V/V M/V M/V M/V ND V/V M/M M/V M/M M/V M/M M/V V/V M/V M/V M/V V/V V/V M/V M/V V/V a CFTR mutations and M470V allele are also described for each patient. Login to comment
94 CFTR Analysis We have identified 14 different CFTR mutations (R117H, L206W, V232D, R258G, F508del, G542X, 621ϩ1GϾT, Q890R, S945L, Y1014C, Y1092X, D1270N, 2789ϩ5GϾA, IVS8-6[5T]) in 17 of 20 patients of the CAVD group, giving a CFTR mutation frequency of 85%. Login to comment

PMID: 11701644 [PubMed] Scriver CR et al: "Human genetics: lessons from Quebec populations."

No. Sentence Comment

236 The L206W allele (with a mild phenotypic effect) reflects a particular French Canadian heritage (142), whereas W1282X and G542X are prominent in Ashkenazi Jews (2, 145), which reflects corresponding twentieth century immigrations into Quebec. Login to comment
905 L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis. Login to comment

PMID: 11781704 [PubMed] Larriba S et al: "ATB(0)/SLC1A5 gene. Fine localisation and exclusion of association with the intestinal phenotype of cystic fibrosis."

No. Sentence Comment

151 Statistical analysis showed that the higher incidence for P17A and the lower incidence for V512L observed in the general population Table 3 CFTR mutations of the CF patients under study with and without meconium ileus (MI) CF-non MI CF-MI CFTR mutations n CFTR mutations n F508del/R117H 2 F508del/F508del 7 F508del/R334W 3 F508del/L365P 1 F508del/R347P 1 F508del/G542X 1 F508del/621+1G4Ta 1 F508del/621+IG4Ta 1 F508del/M1101K 1 F508del/R1066C 1 F508del/1609delCAa 1 F508del/W1089X 1 F508del/2789+5G4Aa 3 F508del/R1162X 1 F508del/3849+10kbC4T 1 F508del/1609delCAa 1 G542X/G85E 1 F508del/Q1281X 1 G542X/V232D 1 F508del/1811+1.6kbA4G 1 G542X/1811+1.6kb A4Ga 1 F508del/2789+5G4Aa 1 G542X/2789+5G4A 1 F508del/2869insG 1 Q890X/L206W 1 F508del/unknown 1 1811+1.6kbA4G/P205S 1 I507del/I507del 1 R1162X/3272-26A4G 1 G542X/1078delT 1 N1303K/R347H 1 G542X/1811+1.6kbA4Ga 1 N1303K/A1006E+5T 1 S549R/CFTR50kbdel 1 2789+5G4A/405+1G4A 1 R1066C/R1066C 1 W1282X/712-1G4T 1 a CF patient with a sibling presenting identical CFTR genotype and discordance of intestinal phenotype. Login to comment

PMID: 12001283 [PubMed] Schaedel C et al: "Predictors of deterioration of lung function in cystic fibrosis."

No. Sentence Comment

121 TABLE 3CFTR Mutations Associated With Pancreatic Sufficiency in Swedish CF Population Y109C S549I/S549I Y109N S945L R117C N1088D À R75Q R117H G1244E L206W 711 þ 3A !G T338I 1249 À 5A !G A455E 2789 þ 5G ! Login to comment

PMID: 12007216 [PubMed] Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."

No. Sentence Comment

109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment

PMID: 12151438 [PubMed] Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."

No. Sentence Comment

20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
76 After the 5T allele, the relative frequent mutations with two to four alleles were: R117H (four alleles), W1282X (four alleles), G551D (three alleles), L206W (three alleles) and D1270 (two alleles). Login to comment
86 CFTR mutations in 92 men with congenital bilateral absence of vas deferens Mutations CFTR mutation panels CF25 CF25 ϩ 5T ACMG25 ACMG25 ϩ 5T CF100 Mutations detected in ∆F508 39 39 39 39 39 CF25 mutation panel R117H 4 4 4 4 4 W1282X 4 4 4 4 4 G551D 3 3 3 3 3 G542X 1 1 1 1 1 N1303K 1 1 1 1 1 IVS8-polyT IVS8-5T 33 33 33 Additional mutations L206W 3 detected not in CF25 D1270N 2 mutation panel 1154InsTC 1 3272-26A→G 1 A455E 1 1 1 R334W 1 1 1 Q890X 1 Total 14 52 85 54 87 95 respectively, in the total number of patients with at least one mutation. Login to comment
91 CFTR genotypes in 92 men with congenital bilateral absence of vas deferens Genotypesa CFTR mutation panelsb CF25 CF25 ϩ 5T ACMG25 ACMG25 ϩ 5T CF100 Two mutations ∆F508/5T 16 16 16 W1282X/5T 4 4 4 ∆F508/R117Hc 3 3 3 3 3 G542X/5T 1 1 1 G551D/5T 1 1 1 ∆F508/L206W 2 ∆F508/A455E 1 1 1 ∆F508/3272-26A→G 1 Q890X/5T 1 L206W/5T 1 D1270N/D1270N 1 5T/5T 1 1 1 Sub-total 3 26 4 27 33 One mutation ∆F508/ϩ 36 20 35 19 16 5T/ϩ 9 9 7 G551D/ϩ 3 2 3 2 2 G542X/ϩ 1 1 R117H/ϩ 1 1 1 1 1 N1303K/ϩ 1 1 1 1 1 W1282X/ϩ 4 4 R334W/ϩ 1 1 1 1154InsTC/ϩ 1 Sub-total 46 33 46 33 29 Total (%) 49 (53.3) 59 (64.1) 50 (54.3) 60 (65.2) 62 (67.4) No mutation (%) 43 (46.7) 33 (35.9) 42 (45.7) 32 (34.8) 30 (32.6) aMutations L206W, 3272-26A→G, Q890X, D1270N, 1154InsTC and 5T are not in either CF25 and ACMG25 panels, while A455E and R334W are not in CF25, but are part of ACMG25 panel. Login to comment
127 L206W is another mild mutation reported with relatively high frequency in both CF and CBAVD patients (Chillon et al., 1995; Mak et al., 1999; Claustres et al., 2000) and which we noted in three compound heterozygotes, two with ∆F508 and one with 5T. Login to comment
128 It appears that L206W is associated in cis with the 9T allele since both ∆F508/L206W patients have a homozygous 9T background, while 5T/L206W exists in a 5T/9T background. Login to comment

PMID: 12167682 [PubMed] Groman JD et al: "Variant cystic fibrosis phenotypes in the absence of CFTR mutations."

No. Sentence Comment

71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

PMID: 12955726 [PubMed] Feldmann D et al: "CFTR genotypes in patients with normal or borderline sweat chloride levels."

No. Sentence Comment

8 R117H, D1152H, L206W, 3272-26A>G, S1235R, G149R, R1070W, S945L, and the poly-T tract variation commonly called IVS8-5T were also observed. Login to comment
18 Other mutations that might be associated with intermediate (40-60 mmol/L) or normal sweat chloride values have been reported: R117H [Kerem et al., 1997; Massie et al., 2000], G551S [Strong et al., 1991], A455E [Gan et al., 1995], L206W [Desgeoges et al., 1995], D1152H [Feldmann et al., 1995; Lebecque et al., 2001]. Login to comment
44 Table 1 : Genotypes and Phenotypes of Patients with Normal or BordIerline Sweat Tests Patient Age at diagnosis (years) CFTR GENOTYPE* Allele 1 Allele 2 SWEAT CL- MEAN (MMOL/L) PHENOTYPE 1 0.2 F508del G149R 38 P+PI, neonatal hypertrypsinemia, 2 0.3 G551D R117H-7T 31 neonatal hypertrypsinemia 3 0.4 F508del R1070W 30.5 neonatal hypertrypsinemia 4 0.4 F508del R117H-7T 52 P 5 0.6 F508del 3849+10kbC>T 48 P 6 0.11 F508del S945L 58 P+PI 7 1 F508del 5T 40 P+CBAVD 8 2 F508del L206W 53 P 9 2 W1282X 5T 42.5 P 10 5 F508del 3849+10kbC>T 55.5 P 11 5 F508del L206W 55 P 12 5 G91R 5T 47.5 P 13 6 G551D S1235R+5T 49.5 P, neonatal hypertrypsinemia 14 7 F508del 3849+10kb 50 P, nasal popyposis 15 13 F508del R117H-7T 58 P, nasal polyposis 16 18 F508del 5T 60.5 P 17 20 G542X 3849+10kbC>T 52 P+PI 18 21 I507del 3849+10kbC>T 54 P, bronchiectasis 19 30 R347P 3849+10kbC>T 43 P, Pseudomonas colonisation 20 30 I507del L206W 57.5 CBAVD, chronic cough 21 31 F508del R117H-7T 60 CBAVD 22 32 G542X 3849+10kbC>T 30 P, Pseudomonas colonisation 23 34 F508del 3272-26A>G 64 P, CBAVD 24 37 R1070Q D1152H 56 CBAVD, bronchectasis 25 46 F508del D1152H 43 P 26 55 F508del D1152H 48 P, Pseudomonas colonisation 27 56 I507del S1235R 53 P 28 >18 F508del D1152H 60 P+PI 29 >20 F508del 3849+10kbC>T 18 P, bronchiectasis 30 >20 F508del 3272-26A>G 61 P *All mutations are named in accordance with the numbering used in the CFTR Mutation Database: http://www.genet.sickkids.on.ca/cftr/. Login to comment
52 Other common mutations observed in our study such as 3849+10kbC>T, R117H, D1152H, L206W were found at a low prevalence in typical CF patients (0.4 % to 0.2 %). Login to comment
82 Other common mutations observed in our study were R117H, IVS8(5T), D1152H, and L206W. Login to comment
99 Previous reports on L206W suggested that this mutation caused CBAVD or mild pulmonary disease [Rozen, 1995; Desgeorges, 1995]. Login to comment
100 In our study, L206W with F508del in trans was observed in a patient with CBAVD, but also in one patient with pancreatic insufficiency. Login to comment

PMID: 14526128 [PubMed] Bernardino AL et al: "CFTR, PRSS1 and SPINK1 mutations in the development of pancreatitis in Brazilian patients."

No. Sentence Comment

68 A total of 13 changes were found: 7 in the CFTR gene (∆F508/R851L, ∆F508/R170C, ∆F508/L206W, 2 N/∆F508, N/P205S, N/R31C and N/V920M), 2 in the PRSS1 gene (E79K and N246N) and 4 in the SPINK1 gene (-253T>C, -164G>C, -7T>G, c75C>T) (Table 1). Login to comment
69 The CFTR Gene Molecular analysis showed that 8 patients (9.8%) had mutations in the CFTR gene: 3 were compound heterozygotes (∆F508/R851L, ∆F508/R170C and ∆F508/L206W) and 5 had mutations on just one allele (2 N/∆F508, N/P205S, N/R31C and N/V920M). Login to comment
70 Among the 16 patients with idiopathic chronic pancreatitis, 5 (31.3%) had mutations in the CFTR gene (∆F508/R851L, ∆F508/L206W, N/∆F508, N/P205S and N/V920M). Login to comment
71 Two of these patients (∆F508/L206W and N/P205S), were found to have congenital absence of the vas deferens in addition to chronic pancreatitis. Login to comment
78 Gene Localization Mutation Polymorphism Frequency in patients' chromosomes Frequency in controls' chromosomes P value Exon 2 R31C 1/164 (0.6%) - - Exon 5 R170C 1/164 (0.6%) - - P205S 1/164 (0.6%) - -Exon 6 L206W 1/164 (0.6%) - - Exon 10 ∆F508 5/164 (3.0%) - - Exon 14a R851L 1/164 (0.6%) - - CFTR Exon 15 V920M 1/164 (0.6%) - - Exon 3 E79K 1/164 (0.6%) 1/300 (0.3%) 1.000a PRSS1 Exon 5 N246N 47/164 (28.7%) 85/300 (28.3%) 1.000b -253T>C 20/164 (12.2%) 20/400 (5.0%) 0.004b Promoter -164G>C 4/164 (2.4%) 13/400 (3.3%) 0.788a Exon 1 -7T>G 5/164 (3.0%) 8/300 (2.7%) 0.777a SPINK1 Exon 2 c75C>T 1/164 (0.6%) 3/300 (1.0%) 1.000a a Fisher's exact test b Yates' corrected chi-squared test alcohol-related chronic pancreatitis, but with no family history. Login to comment
94 Molecular analysis showed that 9.8% of the total group of patients had mutations in the CFTR gene: 3 were compound heterozygotes (∆F508/R851L, ∆F508/R170C and ∆F508/L206W) and 5 had mutations on just one allele (2 N/∆F508, N/P205S, N/R31C and N/V920M). Login to comment
96 Among the 16 patients with idiopathic chronic pancreatitis, 5 had mutations in the CFTR gene (∆F508/R851L, ∆F508/L206W, N/∆F508, N/P205S and N/V920M). Login to comment
97 Two of these patients (∆F508/L206W and N/P205S), were found to have congenital absence of the vas deferens, a condition associated with cystic fibrosis mutations in addition to chronic pancreatitis. Login to comment

PMID: 15173476 [PubMed] Comeau AM et al: "Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections."

No. Sentence Comment

150 112 CF-Affected MA Infants Who Were Screened: Details of CF Newborn Screening Results and Diagnostic Follow-up Sweat Test Result (mEq Cl-/L) CF-Screen Positive CF-Screen Negative Total 2 Mutations 1 Mutation 0 Mutations Positive (Ն60) 62 19 3 2 86 Borderline (Ն30 and Ͻ60) Within expectations for specific CF genotype* 5 3 8¶ Monozygotic twin sweat test positive† 1 1 Negative (Ͻ30) Within expectations for specific CF genotype‡ 4 1 5 Incomplete (not done or QNS) 2 CFTR mutations identified and clinical symptoms§ 6 1 7 2 CFTR mutations identified without clinical symptoms࿣ 5 5 Total 82 25 3 2 112 * ⌬F508/R117H;7T (3), ⌬F508/3849 ϩ 10kb (2), ⌬F508/L206W (1), G551D/R117C (1), and G85E/R117C (1). Login to comment
159 Genotypes and Frequencies Observed in 112 CF-Affected Infants First Mutation Second Mutation N ⌬F508 ⌬F508 55 ⌬F508 R117H 7* ⌬F508 G551D 4 ⌬F508 N1303K 3 ⌬F508 W1282X 3 ⌬F508 G542X 2 ⌬F508 1898 ϩ 1 G Ͼ A 2 G85E R117C 2 ⌬F508 1717-GϾA 1 ⌬F508 3849 ϩ 10kbC Ͼ T 1 ⌬F508 R1066C 1 ⌬F508 Y1092X 1 ⌬F508 L206W 1 ⌬F508 R560T 1 ⌬F508 1152H 1 ⌬F508 621 ϩ 1G Ͼ T 1 R117H G551D 1 R117H G85E 1 G551D 2789 ϩ 5GϾA 1 G551D R117C 1 G85E 711 ϩ 1GϾT 1 W1282X 3849 ϩ 10kbCϾT 1 R553X 2183AAϾG 1 A455E S549R 1 ⌬F508 Unknown† 13 N1303K Unknown 2 G542X Unknown 1 Unknown Unknown 2 * Includes 1 of the false-negative screens. Login to comment
170 § Presumed second CFTR mutation: R1066C, 1898GϾA (2), D1152H, L206W, Y1092X, and "not present in additional mutation analysis and yet to be identified" (13). Login to comment

PMID: 15176679 [PubMed] Decaestecker K et al: "Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients."

No. Sentence Comment

93 1 G85E/W496X 1 F508del# /N1303K# 1 G85E/N1303K# 1 T388I/R1158X 1 G85E/711z5GRA} 1 3272-26AwG} /E822X 1 G85E/R334W} 1 F508del# /R334W} 1 Total 68 574delA/2789z5GRA 1 F508del# /3272-26ARG} 1 F508del# /R352Q 1 F508del# /3272-26AwG} 1 R334W} /444delA 1 L206W/3272-26ARG} 1 F508del# /F508del# 1 L206W/? Login to comment

PMID: 15371903 [PubMed] Sugarman EA et al: "CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations."

No. Sentence Comment

7 The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. Login to comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment
63 The most prevalent mutations were as follows: ⌬F508, D1152H, R117H, G542X, L206W, I148T (3199del6 status unknown), ⌬I507, R1066C, R553X, 3849ϩ10kbCϾT, and R334W representing 83.72% of the total identified. Login to comment
71 In the carrier screening group, 4 mutations, D1152H, R117H, ⌬I507, and L206W, had frequencies of 3.8% 1 CFTR mutation distribution among Hispanic CF patients and carrier screening referrals CFTR Mutation Identified CF Patients Carrier Screening Referrals # of CF Chromosomes % Detection # of Carrier Screen Referrals % of Positive Carriers ⌬F508a 118 37.11c 136 47.39 G542Xa 11 3.46 12 4.18 R334Wa 11 3.46 6 2.09 3120 ϩ 1G Ͼ Aa 7 2.20 5 1.74 3876delAb 7 2.20 4 1.39 W1089Xb 7 2.20 R1066Cb 6 1.89 9 3.14 3849 ϩ 10kbC Ͼ Ta 3 0.94 6 2.09 R1162Xa 2 0.63 5 1.74 G85Ea 2 0.63 3 1.05 S549Nb 2 0.63 2 0.70 711 ϩ 1G Ͼ Ta 2 0.63 1 0.35 2789 ϩ 5G Ͼ Aa 2 0.63 1 0.35 1949del84b 2 0.63 1 0.35 R117Ha 1 0.31 14 4.88 ⌬I507a 1 0.31 11 3.83 R553Xa 1 0.31 7 2.44 ⌬F311b 1 0.31 1 0.35 1078delTa 1 0.31 1 0.35 621 ϩ 1G Ͼ Ta 1 0.31 1 0.35 3659delCa 1 0.31 1 0.35 Q890Xb 1 0.31 1 0.35 G551Da 1 0.31 1812 - 1G Ͼ Ab 1 0.31 I148T ϩ 3199del6a 1 0.31 A559Tb 1 0.31 1717 - 1G Ͼ Aa 1 0.31 3905insTb 1 0.31 3821delTb 1 0.31 G178Rb 1 0.31 D1152Hb 18 6.27 L206Wb 11 3.83 I148T (3199del6 status unknown)a 10 3.48 N1303Ka 4 1.39 W1282Xa 4 1.39 R117Cb 4 1.39 R352Qb 2 0.70 712 - 1G Ͼ Tb 2 0.70 Y1092Xb 1 0.35 444delAb 1 0.35 S549Rb 1 0.35 1609delCAb 1 0.35 Negative for mutations analyzed 120 37.74 15046 Total 318 62.20d 15333 100.00 a Mutation included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening.4,5 b Mutation not included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening. Login to comment
112 In both the Hispanic and African American populations, mutations associated with a variable clinical phenotype such as R117H, D1152H, and L206W were more common in the carrier screening population than the affected population. Login to comment

PMID: 15502086 [PubMed] Farez-Vidal ME et al: "Multimutational analysis of eleven cystic fibrosis mutations common in the Mediterranean areas."

No. Sentence Comment

51 Two multiplex reactions were designed for the analysis of 11 mutations: multiplex 1 (M1) analyzed K710X, R1066C/R1066S, 2869 insG, and Q890X polymorphisms; and multiplex 2 (M2) analyzed L206W, 1609delCA, R1066L/R1066H, R709X, and 1811 ϩ 1.6Kb polymorphisms. Login to comment
87 Peaks in M2 multiplex correspond to the following mutations: L206W, 1609delCA, R1066L/H, R709X, and 1811 ϩ 1.6Kb. Login to comment
88 Peaks sizes for wild-type positions studied (nt) were as follows: for L206W, 28.78-29.10; for 1609delCA, 32.71-32.89; for R1066L/H, 35.77-36.16; for R709X, 41.89-42.16; and for 1811 ϩ 1.6Kb, 49.71-49.91. Login to comment

PMID: 15776432 [PubMed] Clain J et al: "Misprocessing of the CFTR protein leads to mild cystic fibrosis phenotype."

No. Sentence Comment

102 RESULTS Genotype Data Among CF PatientsWith L206W Mutation Among the 668 French CF families and 162 CBAVD patients included in our study, 12 patients were identified as heterozygotes for the p.L206W mutation. Login to comment
209 Cells expressing wild-type or p.L206W CFTR produced a significantly higher cAMP-dependent fluorescence change than mock-transfected cells (wild-type: 0.03170.051; L206W: 0.01270.011), indicating a CFTR-depen- FIGURE 2. Login to comment
235 Because for most CF patients the mild L206W is associated with a severe mutation on the other chromosome, the particular haplotype linked to p.L206W strengthens the mild dominant effect of the p.L206W mutation. Login to comment
3 The aim of this study was to determine the mechanism of dysfunction of a disease-causing mutation associated with variable phenotypes. In order to attain these objectives, we studied the effect of the p.L206W mutation on CFTR protein production and function, and we examined the genotype-phenotype correlation of [p.L206W]+[p.F508del] patients. Login to comment
4 We showed that p.L206W is a processing (class II) mutation since the CFTR biosynthetic pathway was severely impaired, whereas single-channel measurements indicated ion conductance similar to the wild-type protein. Login to comment
19 Individuals bearing p.L206W in Received 3 August 2004; accepted revised manuscript 30 November 2004. n Correspondence to: Pascale Fanen, INSERM U.468, Ho" pital Henri Mondor,94010 Cre¤ teil, France. Login to comment
31 The aim of this study was to determine the mechanism of dysfunction of a disease-causing mutation that can result in such variable phenotypes. In order to attain these objectives, we studied the effect of the p.L206W mutation on CFTR protein production and function, and we examined the genotype-phenotype correlation of [p.L206W]+[p.F508del] patients. Login to comment
32 These studies showed that p.L206W is a class II but mild mutation. Login to comment
33 MATERIALS AND METHODS Patients We selected the patients with p.L206W mutation for this study among patients having well documented CF (n=668) or CBAVD (n=162), who were referred to our CF diagnosis center. Login to comment
39 Segregation of the p.L206W mutation was studied in the families by StyI restriction analysis. Login to comment
41 Intragenic haplotypes were determined by studying three microsatellites, IVS8(CA), IVS17b (TA), and IVS17b(CA) [Morral et al., 1992], in the patients having a p.L206W allele and, when possible, in their parents. Login to comment
42 Relation Between Genotype and Phenotype We extracted from the French CF registry all the patients who attended at least once in a participating care center during 1999 or 2000 and for whom the genotype was composed of the p.L206W and p.F508del mutations. Login to comment
50 For statistical comparison of clinical measures, patients heterozygous [p.L206W]+[p.F508del] were compared with those homozygous for p.F508del. Login to comment
103 Table 1 summarizes the CFTR genotype data among the 12 patients with the p.L206W mutation. Login to comment
104 Because p.L206W was found to be associated with one single haplotype in four patients previously described [Desgeorges et al., 1995], we also analyzed three intragenic microsatellites IVS8(CA), IVS17b(TA), and IVS17b(CA), the variable IVS8 sequence (TG)m(T)n, and the 1540A4G (M470V) common variant. Login to comment
105 All p.L206W chromosomes had the 1540A and the (TG)9(T)9 polymorphisms, six had the true [IVS8(CA)16;IVS17b(TA) 7;IVS17b(CA)17] haplotype defined by the three intragenic microsatellites, whereas six had a ''possible`` [IVS8(CA) 16;IVS17b(TA)7;IVS17b(CA)17] haplotype (see Table 1 for explanations). Login to comment
106 Our data together with the study of Desgeorges et al. [1995] showed that the p.L206W mutation was associated with one haplotype using this set of polymorphic sites. Login to comment
107 A more extensive study with seven diallelic and three multiallelic markers describes a second p.L206W-associated haplotype, as the result of recombination [Claustres et al., 1996]. Login to comment
108 The p.L206W mutation was found to account for 0.6% of the CF genes identified in our specialized center, and 0.9% in CBAVD patients. Login to comment
110 Relation Between Genotype and Phenotype To investigate the conditions associated with the p.L206W mutation, we first described the clinical data of 12 patients with the p.L206W mutation identified in our center, compared with 24 cases for which clinical data are available in the literature. Login to comment
111 Table 2 summarizes the clinical features and CFTR genotype in p.L206W patients. Login to comment
112 For most patients (30/36), p.L206W was combined with a severe mutation (p.F508del, p.I507del, p.G542X, p.W216X, p.R851X, and p.E60X) on the other CFTR allele. Login to comment
114 The patient conditions varied from isolated CBAVD to severe CF, even within the same genotype [p.L206W]+[p.F508del]. Login to comment
115 Interestingly, one newly identified CBAVD patient had 5(T) adjacent to 12 (TG) repeats at the IVS8(TG)m(T)n locus in trans with p.L206W, consistent with the recent demonstration that the (TG)12(T)5 allele is associated with disease penetrance [Groman et al., 2004]. Login to comment
117 All patients presenting with pulmonary outcomes had the [p.L206W]+[p.F508del] or [p.L206W]+[p.I507del] genotype, except one [p.L206W]+[?] Login to comment
119 The phenotypes of the 12 patients identified in the present study did not differ from those previously described in the literature and suggest that the p.L206W mutation is mostly associated with a mild CF or CBAVD phenotype. Login to comment
120 To examine the relationship between morbidity and the p.L206W mutation further, we performed a multicenter cross-sectional study, in which every CF patient with the [p.L206W]+[p.F508del] genotype was matched by age and sex to a p.F508del homozygote from the same center in France. Login to comment
123 Patients with the [p.L206W]+[p.F508del] genotype had a significantly better nutritional status and absence of diarrhea or meconium ileus at diagnosis. Login to comment
124 Pancreatic insufficiency occurred very rarely (1/12) and the lower frequency of Pseudomonas aeruginosa lung colonization explains the absence of i.v. antibiotic therapy in the compound heterozygous group for p.L206W. Login to comment
126 The mean age at diagnosis was borderline significant (P=0.057) when diagnosis based on neonatal screening was excluded: 13.7 years for [p.L206W]+[p.F508del] patients and 3.2 years for p.F508del homozygotes. Login to comment
127 Altogether, these results indicate milder CF disease in patients carrying the [p.L206W]+[p.F508del] genotype. Login to comment
128 Based on the pancreatic sufficient phenotype (>90% of patients), the p.L206W mutation should be considered as a mild mutation. Login to comment
129 Processing of CFTR Mutants To determine why patients with the p.L206W-CFTR allele suffered from mild CF, we first studied the maturation of CFTR in HeLa cells transiently transfected with cDNA encoding the wild-type and mutated CFTR proteins. Login to comment
134 Immunoprecipitation experiments at steady-state show that both wild-type and CF-associated p.L206W CFTR produced mature, fully glycosylated protein (band C), while none of the mock-transfected cells produced CFTR (Fig. 1A). Login to comment
139 By using a classical 15-minute radioactive metabolic labeling of proteins, the kinetics of wild-type and p.L206W core-glycosylated forms of CFTR were identical, whereas the mature band C of the mutant was not detected at any time of a 4-hr chase (Fig. 2A and B) and a even 24-hr chase (data not shown). Login to comment
142 CFTR Genotype of CF PatientsWith p.L206W Patient Genotype 15404Ga IVS8(TG)m(T)n a Haplotypeb 2296 [p.L206W]+[p.R851X] [1540A]+[1540G] [(TG)9(T)9]+[(TG)11(T)7] [16;7;17]+[16;31;14] 1929 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;31;13]c 1749 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[? Login to comment
143 ]c 179 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;31;13] 422 [p.L206W]+[p.G542X] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;33;13] 1720 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[17;32;13]c 1878 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[17;31;13]c 626 [p.L206W]+[p.E60X] [1540A]+[1540G] [(TG)9(T)9]+[(TG)11(T)7] [16;7;17]+[16;31;13] 1455 [p.L206W]+[1342-6(T)5]] [1540A]+[1540G] [(TG)9(T)9]+[(TG)12(T)5] [16;7;17]+[16;31;14]c 2104 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;31;13]c 652 [p.L206W]+[p.E216X] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;32;13] 2345 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[17;32;13] a The DNA and mutation numbering follows the CFTR mutation database, (www.genet.sickkids.on.ca/cftr), the A of the ATG translation start codon being numbered +133 (GeneBank NM_000492.2).We followed the approved nomenclature format in mutation names at the protein level and in genotype writing. Login to comment
145 c The segregation has not been studied in the family; the suggested genotype indicates a possible [IVS8(CA)16;IVS17b(TA)7;IVS17b(CA)17] haplotype linked to p.L206W, the other haplotype having been described linked to the second mutation [Morral et al.,1993]. Login to comment
146 TABLE2.ClinicalDataAmongPatientsWithp.L206W GenotypeClassa Ageat diagnosis(yr) Current age(yr)Sex Genital statusb Pancreatic status Pulmonary outcomes SweatCl(mEq/liter) mean7sd(n)Reference [p.L206W]+[p.F508del]II/II523FPSMild6171(2)Desgeorgesetal. Login to comment
147 [1995] [p.L206W]+[p.F508del]II/II1525FOUPSAsthma190710(2)Desgeorgesetal. Login to comment
148 [1995] [p.L206W]+[p.G542X]II/I2237MCBAVDPS^c 65711(3)Desgeorgesetal. Login to comment
149 [1995] [p.L206W]+[p.1507del]II/II3448MCBAVDPSInfection60710(3)Desgeorgesetal. Login to comment
150 [1995] [p.L206W]+[p.F508del]II/II^^^^PSYes460Bernardinoetal. Login to comment
151 [2000] [p.L206W]+[?]II/-^^^^PSYes460Bernardinoetal. Login to comment
152 [2000] [p.L206W]+[p.F508del]II/II0.312F^PSMildNegativeRozenetal. Login to comment
153 [1995] [p.L206W]+[p.F508del]II/II0.515F^PSMildNegativeRozenetal. Login to comment
154 [1995] [p.L206W]+[p.F508del]II/II0.616M^PSMildNegativeRozenetal. Login to comment
155 [1995] [p.L206W]+[p.F508del]II/II^38MCBAVD^^8773(2)Rozenetal. Login to comment
156 [1995] [p.L206W]+[p.F508del]II/II^56MCBAVD^^7773(2)Rozenetal. Login to comment
157 [1995] [p.L206W]+[p.F508del]II/II^55F^^Mild^Rozenetal. Login to comment
158 [1995] [p.L206W]+[p.F508del]II/II^45F^^Mild^Rozenetal. Login to comment
159 [1995] [p.L206W]+[p.F508del](n=6)II/II^^MCBAVDPSNo^Casalsetal. Login to comment
160 [2000] [p.L206W]+[?]II/-^^MCBAVDPSNo^Casalsetal. Login to comment
161 [2000] [p.L206W]+[3121-1G4A]II/I^^MCBAVDPSNo^Casalsetal. Login to comment
162 [2000] [p.L206W]+[1949del84]II/?^^MCBAVDPSNo^Casalsetal. Login to comment
163 [2000] [p.L206W]+[p.F508del]II/II^^MCBAVDPS^^Maketal. Login to comment
164 [1999] [p.L206W]+[?]II/-^^MCBAVDPS^^Maketal. Login to comment
165 [1999] [p.L206W]+[p.W216X]II/I0.116F^PSNo75(1)Thisstudy [p.L206W]+[p.F508del]II/II0.2d 2F^PSe BronchialhyperreactivityPositiveThisstudy [p.L206W]+[p.F508del]II/II216F^PSNo54714(6)Thisstudy [p.L206W]+[p.F508del]II/II24M^PSe Bronchitis65(1)Thisstudy [p.L206W]+[p.F508del]II/II23M^PSe Bronchitis9672(2)Thisstudy [p.L206W]+[p.F508del]II/II47F^PIBronchitis5478(2)Thisstudy [p.L206W]+[p.F508del]II/I56F^PSAsthma7576(2)Thisstudy [p.L206W]+[1342-6(T)5]II/-2833MCBAVDPSBronchitis^Thisstudy [p.L206W]+[p.G542X]II/I3243MCBAVDPSNo^Thisstudy [p.L206W]+[p.F508del]II/II3740MCBAVD^^^Thisstudy [p.L206W]+[p.E60X]II/I2938MCBAVDPSNo64(1)Thisstudy [p.L206W]+[p.F508del]II/II3536MCBAVDPINo93(1)Thisstudy a Theclassi'cationofmissensemutationswasbasedonfunctionalstudies[Lietal.,1993;Chengetal.,1990;Champignyetal.,1995]. Login to comment
188 D: Endoglycosidase H susceptibility of wild-type, p.F508del, and p.L206W core-glycosylated immature form of the CFTR protein.The asterisk (B*) indicates the shift of band B mobility. Login to comment
191 Both sets of experiments showed that the stability of the mature band C of the p.L206W mutant was nearly unaffected when compared to the wild type. Login to comment
192 Altogether, this indicates that the p.L206W mutation results in decreased conversion to the fully glycosylated protein which accounts for the low amount of band C observed in the steady-state experiments. Login to comment
199 Because polar residues can drive transmembrane helix associations through interhelical hydrogen bonds (H bond) [Choma et al., 2000; Zhou et al., 2000, 2001], aberrant side chain-side chain H bonds between p.L206W and the neighboring TM helices 2 or 4 could account for the misprocessing induced by the p.L206W mutation. Login to comment
200 Inspection of the TM2 and TM4 sequences identified five polar residues that could interact with p.L206W, namely Tyr-122, Cys-128, Thr-135, Cys-225, and Gln-237. Login to comment
201 To test this possibility, these residues were replaced one at a time by Ala (p.T122A, p.C128A, p.S135A, p.C225A, and p.Q237A) together with the p.L206W mutation, and the processing at steady-state was examined. Login to comment
202 None of these double-mutant proteins displayed improved processing when compared to the p.L206W mutation alone (data not shown). Login to comment
203 The overall observations reported here indicated that the p.L206W mutation impaired the CFTR biosynthetic pathway and that a hydrophobic residue at location 206 is necessary for proper CFTR processing. Login to comment
204 Immuno£uorescence Localization of p.L206W CFTR Mutant Figure 3 shows the influence of the p.L206W mutation on the cellular localization of CFTR in transiently transfected HeLa cells evaluated by indirect immunofluorescence using the mouse monoclonal antibody MAB25031, which recognizes the C-terminal portion of the CFTR protein. Login to comment
205 Wild-type CFTR was detectable as a uniform staining over the entire cell surface, and also as a more intense perinuclear pattern, whereas the p.L206W mutation resulted in large decrease in cell surface staining while perinuclear staining remained intense (Fig. 3). Login to comment
206 Hence the relative amount of the mature CFTR band detected in steady-state experiments was consistent with the cell surface staining by indirect immunofluorescence for both the wild-type and the p.L206W CFTR mutant. Login to comment
207 Chloride Channel Function of p.L206W CFTR Mutant To characterize this mutant protein functionally, the cAMP-stimulated Cl-conductance across the entire cell plasma membrane of CFTR-expressing cells was measured using a Cl- - sensitive dye fluorescent assay (Fig. 4A and B). Login to comment
210 Pulse-chase experiments showing the turnover of the immature and mature forms of wild-type and p.L206W CFTR. Login to comment
214 C: Stability of the mature wild-type and p.L206W CFTR determined upon inhibition of protein biosynthesis with cycloheximide (CHX). Login to comment
218 Compared to the wild-type, cells expressing p.L206W exhibited a distribution in fluorescence change that was significantly decreased (Po0.005). Login to comment
219 This decrease in cAMP-dependent Cl-conductance across the entire cell plasma membrane reflected at least in part the p.L206W CFTR misprocessing, and is consistent with the CF phenotype. Login to comment
220 Single-Channel Properties of the p.L206W Mutant Because the p.L206W mutant had altered cAMP-dependent Cl-conductance at the cell plasma membrane and produced some mature protein, single-channel properties were analyzed using excised, inside-out membrane patches. Login to comment
221 None of the membrane patches of mock-transfected cells displayed a Cl- current in the presence of intracellular ATP and PKA, whereas wild-type and p.L206W mutant CFTR channels were reversibly activated (data not shown). Login to comment
222 The single-channel current amplitudes of the p.L206W mutant were not different from those of the wild-type (Fig. 4C). Login to comment
223 By using 120 mM Cl- (symmetrically), wild-type and p.L206W mutant CFTR had a linear i-v relationship under activating conditions (Fig. 4D) and the conductance for p.L206W was 7.6270.61 pS (n=6), which was not significantly different from wild-type (7.1870.36 pS; n=6). Login to comment
225 However, visual inspection suggested that the gating parameters of the p.L206W mutant were not dramatically different from those of the wild-type CFTR. Login to comment
226 DISCUSSION This study provides strong clinical, molecular and functional evidence that the transmembrane CFTR p.L206W mutation should be classified as a mild class II mutation. Login to comment
227 Based on PI incidence in the overall case reports and in the present [p.L206W]+[p.F508del] genotype-phenotype relationships study (PI occurred in o10% of patients), p.L206W should be considered as a mild CF allele. Login to comment
230 Our multicenter cross-sectional study highlights the significantly better nutritional status (absence of diarrhea and meconium ileus) and confirms the presence of pulmonary outcomes in CF patients, further documenting the atypical clinical presentation of compound p.L206W patients from CBAVD to PI cystic fibrosis. Login to comment
232 Of interest, p.L206W arises in a unique haplotype with IVS8 (TG)9(T)9 and the 1540A common variant. Login to comment
233 This has implications concerning the phenotype associated with p.L206W. Login to comment
234 First, IVS8 (TG)9 and IVS8 (T)9 alleles, which are associated with correct splicing of exon 9, result in normal levels of p.L206W CFTR mRNA, and the 1540A allele is described as maintaining normal CFTR function. Login to comment
236 Second, because p.L206W is linked to a unique CFTR genetic background, it can be deduced that these polymorphisms inherited in cis with the p.L206W mutation cannot explain the phenotypic variability observed. Login to comment
237 The data reported here show that p.L206W is a disease-causing mutation by decreasing CFTR processing and subsequently Cl-channel conductance at the cell plasma membrane by approximately 60%. Login to comment
238 The subcellular localization of p.L206W CFTR in transfected HeLa cells differs dramatically from that of the wild-type CFTR, the mutant being mainly located in the cytoplasm. Login to comment
241 We can first confirm that Leu-206 does not line the channel [Akabas, 1998] and second, that cells expressing the p.L206W mutation generate residual cAMP-dependent Cl- currents at the plasma membrane, which is believed to be sufficient to confer a variable or mild clinical phenotype. Login to comment
243 Immuno£uorescence localization of wild-type and p.L206W CFTR in transiently transfected HeLa cells.Cells grown on glass slides were 'xed in methanol, permeabilized in 0.1%Triton X-100 in PBS, and visualized by indirect immuno£uorescence. Login to comment
250 Interestingly, the disease-causing mutation p.P205S, flanking p.L206W in the middle of the TM3, produced nearly no detectable mature protein [Sheppard et al., 1996]. Login to comment
253 Thus, the p.L206W mutation might disturb local hydrophobic constraints, preventing the ''pro-folding`` activity of Pro-205. Login to comment
257 This mechanism seems unlikely to explain p.L206W misprocessing because we did not identify such partners for p.L206W by testing several polar residues in the two helices adjacent to TM3. Login to comment
260 ClÀ channel activity of HeLa cells transiently transfected with wild-type and p.L206W CFTR. Login to comment
275 Unexpectedly, the mechanism of dysfunction of p.L206W resembles that of p.G85E and p.P205S, which are misprocessed without altering ion conductance [Sheppard et al., 1996; Xiong et al., 1997]. Login to comment
283 Environmental and other genetic factors might contribute to this variability [Bronsveld et al., 2000; Garred et al., 1999], and a plausible explanation that we favor is that p.L206W and other class II mutants are associated with a variable clinical phenotype because multiple potential partners could modify the processing of the CFTR protein during its course to the cell surface. Login to comment
287 p.L206W, a misprocessing mutation localized in a transmembrane segment, provides a striking example that functional analysis of CFTR mutations identified in patients is necessary to assign the correct class to each particular mutation. Login to comment

PMID: 15880796 [PubMed] Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."

No. Sentence Comment

58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

PMID: 15994263 [PubMed] de Gracia J et al: "Genotype-phenotype correlation for pulmonary function in cystic fibrosis."

No. Sentence Comment

209 To study the decline in pulmonary function between groups the ANOVA method (repeated measures) was used with baseline and current spirometric values as dependent variables, genotype groups as the independent variable, and age and evolution time as Table 1 CFTR mutation according to functional classification Class Molecular dysfunction Mutation I Defective protein production G542X, 711+1GRT, 1609delCA, R1162X, 1717-8GRA, W1282X, 1782delA, Q890X, 1898+3ARG, CFTRdele19, 936delTA II Defective protein processing F508del, N1303K, I507del, R1066C III Defective protein regulation D1270N, G551D IV Defective protein conductance L206W, R334W, R117H, R347H, D836Y, P205S V Partially defective production or processing 2789+5GRA, 1811+1.6kbARG, 3849+10kbCRT, 3272+26GRA Table 2 Groups based on genotype in CF adult patients Functional classes Genotype No of subjects I-I G542X/W1282X 1 R1162X/1898+3ARG 1 R1162X/CFTRdele19 1 I-II F508del/G542X 5 F508del/711+1GRT 2 F508del/1717-8GRA 1 F508del/936delTA 1 F508del/R1162X 1 N1303K/1609delCA 1 I-III G542X/D1270N+R74W 1 711+1G-T/G551D 1 I-IV G542X/P205S 1 Q890X/R334W 1 1609delCA/R347H 1 I-V G542X/2789+5GRT 2 G542X/1811+1.6kbARG 1 1782delA/2789+5GRA 1 1609delCA/1811+1.6kbARG 1 II-II F508del/F508del 21 F508del/N1303K 1 F508del/R1066C 1 II-III F508del/D1270N+R74W 1 I507del/D1270N+R74W 1 II-IV F508del/L206W 4 F508del/R334W 3 F508del/R117H 3 F08del/R347H 2 F508del/D836Y 1 II-V F508del/2789+5GRA 5 F508del/3849+10kbCRT 2 F508del/1811+1.6kbARG 2 F508del/3272+26GRA 1 N1303K/1811+1.6kbARG 1 N1303K/2789+5GRA 1 adjusted variables. Login to comment

PMID: 16189704 [PubMed] McGinniss MJ et al: "Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples."

No. Sentence Comment

74 DF508/c.546insCTA CF; lung symptoms; PS; 2 sibs with CF NG Pos p.R1066C/c.3272-26 A>G Mild CF 40 115 [p.V562I;p.A1006E]b /p.R1158X CF, FTT 6 Not done DF508/c.1716G>A Classic CF 21 Not done p.R785X/c.2732insA Classic CF, PI 4 Not done DF508/p.R117C Classic CF 2 Not done DF508/p.R75X CF 19 Pos DF508/p.G451Va Mild CF 23 Pos DF508/p.L206W Classic CF 9 150s DF508/p.G542Xc Classic CF 15 Pos p.T1036N/p.T1036Na CF, PS 9 Pos DF508/c.3272-26 A>G Classic CF 33 Not done DF508/p.R117Hc Classic CF 35 Not done DF508/p.A455Ec CF 3 Pos p.G551D/p.Y275X a Novel CFTR variant b Complex CFTR allele c Both mutations are on the ACMG/ACOG panel Table 5 Diagnosis of CF in infants/newborns with abnormal newborn screening results Patient number Genotype Age at sequencing Sex Newborn screen result Sweat chloride concentration (mmol/l)a Phenotype 1 DF508/c.2789+2insA 3 months F Positive sweat test 88,96,89,84 Dx of CF, being treated prophylactically 2 DF508/c.2949del5b 3 months F IRT positive 105 Dx of CF 3 p.G551D/c.1259insA 14 months M Positive sweat test ?

In reference to DF508 and 1716G>A. Does this mean these two mutation have resulted in "classic CF"? Does this mean 1716G>A is disease causing?
Gibson75 on 2013-08-12 07:00:25

PMID: 16193325 [PubMed] Bishop MD et al: "The cystic fibrosis transmembrane conductance regulator gene and ion channel function in patients with idiopathic pancreatitis."

No. Sentence Comment

85 Sex Type of pancreatitis Age, years CFTR genotype TG repeata Sweat chloride, mmol/lb NTPD DClÀ free+ Iso, mVc Normal Borderline Abnormal Normal Abnormal 1 F Chronic 19 F508deld /L206W 63 Not done 2 M Acute 16 F508deld /R117H(7T)d 10 60 5.0 3 F Chronic 43 F508deld /L967S 46 À2.5 4 F Acute 16 W1282Xd /5T 12 38 1.0 5 F Acute 10 F508deld /D1152H 33 17.0 6 F Chronic 19 5T/5T 11/11 6 15.0 7 F Chronic 33 F508deld /À 69 7.4 8 M Chronic 25 F508deld /À 54 7.0 9 M Chronic 15 F508deld /À 33 14.0 10 F Chronic 33 F508deld /À 26 7.0 11 M Chronic 12 F508deld /À 24 6.0 12 M Chronic 21 2183AA fi G/À 124 Not done 13 F Acute 19 5T/À 11 71 11.0 14 M Chronic 71 5T/À 11 39 19.0 15 F Chronic 38 5T/À 11 20 30.0 16 F Chronic 21 5T/À 11 18 Not done 17 F Chronic 17 5T/À 11 17 Not done 18 F Chronic 26 5T/À No DNA 12 38.0 19 F Chronic 45 5T/À 11 5 34.0 20 F Chronic 40 R75Q/À 32 16.0 21 F Chronic 11 S1235R/À 31 46.0 22 F Acute 1 R170H/À 19 Not done 23 F Acute 14 1716G fi A/À 14 26.0 24 F Chronic 23 1716G fi A/À 12 12.0 25 M Acute 8 À/À 51 15.0 26 M Chronic 67 À/À 46 11.0 27 M Acute 13 À/À 44 36.0 28 F Acute 28 À/À 35 3.0 29 F Chronic 21 À/À 22 6.0 TG12. Login to comment

PMID: 16202789 [PubMed] Parad RB et al: "Diagnostic dilemmas resulting from the immunoreactive trypsinogen/DNA cystic fibrosis newborn screening algorithm."

No. Sentence Comment

65 Two infants with DF508/5T and borderline sweat chloride values were not included in the count of the true positive cohort, however follow-up continues Group IRT (mg/ml) IRT % CFTR Allele 1 CFTR Allele 2 [Cl2 ] mEq/L Sex I 64 97 DF508 R117H-7T 34 F 179 100 DF508 R117H-7T 33 F 79 99 DF508 R117H-7T 49 M 97 99 W1282X 3849110kb 54 M II 176 99.8 DF508 R117H-7T 24 F 129 99.7 G85E R117H 21 F 84 99 G551D R117H-7T 27 M III 94 99.1 DF508 unknown 58 M* 142 100 G85E R117C 33 F 72 98 G551D R117C 46 F 100 99.2 DF508 L206W 35 M IV 141 100 G85Ey R117C 41 M *Identified twin sibling has [Cl2 ] > 60 mEq/L. Login to comment

PMID: 17003641 [PubMed] Keiles S et al: "Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis."

No. Sentence Comment

71 Patients With 1 CFTR Mutation CFTR Mutation 1 No. of Patients 1717-1 G9A 1 2789+5 G9A 1 3849+10kb C9T 2 3849+45 G9A 1 621+3 A9G 2 A1364V 1 A349V 1 A455E 1 D1152H 1 D1445N 1 deltaF508 16 E217G 1 F1286C 1 F316L 1 G542X 1 G551D 1 I148T 1 I807M 1 L206W 1 L967S 2 L997F 2 P55S 1 Q179K 1 Q220X 1 R117H 3 R1453W 1 R297Q 1 R31C 1 R668C 2 S1235R 1 S573C 1 S945L 1 V562A 1 V754M 2 Y1092X 1 Total patients 58 MutationsinboldfacewouldnothavebeendetectedbytheACOG/ACMGmutationpanel. Login to comment

PMID: 17329263 [PubMed] Ratbi I et al: "Detection of cystic fibrosis transmembrane conductance regulator (CFTR) gene rearrangements enriches the mutation spectrum in congenital bilateral absence of the vas deferens and impacts on genetic counselling."

No. Sentence Comment

50 CFTR mutations were detected in 387 out of 444 alleles (87.2%), most of them being previously described in patients with CF of varying severity, CBAVD or other CFTR diseases: 45% of identified alleles consisted of severe CF mutations (e.g. F508del, W1282X, 2183AA.G); 13.8% of mild or variable CF mutations (e.g. L206W, 3272-26A.G, R117H, D1152H); 36.7% of mild CFTR defects which are currently not considered CF-causing (e.g. IVS8(T)5, Q1352H, the complex alleles [D443Y;G576A;R668C] and [R74W;D1270N]) and 4.5% of rare missense mutations whose effect is difficult to predict (e.g. A959V, G1069R, V1153E). Login to comment
69 Frequent cystic fibrosis transmembrane conductance regulator (CFTR) defects found in congenital bilateral absence of the vas deferens (CBAVD) patients (above 1% among the identified alleles) Mutation No. of alleles % of the 390 identified alleles F508dela 119 30.5 IVS8(T)5a,b 107 27.4 (TG)12(T)5 82 (TG)13(T)5 16 (TG)11(T)5b 9 R117Ha 25 6.4 R668C 9 2.3 [D443Y;G576A;R668C] 6 [G576A;R668C] 2 R668C 1 L206W 7 1.8 D1152H 6 1.5 W1282Xa 5 1.3 [V562I;(TG)11(T)5] 5 1.3 [R74W;D1270 N] 4 1.0 [R74W;D1270 N] 3 [R74W;V201M;D1270 N] 1 Q1352H(G . Login to comment
149 Some genotypes had already been described in patients with moderate or late CF, such as those combining F508del with L206W, D1152H, 3272-26A.G or 2789 þ 5G.A. Login to comment

PMID: 17413420 [PubMed] Grangeia A et al: "Molecular characterization of the cystic fibrosis transmembrane conductance regulator gene in congenital absence of the vas deferens."

No. Sentence Comment

93 DeltaF508 was the second most common mutation, representing 21 (23.3%) of total alleles, followed by R334W (6, Table 1 CFTR gene mutations and polymorphisms in patients with congenital absence of the vas deferens Mutation Location Nucleotide alteration Effect Method 1 CFTRdele2,3 Exons 2-3 Deletion of exons 2 and 3 Frameshift QFM-PCR 2 R117H Exon 4 G¡A at 482 AA substitution 31 mutation panel 3 P205S Exon 6a C¡T at 745 AA substitution DGGE/dHPLC 4 L206W Exon 6a T¡G at 749 AA substitution DGGE/dHPLC 5 R258G Exon 6b A¡G at 904 AA substitution DGGE/dHPLC 6 R334W Exon 7 C¡T at 1132 AA substitution 31 mutation panel 7 T5 allele Intron 8 Deletion of 2T at 1342-12 to -6 Aberrant splicing DGGE/DNA sequencing 8 P439S Exon 9 C¡T at 1447 AA substitution DGGE/dHPLC 9 D443Ya Exon 9 G¡T at 1459 AA substitution DGGE/dHPLC 10 I507del Exon 10 Deletion of 3 bp at 1648-1653 AA deletion 31 mutation panel 11 DeltaF508 Exon 10 Deletion of 3 bp at 1652-1655 AA deletion 31 mutation panel 12 G542X Exon 11 G¡T at 1756 Truncation 31 mutation panel 13 V562I Exon 12 G¡A at 1816 AA substitution DGGE/dHPLC 14 G576Aa Exon 12 G¡C at 1859 Aberrant splicing DGGE/dHPLC 15 D614G Exon 13 A¡G at 1973 AA substitution DGGE/dHPLC 16 R688Ca Exon 13 C¡T at 2134 AA substitution DGGE/dHPLC 17 V754M Exon 13 G¡A at 2392 AA substitution DGGE/dHPLC 18 E831X Exon 14a G¡T at 2623 Truncation DGGE/dHPLC 19 3272-26AϾG Intron 17a A¡G at 3272-26 Aberrant splicing DGGE/dHPLC 20 2789ϩ5G¡A Intron 14b G¡A at 2789ϩ5 Aberrant splicing 31 mutation panel 21 V1108L Exon 17b G¡C at 3454 AA substitution DGGE/dHPLC 22 L1227S Exon 19 T¡C at 3812 AA substitution DGGE/dHPLC 23 S1235R Exon 19 T¡G at 3837 AA substitution DGGE/dHPLC 24 P1290S Exon 20 C¡T at 4000 AA substitution DGGE/dHPLC 25 N1303K Exon 21 C¡G at 4041 AA substitution 31 mutation panel 26 E1401K Exon 23 G¡A at 4333 AA substitution DGGE/dHPLC Polymorphisms 1 TG repeats Intron 8 9-13 copies at 1342-12 to -35 Sequence variation DGGE/DNA sequencing 2 M470V Exon 10 A or G at 1540 Sequence variation DNA sequencing 3 125G/C Exon 1 G¡C at 125 Sequence variation DGGE/dHPLC 4 1001ϩ11T/C Intron 6b C¡4T at 1001ϩ11 Sequence variation DGGE/dHPLC 5 1716G/A Exon 10 G¡A at 1716 Sequence variation DGGE/dHPLC 6 1899-136T/G Intron 12 T¡G at 1899-136 Sequence variation DGGE/dHPLC 7 T854T Exon 14a T¡G at 2694 Sequence variation DGGE/dHPLC 8 3601-65C/A Intron 18 C¡A at 3601-65 Sequence variation DGGE/dHPLC 9 4521G/A Exon 24 G¡A at 4521 Sequence variation DGGE/dHPLC QFM-PCR, semiquantitative fluorescent multiplex polymerase chain reaction; bp, base pair; DGGE, denaturing gradient gel electrophoresis; dHPLC, denaturing high-performance liquid chromatography. Login to comment
97 The allelic frequency of the other mutations was 4.4% for R117H, G576A, and R668C, 3.3% for S1235R and 3272-26A¡G, and 2.2% for P205S, L206W, D443Y, G542X, D614G, and N1301K, whereas the remaining 12 mutations were present in single patients (Table 3). Login to comment
101 The missense M470V polymorphism was evaluated in all 45 pa- tientswithCAVD(Table2).TheallelicfrequencyoftheM470variant Table 2 CFTR genotypes identified in patients with congenital absence of the vas deferens CFTR mutation genotypes [(TG)mTn] genotype M470V Patients N % DeltaF508 (TG)10T9 (TG)12T5 M V 11 24.4 DeltaF508 (TG)10T9 (TG)11T5 M M 1 2.2 DeltaF508 R117H (TG)10T9 (TG)10T7 M M 2 4.4 G542X (TG)10T9 (TG)12T5 M V 2a 4.4 DeltaF508 R334W (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 D443Y-G576A-R668C (TG)10T9 (TG)10T7 M M 1 2.2 DeltaF508 D614G (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 E831X (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 L1227S (TG)10T9 (TG)11T7 M M 1 2.2 DeltaF508 E1401K (TG)10T9 (TG)11T7 M V 1 2.2 I507del D614G (TG)11T7 (TG)10T7 M V 1 2.2 N1303K L206W (TG)10T9 (TG)9T9 M M 1 2.2 R117H P205S (TG)11T7 (TG)10T7 M V 1 2.2 R117H R334W (TG)10T7 (TG)11T7 M V 1 2.2 R334W P439S (TG)11T7 (TG)11T7 M V 1 2.2 R334W R334Wb (TG)11T7 (TG)11T7 V V 1 2.2 R334W V562I (TG)11T7 (TG)11T5 V M 1 2.2 D443Y-G576A-R668C 3272-26A¡G (TG)10T7 (TG)10T7 M M 1 2.2 G576A-R668C V754Mb (TG)10T7 (TG)11T7 M M 1 2.2 S1235R S1235Rb (TG)13T5 (TG)13T5 M M 1 2.2 2789ϩ5G¡A S1235Rb (TG)10T7 (TG)13T5 M M 1 2.2 3272-26A¡G P1290S (TG)11T7 (TG)10T7 M V 1 2.2 P205S (TG)11T7 (TG)12T5 V V 1 2.2 G576A-R668C b (TG)10T7 (TG)11T5 M M 1 2.2 V1108L b (TG)11T7 (TG)11T5 V M 1 2.2 N1303K (TG)10T9 (TG)12T5 M V 1 2.2 3272-26A¡G b (TG)10T7 (TG)12T5 M V 1 2.2 CFTRdele2,3 b (TG)11T7 (TG)13T5 V M 1 2.2 b (TG)11T5 (TG)12T5 M V 1 2.2 b (TG)13T5 (TG)12T5 M V 1 2.2 DeltaF508 - (TG)10T9 (TG)11T7 M V 1a 2.2 L206W -b (TG)9T9 (TG)11T7 M V 1 2.2 R258G -b (TG)11T7 (TG)11T7 V V 1 2.2 a CUAVD. Login to comment
110 Large Table 3 Allelic frequencies of CFTR mutations in patients with congenital absence of the vas deferens CBAVD CUAVD Total Patients 42 3 45 Alleles 84 6 90 Mutations N % N % N % 1 T5 allele 26a 31 2 33.3 28 31.1 2 DeltaF508 20 23.8 1 16.7 21 23.3 3 R334W 6a 7.1 0 0 6 6.7 4 R117H 4 4.8 0 0 4 4.4 5 G576A 4b 4.8 0 0 4 4.4 6 R688C 4b 4.8 0 0 4 4.4 7 S1235R 3a 3.6 0 0 3 3.3 8 3272-26A¡G 3 3.6 0 0 3 3.3 9 P205S 2 2.4 0 0 2 2.2 10 L206W 2 2.4 0 0 2 2.2 11 D443Y 2b 2.4 0 0 2 2.2 13 D614G 2 2.4 0 0 2 2.2 14 N1303K 2 2.4 0 0 2 2.2 12 G542X 0 0 2 33.3 2 2.2 15 R258G 1 1.2 0 0 1 1.1 16 P439S 1 1.2 0 0 1 1.1 17 I507del 1 1.2 0 0 1 1.1 18 V562I 1 1.2 0 0 1 1.1 19 V754M 1 1.2 0 0 1 1.1 20 E831X 1 1.2 0 0 1 1.1 21 2789ϩ5G¡A 1 1.2 0 0 1 1.1 22 V1108L 1 1.2 0 0 1 1.1 23 L1227S 1 1.2 0 0 1 1.1 24 P1290S 1 1.2 0 0 1 1.1 25 E1401K 1 1.2 0 0 1 1.1 26 CFTRdele2,3 1 1.2 0 0 1 1.1 CBAVD, congenital bilateral absence of the vas deferens; CUAVD, congenital unilateral absence of the vas deferens. Login to comment

PMID: 17656682 [PubMed] Guilbault C et al: "Fenretinide corrects newly found ceramide deficiency in cystic fibrosis."

No. Sentence Comment

179 T/L206W CF (n 5 10) 50† 37.2 6 4.2 58.5 6 3.0 166.7 6 3.4 21.0 6 1.0 HC (n 5 10)‡ 50† 34.7 6 4.2 70.1 6 4.3 166.2 6 3.4 25.4 6 1.3 Definition of abbreviations: BMI, body mass index; CF, cystic fibrosis; HC, healthy control. Login to comment

PMID: 17850636 [PubMed] Girardet A et al: "Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements."

No. Sentence Comment

28 CFTR mutations identified through the neonatal screening of 84 newborns Mutations Frequency (%) p.Phe508del* 59.52 p.Arg117His* 5.35 p.Gly542X* 2.98 [3849110 kbC.T]* 2.39 p.Arg334Trp* 1.19 p.Arg1162X* 1.19 [2183AA.G]* 1.19 [1717-1G.A]* 1.19 p.Arg1066Cys 1.19 p.Glu1104X 1.19 Total 77.38 Mutations found only once 22.62 Mutations found in a single cystic fibrosis allele: p.Arg75X*, p.Tyr122X*, 71111G.T*, 1078delT*, p.Ile507del*, p.Gly551Asp*, p.Ser1251Asn*, p.Trp1282X*, p.Asn1303Lys*, 62113A.G, p.Leu206Trp, p.Gln220X, p.Gln237Glu, 100115G.A, (TG)12T5, p.Ile506Val, p.Ile506Thr, 1717- 3T.C, p.Leu558Ser, 1802delC, p.Lys710X, p.Leu732X, 2380del8, p.Cys832X, 262211G.A, p.Arg851X, 2634delT, 3007delG, p.Leu997Phe, 3041-15T.G, 3121-1G.A, p.Arg1102X, p.Gly1127Glu, 3750delAG, 3850-1G.A, 400511G.A, and two large rearrangements c.54-5811_c. Login to comment

PMID: 18306312 [PubMed] Gene GG et al: "N-terminal CFTR missense variants severely affect the behavior of the CFTR chloride channel."

No. Sentence Comment

133 Genotype^Phenotype Correlation in the N-Terminal CFTR MissenseVariants Under StudyÃ Missense varianta Phenotype Second allele (number of patients)b p.P5L CF p.F508del (1), p.P205S (1) p.S50P CBAVD p.F508del (1), p.E115del (1) p.E60K CF p.G542X (1), p.I507del (1) p.R75Q HT p.F508del (3), p.E725K (1) B p.R347H (1), p.R75Q (1), n.i. (4) Br c.1584G4A (2), c.1210-7_1210-6delTT (1), n.i.(3) NT p.F508del (1) CP c.1584G4A (1), n.i. (3) MI n.i. (1) CUAVD n.i. (2) OZ n.i. (2) Normal p.R75Q (1), c.2052_2053insA (1), n.i. (1) p.G85E CF p.F508del (8), p.G542X (2), p.I507del (1), c.580-1G4T (1), p.G85E (1), c.1477_ 1478delCA (1) CBAVD p.G576A (1) HT p.L997F (1),WT (1) p.G85V CF p.F508del (2), p.G542X (2), p.Y1092X (1), c.265715G4A (1), p.A1006E, c.1210-7_1210- 6delTT (1), n.i. (1) p.Y89C CF n.i. (1)c p.E92K CF p.F508del (2), p.Q890X (1), p.L206W (1) CBAVD c.1210-7_1210-6delTT (1) ÃThe recommendations for mutation nomenclature (www.hgvs.org/mutnomen/) were used to name CFTR gene sequence variations at both the nucleotide level and the protein level. Login to comment

PMID: 18344710 [PubMed] Madore AM et al: "Distribution of CFTR mutations in Saguenay- Lac-Saint-Jean: proposal of a panel of mutations for population screening."

No. Sentence Comment

48 Altogether, the six mutations represent 95.89% of the CFTR allele of CF patients in the SLSJ population, whereas the proportions are 86.85, 85.27, and Table 2 Cystic fibrosis mutations present in the four populations studied Mutationa Allelic frequency (number of alleles [%]) Populationb 1 2 3 4 „F508 106 (62.35) 55 (72.37) 398 (72.36) 67 (57.78) 621 ؉ 1G>T 42 (24.71) 6 (7.89) 30 (5.45) 1 (0.85) A455E 12 (7.06) 2 (2.63) 14 (2.55) 1 (0.85) 3199del6 1 (0.59) 1 (1.32) 7 (1.27) 1 (0.85) 711 ؉ 1G>T 1 (0.59) 1 (1.32) 15 (2.73) 1 (0.85) Y1092X 1 (0.59) 1 (1.32) 5 (0.91) 0 R117C 2 (1.18) 0 0 0 ‚I507 1 (0.59) 2 (2.63) 10 (1.82) 0 L206W 1 (0.59) 1 (1.32) 9 (1.64) 0 R1158X 1 (0.59) 0 0 0 S489X 1 (0.59) 0 1 (0.18) 0 R553X 0 2 (2.63) 2 (0.36) 0 R334W 0 1 (1.32) 2 (0.36) 0 G542X 0 0 10 (1.82) 0 G85E 0 0 6 (1.09) 5 (4.24) N1303K 0 0 5 (0.91) 1 (0.85) IVS8-5T 0 0 4 (0.73) 0 W1282X 0 0 3 (0.55) 7 (5.93) R347P 0 0 1 (0.18) 2 (1.69) V520F 0 0 1 (0.18) 0 I1027T 0 0 1 (0.18) 0 R1066C/IVS 0 0 1 (0.18) 0 Q1313X 0 0 1 (0.18) 0 1898ϩ3GϾA 0 0 1 (0.18) 0 2183AAϾG 0 0 1 (0.18) 0 2951insA 0 0 1 (0.18) 0 G551D 0 0 0 2 (1.69) 1525-iG-A 0 0 0 2 (1.69) Y109C 0 0 0 1 (0.85) S549N 0 0 0 1 (0.85) 3154del1G 0 0 0 1 (0.85) UNKNOWN 1 (0.59) 4 (5.26) 20 (3.82) 25 (21.19) Number of alleles genotypedc 170 (100) 76 (100) 550 (100) 118 (100) a The six mutations included in the panels proposed are in bold. Login to comment

PMID: 19014821 [PubMed] Soultan ZN et al: "Sweat chloride testing in infants identified as heterozygote carriers by newborn screening."

No. Sentence Comment

54 Sweat [Cl- ] and the results of genetic screening of 11 patients with [Cl- ] > 24 mmol/L Patients Sweat [Cl- ] mmol/L Mutations Poly T-TG Repeats 1 89 91 R347P CFTRdel 17a-18 7T/9T 2 85 82 ⌬F508 2622ϩ1 GϾT 9T/9T 3 71 - G542X Y1014del 7T/9T 4 69 65 ⌬F508 c.759AϾG 9T/7T 5 58 49 ⌬F508 L206W 9T/9T 6 44 27 ⌬F508 R352W, P750L - 7 38 41 ⌬F508 - 9T-TG10 5T-TG12 8 24 - ⌬F508 - 9T-TG10 5T-TG12 9 25 27 ⌬F508 - 9T-TG10 5T-TG12 10 24 25 ⌬F508 - 9T-TG12 5T-TG12 11 35 26 ⌬F508 - 9T 9T Soultan et al The Journal of Pediatrics • December 2008 should be followed. Login to comment

PMID: 19812525 [PubMed] de Cid R et al: "Independent contribution of common CFTR variants to chronic pancreatitis."

No. Sentence Comment

38 Scanning Methodology Applied in CFTR Gene Analysis Amplicon Name Fragment Size, bp Control Set (n = 93) Patient Set 1 (n = 68) Patient Set 2 (n = 68) Control Sequence Exon 1 192 SSCP/HD SSCP/HD dHPLC 125G9C Exon 2 334 SSCP/HD SSCP/HD dHPLC 296+3insT Exon 3 309 DGGE DGGE dHPLC G85V Exon 4 436 SSCP/HD SSCP/HD dHPLC R117H Exon 5 466 DGGE DGGE dHPLC R170H Exon 6a 345 SSCP/HD SSCP/HD dHPLC L206W Exon 6b 331 SSCP/HD SSCP/HD SSCP/HD TTGA 6/7 Exon 7 410 SSCP/HD SSCP/HD dHPLC R334W Exon 8 328 DGGE DGGE dHPLC 1341+28C9T Exon 9 375 DGGE DGGE DGGE 7T/9T Exon 10 493 SSCP/HD SSCP/HD SSCP/HD F508del; 1540A/A Exon 11 322 DGGE DGGE dHPLC S549R Exon 12 426 DGGE DGGE dHPLC G576A Exon 13a 532 SSCP/HD SSCP/HD dHPLC R668C Exon 13b 498 SSCP/HD SSCP/HD dHPLC I807M Exon 14a 284 DGGE DGGE DGGE 2694T9G Exon 14b 211 DGGE DGGE dHPLC 2789+5G9A Exon 15 487 DGGE DGGE dHPLC D924N Exon 16 294 SSCP/HD SSCP/HD dHPLC 3041-71G9C Exon 17a 294 SSCP/HD SSCP/HD dHPLC L997F Exon 17b 463 DGGE DGGE dHPLC 3272-26A9G Exon 18 451 DGGE DGGE dHPLC N1148K Exon 19 588 SSCP/HD SSCP/HD SSCP/HD 3601-65C9A Exon 20 471 DGGE DGGE dHPLC W1282X Exon 21 477 DGGE DGGE DGGE 4029G9A Exon 22 339 SSCP/HD SSCP/HD dHPLC Q1352H Exon 23 249 DGGE DGGE dHPLC 4374+13A9G Exon 24 362 SSCP/HD SSCP/HD SSCP/HD 4521G9A Control set, general population series analyzed; patient set 1, previous patient series reported in 2004; and patient set 2, new patient series analyzed in this study. Login to comment

PMID: 19845690 [PubMed] Moya-Quiles MR et al: "CFTR mutations in cystic fibrosis patients from Murcia region (southeastern Spain): implications for genetic testing."

No. Sentence Comment

17 of chromosomes Frequency (%) F508dela E.10 67 36.8 G542Xa E.11 22 12.1 A1006E E.17a 10 5.5 K710X E.13 10 5.5 2789+5G>Aa I.14b 9 4.9 L206W E.6a 7 3.8 1811+1.6kbA>G I.11 6 3.3 R334Wa E.7 5 2.7 2869insG E.15 5 2.7 I507dela E.10 4 2.2 N1303Ka E.21 4 2.2 R347Pa E.7 3 1.6 711+1G>Ta I.5 3 1.6 3849+10kbC>Ta I.19 3 1.6 Q890X E.15 3 1.6 R117Ha E.4 2 1.1 R1162Xa E.19 2 1.1 2183AA>Ga E.13 2 1.1 A561E E.12 2 1.1 R560G E.11 2 1.1 1717-1G>Aa I.10 1 0.5 E1308X E.21 1 0.5 E585X E.12 1 0.5 L997F E.17a 1 0.5 1677delTA E.10 1 0.5 R1158X E.19 1 0.5 W202X E.6a 1 0.5 R74W+D1270N E.3 + E.20 1 0.5 G576A+R668C E.12 + E.13 1 0.5 Unknown 2 1.1 Total 182 100 aCFTR mutations identified with the PCR OLA CF Genotyping Assay . Login to comment

PMID: 19897426 [PubMed] Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."

No. Sentence Comment

74 For many of these subjects mutations were identified following DGGE and/or dHPLC analysis, and not through the RDB-based test, as gene alterations are "rare"/uncommon [A238V, R352W, S42F, (V201M, D1270N & R74W) and L206W] or because they have never been identified before [D372E (1251T→G) and L1414S (4373T→C)]. Login to comment
97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction. Login to comment
99 Notes to Tables: (A) CFTR mutations A238V, R352W, 4006-19del3, S42F, D372E (1251T→G), L1414S (4373T→C), (V201M, D1270N & R74W) and L206W are not included in the RDB-based screening. Login to comment

PMID: 20059485 [PubMed] Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"

No. Sentence Comment

64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment
57 PI prevalence and in silico prediction scores for 13 most frequent missense mutations identified in Canadian CF patients Mutation Total PI Total (PI + PS) PI prevalence Class PANTHER scorea POLYPHENa SIFTa p.R334W 1 9 0.11 CF-PS -7.4419 Possibly damaging 0.01 p.P67L 2 14 0.14 CF-PS -4.1736 Probably damaging 0 p.R347P 2 12 0.17 CF-PS -7.5259 Possibly damaging 0.01 p.R347H 1 5 0.20 CF-PS -6.8327 Possibly damaging 0 p.A455E 8 39 0.21 CF-PS -8.8641 Probably damaging 0 p.L206W 4 19 0.21 CF-PS -8.5817 Possibly damaging 0 p.P574H 4 7 0.57 CF-PI/PSb -8.1252 Probably damaging 0 p.G85E 15 24 0.63 CF-PI/PSb -7.3194 Possibly damaging 0 p.M1101K 22 33 0.67 CF-PI/PSb -5.8849 Probably damaging 0.01 p.R1066C 7 8 0.88 CF-PI -7.7424 Probably damaging 0 p.G551D 56 59 0.95 CF-PI -9.5654 Probably damaging 0 p.N1303K 47 49 0.96 CF-PI -9.7687 Probably damaging 0 p.V520F 7 7 1.00 CF-PI -7.1652 Benign 0 aPANTHER scores range from zero to negative values (maximum -12). Login to comment
122 However, it completely misclassified other well-established mutations with low PI prevalence scores (p.L206W, p.R334W, p.R347P and p.A455E). Login to comment
124 SIFT-generated low (deleterious) scores for missense mutations associated both with the highest (p.N1303K, p.G551D, p.V520F) and the lowest PI prevalence scores (p.A455E, p.P67L, p.L206W). Login to comment

PMID: 20100616 [PubMed] Havasi V et al: "Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens."

No. Sentence Comment

68 Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator. Login to comment

PMID: 20522854 [PubMed] Sermet-Gaudelus I et al: "Measurement of nasal potential difference in young children with an equivocal sweat test following newborn screening for cystic fibrosis."

No. Sentence Comment

130 Table 3 Genotypes of the children with HIRT according to the diagnostic score cut-off in the 21 patients with reliable NPD tests; results after extensive genetic analysis CFTR genotypes Diagnosis score >0.27 (8 patients) £0.27 (13 patients) A/A 0 F508del/621+3A/G F508del/Q1291R A/AB F508del/R347H F508del/R117H;T7 W846X/R117C n¼2 F508del/R1070W 2183AA/G/L206W F508del/3272-26A/G F508del/R117H;T7; n¼4 A/D 0 F508del/R933G G551D/R352Q B/D G622D/3849+45G/A 0 A/0 F508del/0 n¼2 0 0/0 3 0 0, no identified mutation; A, CF-causing mutation; B, mutation associated with cystic CFTR-related disorders; C, mutation with no clinical consequence ; D, mutation of unknown or uncertain clinical relevance; AB, mutation that is associated with a wide phenotypic spectrum that might belong to either group A or B. CFTR, cystic fibrosis transmembrane conductance regulator; HIRT, hypertrypsinaemia; NPD, nasal potential difference. Login to comment

PMID: 20538955 [PubMed] Sermet-Gaudelus I et al: "Clinical phenotype and genotype of children with borderline sweat test and abnormal nasal epithelial chloride transport."

No. Sentence Comment

162 CLINICAL CHARACTERISTICS OF CHILDREN WITH EQUIVOCAL DIAGNOSES AND NASAL POTENTIAL DIFFERENCE DIAGNOSTIC SCORE <0.27 Pt Mutation Age (yr) NPD Score Sweat Cl2 Chronic CF Pulmonary Disease CF Pathogens Airway Obstruction CF Lung Imaging FEV1 (%) BMI Others 1 F508del/S977F A-D 8 0.181 43 RLRTI, chronic productive cough S. aureus No Bronchiectasis 80 14.5 No Bronchial thickening Atelectasis 2 0/0 4 0.121 43 No S. aureus Yes Air trapping NA 13 Pancreatic extracts 0-0 Bronchial thickening 3 0/0 15 20.032 46 RLRTI S. aureus, P. aeruginosa Yes Air trapping 74 14 Polyposis 0-0 Bronchiectasis 4 F508del/0 2 20.249 57 RLRTI P. aeruginosa Yes Air trapping NA 16 No A-0 5 N1303K/(TG12)T5 11.8 20.263 47 RLRTI S. aureus, P. aeruginosa No Bronchial thickening ND 20 No A-B 6 F508del/L206W 5.9 20.278 40 RLRTI S. aureus No Bronchial thickening 115 22 Chronic pancreatitis A-AB 7 R668C/0 15 20.403 40 RLRTI None Yes Bronchiectasis 112 20 No B-0 Air trapping 8 F508del/L997F A-B 1 20.594 38 RLRTI, chronic productive cough P. aeruginosa No Bronchial thickening NA 16 CF hepatopathy 9 G576A;R668C/S1235R 8 20.659 31 0 None Wheezing Normal 100 20 No B-B 10 G542X/0 5 20.718 49 RLRTI, chronic productive cough S. aureus No Bronchial thickening NA 18 No A-0 11 0/0 7 20.742 37 RLRTI None No Normal 106 18 No 0-0 12 F508del/D110E 16 20.777 50 No S. aureus No No 100 21 No A-AB 13 F508del/R1070W 7 21.006 40 RLRTI S. aureus Wheezing Bronchial thickening 110 14 No A-AB 14 F508del-L467F/0 12 21.897 55 RLRTI, chronic productive cough S. aureus No Bronchiectasis 109 17 Pansinusitis A-0 15 F508del/H1054D 9 22.327 59 RLRTI, chronic productive cough S. aureus No Bronchial thickening 100 20 DIOS A-D Definition of abbreviations: A, B, AB, and D: A 5 CF-causing mutation; B 5 mutation that results in a CFTR-RD (clinical entities associated with CFTR mutations that do not meet the current diagnostic criteria for CF); AB 5 wide-spectrum mutation that may belong to either group A or group B; D 5 mutation of uncertain clinical relevance; BMI 5 body mass index; CF 5 cystic fibrosis; CFTR 5 gene encoding cystic fibrosis transmembrane conductance regulator; DIOS 5 distal intestinal obstructive syndrome; NA 5 not applicable; ND 5 not determined; NPD 5 nasal potential difference; P. aeruginosa 5 Pseudomonas aeruginosa; Pt 5 patient; RLRTI 5 recurrent lower respiratory tract infection; S. aureus 5 Staphylococcus aureus. Login to comment

PMID: 21474639 [PubMed] Rohlfs EM et al: "Cystic fibrosis carrier testing in an ethnically diverse US population."

No. Sentence Comment

65 The median fluorescent intensity was determined, and the presence or absence of mutant and wild-type alleles was evaluated from the ratio of the mutant signal to the wild-type signal for the following mutations: c.1155_1156dupTA, c.2657ϩ5GϾA, c.3717ϩ12191CϾT, p.A455E, p.D1152H, p.F508del, p.G542X, p.G551D, p.I507del, p.L206W, p.N1303K, p.R117H, p.W1282X, and c.54-5940_ 273ϩ10250del21kb. Login to comment
123 CFTR mutationsa Individuals, n p.F508del/p.R117H 16 5T/9T 1 7T/9T 15 p.F508del/p.D1152H 3 p.R117H/p.R117H, 7T/7T 2 p.D1152H/p.D1152H 2 p.W1282X/p.D1152H 2 p.D1152H/p.G551D 1 c.3717ϩ12191CϾT/p.R352Q 1 c.3717ϩ12191CϾT/c.3717ϩ12191CϾT 1 p.F508del/c.3717ϩ12191CϾT 1 p.F508del/p.L206W 1 p.F508del/p.R117C 1 p.F508del/p.R347H 1 p.F508del/p.R347P 1 p.R117H/p.W1282X, 7T/7T 1 p.R117H/p.G551D, 7T/7T 1 p.R117H/p.G542X, 7T/9T 1 a Human Genome Variation Society nomenclature [Ogino et al. (23)]. Login to comment

PMID: 9724537 [PubMed] Akabas MH et al: "Channel-lining residues in the M3 membrane-spanning segment of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

222 Several mutations of residues in and flanking the M3 membrane-spanning segment have been identified in patients with CF, including D192G, E193K, H199Y, P205S, and L206W (58, 60-63). Login to comment

PMID: 9736775 [PubMed] Larriba S et al: "Testicular CFTR splice variants in patients with congenital absence of the vas deferens."

No. Sentence Comment

18 RESULTS CFTR analysis Eight different mutations (R117H, L206W, V232D, ∆F508, G542X, 711+1G→T, D1270N and 2789+5G→A) were found in nine of the 12 CBAVD patients, yielding a CFTR mutation frequencyof75%.ThreepatientspresentedtwoCFTRmutations, with one of them homozygous for the V232D mutation. Login to comment
26 CFTR genotype, IVS8-6 poly(T) allele and proportion of exon 9+ (E9+) and exon 9- (E9-) CFTR transcripts in testicular and epididymal biopsies Sample Phenotype CF mutation IVS8-6(T) Testis Epididymis n E9+ (%) E9- (%) n E9+ (%) E9- (%) 1 Non-CBAVD N/N 9T/9T 5 99 ± 0 1 ± 0 2 Non-CBAVD N/N 7T/7T 2 96 ± 2 4 ± 2 3 Non-CBAVD N/N 7T/7T 3 98 ± 0 2 ± 0 4 Non-CBAVD N/N 7T/7T 3 97 ± 1.5 3 ± 1.5 5 Non-CBAVD R334W/N 7T/7T 3 94 ± 1 6 ± 1 6 Non-CBAVD N/N 7T/7T 2 95 ± 1 5 ± 1 7 CBAVD V232D/V232D 9T/9T 4 96 ± 1.5 4 ± 1.5 8 CBAVD ∆F508/N 9T/9T 2 99 ± 0 1 ± 0 9 CBAVD ∆F508/D1270N 7T/9T 2 98 ± 1 2 ± 1 10 CBAVD G542X/2789+5G→A 7T/9T 2 96 ± 1 4 ± 1 11 CBAVD N/N 7T/7T 3 96 ± 2 4 ± 2 2 90 ± 3 10 ± 3 12 CBAVD N/N 7T/7T 2 94 ± 2 6 ± 2 5 78 ± 5 22 ± 5 13 CBAVD R117H/N 7T/7T 2 99 ± 0 1 ± 0 4 95 ± 2 5 ± 2 14 CBAVD G542X/5T 5T/9T 3 30 ± 2 70 ± 2 15 CBAVD ∆F508/5T 5T/9T 2 80 ± 5 20 ± 5 16 CBAVD L206W/5T 5T/9T 2 58 ± 2 42 ± 2 17 CBAVD 711+1G→T/5T 5T/7T 3 77 ± 4 23 ± 4 18 CBAVD 5T/N 5T/7T 5 71 ± 2 29 ± 2 The mean proportion of E9+ and E9- CFTR transcripts is calculated as the mean of the proportions found for each sample. Login to comment

PMID: 17331079 [PubMed] Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."

No. Sentence Comment

45 (%) p.F508del # E.10 1009 (51.74) p.G542X # E.11 150 (7.69) p.N1303K # E.21 57 (2.92) c.1811 + 1.6kbA > G I.11 36 (1.84) p.R334W # E.7 35 (1.79) p.L206W E.6a 32 (1.64) c.711 + 1G > T # I.5 31 (1.58) p.Q890X E.15 28 (1.43) p.R1162X # E.19 25 (1.28) c.2789 + 5G > A # I.14b 24 (1.23) p.R1066C E.17b 23 (1.18) p.I507del # E.10 21 (1.07) c.1609delCA E.10 18 (0.92) c.712-1G > T I.5 18 (0.92) c.3272-26A > G I.17a 18 (0.92) c.2183AA > G # E.13 16 (0.82) p.G85E # E.3 15 (0.77) c.2869insG E.15 15 (0.77) p.W1282X # E.20 15 (0.77) p.V232D E.6a 14 (0.71) p.A1006E * E.17a 12 (0.61) c.2184insA E.13 11 (0.56) p.K710X E.13 11 (0.56) TOTAL (n = 23) 1,634 (83.72) * , the complex allele [p.A1006E; p.V562I; IVS8-6(5T)] #, CF mutations identified with the Celera Diagnosis Cystic Fibrosis v2 genotyping assay and the Inno-Lipa CFTR12, CFTR17 + Tn Samples with microsatellite haplotypes 16/45-46-47 (IVS8CA/IVS17bTA) were submitted to direct analysis of the c.1811 + 1.6kbA > G mutation, which was found mainly associated with the 16-46 haplotype. Login to comment
53 #, CF mutations identified with the Celera Diagnosis Cystic Fibrosis v2 genotyping assay and the Inno-Lipa CFTR12, CFTR17 + Tn p.L206W, p.Q890X and p.R1066C, presented with frequencies above 1%, while 51 mutations (42%) were found only once (Table 2). Login to comment
68 In addition, the p.L206W mutation was always found to be associated with the rare haplotype 9T-9TG, and the c.1811 + 1.6kbA > G mutation with the c.3601-111G > C polymorphism. Login to comment
76 It is not surprising that four of the common mutations, presenting with frequencies above 1% (c.1811 + 1.6kbA > G, p.L206W, p.Q890X and p.R1066C), were undetected by these panels (Table 1). Login to comment
84 Comparing this mutation update with our previous report (Casals et al. 1997), we observed that some mild mutations, c.2789 + 5G > A and p.L206W, should now be considered as common mutations (relative frequency >1%). Login to comment
105 Our impression is that Table 3 Common CF mutations identified in this study and in several Latin American populations Mutation This study Hispanic1 Mexico2 Colombia3 Brazil4 Argentina5 Chile6 p.F508del 51.7 51.6 40.7 41.8 48.4 58.6 45.0 p.G542X 7.7 4.0 6.2 3.8 8.8 4.1 7.0 p.N1303K 2.9 0.8 2.0 0.5 2.5 2.7 - c.1811 + 1,6kbA > G 1.8 - - 6.5 - 0.9 - p.R334W 1.8 1.6 - 0.5 2.5 1.1 2.0 p.L206W 1.6 - - - 0.6 - - c.711 + 1G > T 1.6 - - - - - - p.Q890X 1.4 - - - - - - p.R1162X 1.3 0.8 - 1.1 2.5 0.4 2.0 c.2789 + 5G > A 1.2 - - 0.5 0.3 0.7 - p.R1066C 1.2 1.6 - 0.5 - 0.2 - p.I507del 1.0 - 2.6 - - 0.7 - c.2183AA > G 0.8 - 1.0 - 0.2 - p.G85E 0.7 0.8 0.5 - 1.3 0.7 - p.W1282X 0.7 0.8 - 1.1 1.3 2.7 5.0 c.3849 + 10kbC > T 0.4 4.0 0.5 - - 0.9 3.0 p.S549N - 2.4 2.6 - - - - c.3120 + 1G > A - 1.6 - 0.5 - - - c.3876delA - 5.6 - - - - - c.406-1G > A - 1.6 1.5 - - - - c.935delA - 1.6 1.0 - - - - p.R75X - 0.8 1.5 - - - - c.2055del9 - - 1.0 - - - - p.I506T - - 1.0 - - - - c.3199del6 - - 1.0 - - - - p.S549R 0.4 - - 2.2 - 0.2 - c.1717-1G > A 0.2 - - - 0.3 1.1 - p.G551D 0.2 0.8 0.5 - - - 1.0 p.R553X 0.4 - 0.5 - 0.6 0.2 1.0 No. Login to comment

PMID: 17440499 [PubMed] Keymolen K et al: "Clinical outcome of preimplantation genetic diagnosis for cystic fibrosis: the Brussels' experience."

No. Sentence Comment

69 2 p.F508del/- p.N1303K/- 1 p.Q493X/- p.F508del/- 1 p.F508del/- p.R1162X/- 1 p.4218insT/- p.N1303K/- 1 p.G673X/- p.F508del/- 1 p.W1282X/- p.G542X/- 1 p.F508del/- p.W1282X/- 1 p.W1282X/- p.F508del/- 2 p.F508del/- p.G551D/- 1 p.D1168G/- p.L206W/- 1 If we express these results per cycle with oocyte retrieval, this means that in each cycle there was an average of 12.5 COCs, giving 5.1 embryos to be biopsied with an 80% chance of having an embryo transfer and a 22.2% chance of having an ongoing pregnancy with the delivery of a child. Login to comment

PMID: 20607857 [PubMed] Bareil C et al: "UMD-CFTR: a database dedicated to CF and CFTR-related disorders."

No. Sentence Comment

15 Several sequence changes initially reported as causing disease have subsequently been reported to be neutral sequence variants (a typical illustration is the variant p.Ile148Thr) [Claustres et al., 2004; Rohlfs et al., 2004] or mutations with reduced penetrance (only some patients will develop CF or CFTR-related disorder; example: p.Arg117His) [Kiesewetter et al., 1993; Rosenstein and Cutting, 1998; Thauvin-Robinet et al., 2009] or mutations with variable expressivity (some patients develop mild rather than severe symptoms; examples include p.Leu206Trp [Desgeorges et al., 1995; Rozen et al., 1995] or p.Asp1152His [Burgel et al., 2010; Mussaffi et al., 2006]). Login to comment

PMID: 19236881 [PubMed] Enquist K et al: "Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein."

No. Sentence Comment

113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment

PMID: 22859523 [PubMed] Quinton P et al: "beta-Adrenergic Sweat Secretion as a Diagnostic Test for Cystic Fibrosis."

No. Sentence Comment

42 DIAGNOSTIC CHARACTERISTICS OF PARTICIPANTS IN THE VALIDATION COHORT Group Age (yr) Sex Genotype Sweat Cl2 (mmol/L) Cholinergic b-Adrenergic Ratio b/Chol Healthy 38 M 2/2 15 64.45 72.79 1.13 Healthy 39 M 2/2 18 81.61 86.08 1.05 Healthy 54 F 2/2 29 48.90 47.30 0.97 Healthy 64 F 2/2 28 50.64 57.54 1.14 Healthy 54 F 2/2 11 68.63 52.30 0.76 Hetero. 64 M F508del/2 16 68.21 36.78 0.54 Hetero. 56 M F508del/2 53 82.44 59.57 0.72 Hetero. 27 F F508del/2 11 78.30 46.30 0.59 Hetero. 29 F F508del/2 16 65.63 26.13 0.40 Hetero. 51 F G551D/2 62 39.13 16.50 0.42 CFTR-RD CBAVD 41 M W1282X/5T 55 84.61 20.69 20.01 CFTR-RD CBAVD 52 M F508del/R117H (7T) 57 70.39 20.61 20.01 CFTR-RD CBAVD 41 M F508del/5T 40 68.00 22.29 20.03 CFTR-RD CBAVD 47 M G551D/R117H (7T) 57 65.93 10.08 0.15 CFTR-RD CBAVD 40 M L206W/W216C 42 67.80 17.00 0.25 CFTR-RD CBAVD 26 M 36599delC15T/7T 55 91.55 0.18 0.00 CFTR-RD Sinopulm 65 F F508del/c.876-9_876-6delGATT 51 74.30 32.20 0.43 CFTR-RD Sinopulm 39 F R764X/2 12 24.64 3.49 0.14 CFTR-RD Sinopulm 17 F 5T/2 50 52.95 14.24 0.27 CFPS 21 M F508del/2 97 46.19 0.56 0.01 CFPS 33 M F508del/3849110kbC.T 50 76.22 22.94 20.04 CFPS 58 M 71111G.T/A455E 72 70.19 23.06 20.04 CFPS 41 M G551D/3849110kbC.T 88 87.37 0.08 0.00 CFPS 54 F F508del/R117C 59 36.74 1.06 0.03 CFPS 23 F F508del/A455E 82 64.85 3.46 0.05 CFPS 30 F D1152H/D1152H 31 41.52 23.54 20.09 CFPS 55 F G551D/2 99 67.62 21.78 20.03 CFPS 42 F F508del/1002-2A.G 94 27.64 2.63 0.10 CFPS 46 F 3849110kbC.T/3849110kbC.T 53 24.43 21.16 20.05 CFPS 14 F R1162X/3849110kbC.T 46 50.19 20.49 20.01 CFPI 32 M F508del/F508del 108 73.93 1.41 0.02 CFPI 28 M F508del/F508del 84 95.13 3.45 0.04 CFPI 24 F F508del/F508del 109 60.48 4.06 0.07 CFPI 34 F F508del/F508del 115 79.24 0.99 0.01 CFPI 35 F F508del/F508del 87 79.79 23.02 20.04 CFPI 44 F F508del/F508del 112 80.60 1.23 0.02 CFPI 23 F F508del/G551D 90 45.80 0.80 0.02 Definition of abbreviations: CBAVD ¼ congenital bilateral absence of vas deference; CF ¼ cystic fibrosis; CFPI ¼ pancreatic-insufficient patients with CF; CFPS ¼ pancreatic-sufficient patients with CF; CFTR ¼ CF transmembrane regulator; CFTR-RD ¼ CFTR-related disorder; hetero ¼ heterozygotes; sinopulm ¼ chronic sinopulmonary disease. Login to comment
82 Four men with congenital bilateral absence of vas deference (CBAVD) (W1282X/5T, F508del/R117H [7T], F508del/5T, and 36599delC17T/5T) showed no b-adrenergic secretory response; one woman with chronic sinopulmonary disease (F508del/c.876-9_876-6delGATT) responded comparably with heterozygotes; two men with CBAVD (G551D/ R117H and L206W/W216C) and two women with chronic sinopulmonary disease (5T/2 and R764X/2) demonstrated b-adrenergic sweat secretion that was reduced compared with heterozygotes (Figure 3A, Table 1). Login to comment
43 DIAGNOSTIC CHARACTERISTICS OF PARTICIPANTS IN THE VALIDATION COHORT Group Age (yr) Sex Genotype Sweat Cl2 (mmol/L) Cholinergic b-Adrenergic Ratio b/Chol Healthy 38 M 2/2 15 64.45 72.79 1.13 Healthy 39 M 2/2 18 81.61 86.08 1.05 Healthy 54 F 2/2 29 48.90 47.30 0.97 Healthy 64 F 2/2 28 50.64 57.54 1.14 Healthy 54 F 2/2 11 68.63 52.30 0.76 Hetero. 64 M F508del/2 16 68.21 36.78 0.54 Hetero. 56 M F508del/2 53 82.44 59.57 0.72 Hetero. 27 F F508del/2 11 78.30 46.30 0.59 Hetero. 29 F F508del/2 16 65.63 26.13 0.40 Hetero. 51 F G551D/2 62 39.13 16.50 0.42 CFTR-RD CBAVD 41 M W1282X/5T 55 84.61 20.69 20.01 CFTR-RD CBAVD 52 M F508del/R117H (7T) 57 70.39 20.61 20.01 CFTR-RD CBAVD 41 M F508del/5T 40 68.00 22.29 20.03 CFTR-RD CBAVD 47 M G551D/R117H (7T) 57 65.93 10.08 0.15 CFTR-RD CBAVD 40 M L206W/W216C 42 67.80 17.00 0.25 CFTR-RD CBAVD 26 M 36599delC15T/7T 55 91.55 0.18 0.00 CFTR-RD Sinopulm 65 F F508del/c.876-9_876-6delGATT 51 74.30 32.20 0.43 CFTR-RD Sinopulm 39 F R764X/2 12 24.64 3.49 0.14 CFTR-RD Sinopulm 17 F 5T/2 50 52.95 14.24 0.27 CFPS 21 M F508del/2 97 46.19 0.56 0.01 CFPS 33 M F508del/3849110kbC.T 50 76.22 22.94 20.04 CFPS 58 M 71111G.T/A455E 72 70.19 23.06 20.04 CFPS 41 M G551D/3849110kbC.T 88 87.37 0.08 0.00 CFPS 54 F F508del/R117C 59 36.74 1.06 0.03 CFPS 23 F F508del/A455E 82 64.85 3.46 0.05 CFPS 30 F D1152H/D1152H 31 41.52 23.54 20.09 CFPS 55 F G551D/2 99 67.62 21.78 20.03 CFPS 42 F F508del/1002-2A.G 94 27.64 2.63 0.10 CFPS 46 F 3849110kbC.T/3849110kbC.T 53 24.43 21.16 20.05 CFPS 14 F R1162X/3849110kbC.T 46 50.19 20.49 20.01 CFPI 32 M F508del/F508del 108 73.93 1.41 0.02 CFPI 28 M F508del/F508del 84 95.13 3.45 0.04 CFPI 24 F F508del/F508del 109 60.48 4.06 0.07 CFPI 34 F F508del/F508del 115 79.24 0.99 0.01 CFPI 35 F F508del/F508del 87 79.79 23.02 20.04 CFPI 44 F F508del/F508del 112 80.60 1.23 0.02 CFPI 23 F F508del/G551D 90 45.80 0.80 0.02 Definition of abbreviations: CBAVD &#bc; congenital bilateral absence of vas deference; CF &#bc; cystic fibrosis; CFPI &#bc; pancreatic-insufficient patients with CF; CFPS &#bc; pancreatic-sufficient patients with CF; CFTR &#bc; CF transmembrane regulator; CFTR-RD &#bc; CFTR-related disorder; hetero &#bc; heterozygotes; sinopulm &#bc; chronic sinopulmonary disease. Login to comment
83 Four men with congenital bilateral absence of vas deference (CBAVD) (W1282X/5T, F508del/R117H [7T], F508del/5T, and 36599delC17T/5T) showed no b-adrenergic secretory response; one woman with chronic sinopulmonary disease (F508del/c.876-9_876-6delGATT) responded comparably with heterozygotes; two men with CBAVD (G551D/ R117H and L206W/W216C) and two women with chronic sinopulmonary disease (5T/2 and R764X/2) demonstrated b-adrenergic sweat secretion that was reduced compared with heterozygotes (Figure 3A, Table 1). Login to comment

PMID: 22390181 [PubMed] Grzegorczyk V et al: "Management of male infertility due to congenital bilateral absence of vas deferens should not ignore the diagnosis of cystic fibrosis."

No. Sentence Comment

49 Some genotypes had been described in patients with moderate or late CF, such as those with F508del/L206W, F508del/D1152H, F508del/A455E like in our patient. Login to comment

PMID: 22658665 [PubMed] Ooi CY et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis."

No. Sentence Comment

855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

PMID: 22581207 [PubMed] Krulisova V et al: "Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA."

No. Sentence Comment

81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

PMID: 22496330 [PubMed] Trinh NT et al: "Improvement of defective cystic fibrosis airway epithelial wound repair after CFTR rescue."

No. Sentence Comment

35 Primary human bronchial cells were isolated from CF homozygous F508/F508 lung transplants (median age 31 years, mean FEV1 23.6±2.1%) and non-CF donors, while primary human nasal cells were recovered after polypectomy procedures from non-CF and CF patients (with various genotypes, i.e. 2 homozygous F508/F508, 1 F508/A555E and 1 C621+1GT/P-L206W, median age 16 years, mean FEV1 of 81.6±14.2%), according to ethically-approved protocols. Login to comment

PMID: 21917531 [PubMed] Handschick M et al: "Frequency of the hyperactive W493R ENaC variant in carriers of a CFTR mutation."

No. Sentence Comment

53 A. Caucasians a F508del 378 2184delA 2 CFTRdele2,3(21 kb) 4 2789+5 G-A 1 R117H 1 I1005R 1 405+1 G-A 1 L1077P 1 H199Y 1 Y1092X 1 L206W 1 3601-111 G-C 1 R347P 3 3849+10 kb C-T 1 Q414X 1 3850-3 T-G 1 G551D 4 W1282X 1 R553X 8 N1303K 2 1717-1 G-A 1 4374+1 G-T 1 2143delT 1 Unknown 9 B. Turks K68N 1 1525-1 G-A 1 G85E 1 F508del 2 E92K 1 1677delTA 1 CFTRdele2(ins186) 2 2184delA 1 CFTRdele2,3(21 kb) 2 3601-2 A-G 1 435insA 1 Unknown 1 a The subjects were born in Austria (N=9 subjects), Belgium (2), France (4), Germany (374), Greece (4), Italy (12), The Netherlands (7), Poland (2), Spain (5), Sweden (2) and United Kingdom (5). Login to comment

PMID: 23082198 [PubMed] Sousa M et al: "Measurements of CFTR-Mediated Cl(-) Secretion in Human Rectal Biopsies Constitute a Robust Biomarker for Cystic Fibrosis Diagnosis and Prognosis."

No. Sentence Comment

105 Functional classification of rarer mutations also results from these analyses, namely (Table S1): 3120+1G.A as class I (2 siblings with 3120+1G.A/R1066C, absence of CFTR-function and severe phenotypes); 1716+18672A.G as class V (2 other siblings with F508del/1716+18672A.G, residual CFTR function 228-34%- and mild CF); I618T as class IV (in a patient with G542X/I618T, 37% CFTR function and mild disease); and L206W as class IV or CFTR-RD mutation (in a patient with F508del/L206W and the highest CFTR function 257%- and very mild disease). Login to comment
209 Rectal biopsies from (A) Non-CF individual showing large cholinergic (carbachol, CCH, 100 mM, basolateral) and cAMP-dependent (3-isobutyl-1-methylxantine, IBMX, 100 mM, and forskolin, Fsk, 2 mM, basolateral) Chloride (Cl2 ) secretion (lumen-negative responses); (B) CF patient homozygous for F508del-CFTR mutation with absence of Cl2 secretion (only lumen-positive responses, reflecting potassium (K+ ) secretion, were observed); (C) CF patient (genotype: F508del/G85E-CFTR) showing very little (,12%) cAMP-dependent Cl2 secretion (biphasic responses observed upon co-cholinergic stimulation with CCH); and (D) CF patient (genotype: 3120+1G.A/L206W-CFTR) presenting larger CFTR residual function (,57%) and milder phenotype than in (C). Login to comment
208 Rectal biopsies from (A) Non-CF individual showing large cholinergic (carbachol, CCH, 100 mM, basolateral) and cAMP-dependent (3-isobutyl-1-methylxantine, IBMX, 100 mM, and forskolin, Fsk, 2 mM, basolateral) Chloride (Cl2 ) secretion (lumen-negative responses); (B) CF patient homozygous for F508del-CFTR mutation with absence of Cl2 secretion (only lumen-positive responses, reflecting potassium (K+ ) secretion, were observed); (C) CF patient (genotype: F508del/G85E-CFTR) showing very little (,12%) cAMP-dependent Cl2 secretion (biphasic responses observed upon co-cholinergic stimulation with CCH); and (D) CF patient (genotype: 3120+1G.A/L206W-CFTR) presenting larger CFTR residual function (,57%) and milder phenotype than in (C). Login to comment

PMID: 18687795 [PubMed] Audrezet MP et al: "Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene."

No. Sentence Comment

51 Sequences of the Primers Used for CFTR Analysis by HRM, GC Size, Amplicon Length, Number of Positive Controls Validated for Each Exon, and Positive Controls for Routine Analysis Exon Primer Sequences GC length Amplicon length (bp) Introns Number of heterozygous- positive controls Number of homozygous- positive controls Recommended control 1 LSCFE1Fmod 5Ј-CCGCCGCCGTTGAGCGGCAGGCACC-3Ј 8 200 bp 74 4 125GϾC LSCFE1Rmod 5Ј-CCGCCGCCGGCACGTGTCTTT CCGAAGCT-3Ј 8 19 M1I 2 2i5b 5Ј-CAAATCTGTATGGAGACC-3Ј 0 194 bp 39 5 R31C 2i3Љ 5Ј-CAACTAAACAATGTACATGAAC-3Ј 0 4 296ϩ1GϾT 3 LSCFe3Fmod LSCFe3Rmod 5Ј-CGCCGTTAAGGGAAATAGGACAA CTAAAATA-3Ј 5 276 bp 44 10 2 R75Q 5Ј-CCGCCGATTCACCAGATTTCGTAGTC-3Ј 6 66 G85V 4 LSCFe4FmodC 5Ј-CCGCCGCCGCCCGTGTTGAAATT CTCAGGGT-3Ј 12 361 bp 52 14 1 R117H LSCFe4RmodC 5Ј-CCGCCGCCCACATGTACGATAC AGAATATATGTGCC-3Ј 9 26 574delA 5 LSCFE5Fmod 5Ј-CCGCCGGTTGAAATTATCTAACTTTCC-3Ј 6 201 bp 13 8 624delT LSCFE5Rmod 5Ј-CCGAACTCCGCCTTTCCAGTTGT-3Ј 3 48 711ϩ1GϾT 6a LSCF6aFmod2 5Ј-CCGCCGGGGTGGAAGAT ACAATGACACCTG-3Ј 5 317 bp 25 8 C225X LSCF6aRmod2 5Ј-CCGCCGCCGCGATGCATAGAG CAGTCCTGGTT-3Ј 11 66 L206W 6b LSCFE6bFmod 5Ј-CGCGCCGCCGGATTTAC AGAGATCAGAGAG-3Ј 10 239 bp 0 2 1 R258G LSCFE6Brmod 5Ј-CCGCCGCCGAGGTGGA GTCTACCATGA-3Ј 8 66 1001ϩ11CϾT 7 LSCFE7Fmod2 5Ј-CCGCCGCCCTCTCCCTGAATTT TATTGTTATTGTTT-3Ј 13 326 bp 7 11 1078delT LSCFE7Rmod2 5Ј-CCCGCCGCCCTATAATGCAG CATTATGGT-3Ј 10 7 1248ϩ1GϾT 8 LSCFE8Fmod 5Ј-CCGGAATGCATTAATGCTAT TCTGATTC-3Ј 4 199 bp 32 7 W401X LSCFE8Rmod 5Ј-CCCGCAGTTAGGTGTTTAG AGCAAACAA-3Ј 4 18 1249-5AϾG 9 LSCFe9Fmod2 5Ј-CCGCCGCCGGGAATTATTTGAGAA AGCAAAACA-3Ј 8 279 bp 0 3 D443Y LSCFe9Rmod2 5Ј-CCGCCGCGAAAATACCTTCCAG CACTACAAACTAGAAA-3Ј 8 57 A455E 10 LSCF10FmodD 5Ј-CGCCGTTATGGGAGAACTGG AGCCTTCAGAG-3Ј 5 275 bp 0 15 1 F508del LSCF10RmodD 5Ј-CCGCAGACTAACCGATTGAAT ATGGAGCC-3Ј 4 68 E528E 11 h11i5 5Ј-TGCCTTTCAAATTCAGATTGAGC-3Ј 0 197 bp 42 13 2 G542X 11i3ter 5Ј-ACAGCAAATGCTTGCTAGACC-3Ј 0 17 G551D 12 LSCFE12Fmod 5Ј-CGCGTCATCTACACTAGATGACCAG-3Ј 4 244 bp 43 15 G576A 1898 ϩ 1GϾALSCFE12Rmod 5Ј-CCGGAGGTAAAATGCAATCTATGATG-3Ј 3 63 13 LSCF13AFmod 5Ј-CCGCCGCCGGAGACATATTG CAATAAAGTAT-3Ј 9 38 20 I601F LSCF13ARmod 5Ј-GCCTGTCCAGGAGACAGGA GCATCTC-3Ј 2 R668C LSCF13BFmod 5Ј-CCGCCGCAATCCTAACTGAG ACCTTACACCG-3Ј 2 R668C LSCF13BRmod 5Ј-CCGCCGATCAGGTTCAGGA CAGACTGC-3Ј 3 346 bp 2184insA LSCF13CFmod 5Ј-CCGCGGTGATCAGCACTGGCCC-3Ј 6 301 bp 77 L749L LSCF13CRmod 5Ј-CCGCGCGCGCGGCCAGTTTCTTG AGATAACCTTCT-3Ј 13 259 bp V754M LSCF13DFmod 5Ј-CGTGTCACTGGCCCCTCAGGC-3Ј 1 221 bp I807M LSCF13DRmof 5Ј-CCGCCGCCGCTAATCCTATGA TTTTAGTAAAT-3Ј 9 220 bp 2622ϩ1GϾA LSCf13FFmod 5Ј-CGCGGTGCAGAAAGAAGAAAT TCAATCCTAACTG-3Ј 4 R668C LSCF13FRmod 5Ј-CCGCCGTGCCATTCATTTGT AAGGGAGTCT-3Ј 6 2184insA 14a LSCF14aFmodB 5Ј-CCGACCACAATGGTGGCAT GAAACTG-3Ј 3 239 bp 35 7 1 T854T LSCF14aRmodB 5Ј-CCGCCGACTTTAAATCCAGTAAT ACTTTACAATAGAACA-3Ј 6 7 W846X 14b LSCF14bFmod 5Ј-CCGGAGGAATAGGTGAAGAT-3Ј 2 179 bp 38 4 2752-5GϾT LSCF14bRmodb 5Ј-CCGTACATACAAACATAGTGGATT-3Ј 3 59 2789ϩ5GϾT 15 LSCFE15Fmod 5Ј-CGCGCCGTGTATTGGAAA TTCAGTAAGTAACTTTGG-3Ј 7 412 bp 33 16 T908S LSCFE15Rmod 5Ј-CCGCAGCCAGCACTGCCAT TAGAAA-3Ј 4 68 S945L (table continues) phisms that we have chosen to exclude. Login to comment

PMID: 18456578 [PubMed] Castellani C et al: "Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice."

No. Sentence Comment

1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

PMID: 15858154 [PubMed] Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."

No. Sentence Comment

76 Other than ⌬F508 itself and I1027T, typically occurring in cis-, only two individual mutations, W1204X and L206W, were observed with ⌬F508 more than once (twice each) in this study. Login to comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment

PMID: 15698946 [PubMed] des Georges M et al: "High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France."

No. Sentence Comment

68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment

PMID: 12454843 [PubMed] Durno C et al: "Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis."

No. Sentence Comment

105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

102 Distribution of 310 CF Mutations in France With Respect to Relative Frequencies (Total Number of CF Chromosomes = 7,420) Group Mutations Number of alleles % Cum. % A F508del 4,985 67.18 G542X 212 2.86 N1303K 156 2.10 73.45 1717-1G>A 97 1.31 B G551D 73 0.98 2789+5G>A 72 0.97 W1282X 68 0.91 R553X 66 0.89 I507del 52 0.70 1078delT 49 0.66 7.47 2183AA>G 48 0.64 711+1G>T 33 0.44 R1162X 33 0.44 Y1092X 30 0.40 3849+10kbC>T 30 0.40 C 12 mutationsa 29 to 15 (239) 0.39-0.20 19 mutationsb 14 to 8 (190) 0.19-0.10 11 mutationsc 7 to 6 (71) 0.09-0.08 11 mutationsd 5 (55) 0.06 10.57 15 mutationse 4 (60) 0.05 23 mutationsf 3 (69) 0.04 50 mutationsg 2 (100) 0.02 D 154 mutationsh 1 (154) 0.01 2.07 6,942 93.56 a 3659delC, R347P, 3272-26A>G, R334W, W846X, 621+1G>T, G85E, R1066C, L206W, 394delTT, 4055+1G>A, R347H. Login to comment
153 Four mutations were detected on a 7T or a 9T background: L206W, R347H, D1152H, 3272-26A>G. Login to comment
171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele. Login to comment

PMID: 10445601 [PubMed] Danner I et al: "Respiratory epithelial ion transport in patients with disseminated bronchiectasis."

No. Sentence Comment

58 Age yrs Mutations Sweat chloride mEq.L-1 PI/PS Heart±Lung Transplantation 1 22 DF508/DF508 88 PI No 2 21 DF508/3659delC NA PI Yes 3 26 DF508/DF508 NA PI Yes 4 24 DF508/DF508 190 PI No 5 28 DF508/DF508 NA PI No 6 23 DF508/DF508 NA PI Yes 7 61 DF508/L206W 100 PS No PI: pancreatic insufficiency; PS: pancreatic sufficiency; NA: not available. Login to comment
116 This revealed DF508/L206W CFTR gene mutations. Login to comment
140 L206W mutations. Login to comment
141 The L206W mutation, located in exon 6a, is usually associated with a mild CF phenotype (bronchiectasis or CBAVD alone) or even asymptomatic presentations of CF [12, 13]. Login to comment
115 This revealed DF508/L206W CFTR gene mutations. Login to comment
139 L206W mutations. Login to comment

PMID: 10200050 [PubMed] de Meeus A et al: "Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online."

No. Sentence Comment

56 However, some genotypes (DF508/L206W, DF508/R347H, DF508/D1152H, DF508/R117H, W1282X/D1152H and even DF508/5T) can induce both CF and CBAVD phenotypes. Login to comment
83 Phenotype CFTRamutations Intron 8, Poly(T) tract 1 3 crisis of acute pancreatitis F508 / L206W 9/7 2 F508 / L206W 9/9 3 frequent bronchitis F508 / R347H 9/9 4 F508 / R347H 9/9 5 F508 / M244K 9/7 6 F508 / A1364V 9/7 7 F508 / D1152H 9/7 8 chronic sinusitis and bronchitis F508 / D1152H 9/7 9 F508 / R117H 9/7 10 F508 / R117H 9/7 11 F508 / M952I 9/7 12 D443Y / G542X 7/9 13 D443Y / G542X 7/9 14 2184delA / D443Y 7/7 15 2184delA / D443Y 7/7 16 R347H / D443Y 9/7 17 seminal vesicles agenesia R117H / G1349D 7/7 18 R117H / G1244E 7/7 19 N1303K / P111L 9/7 20 chronic sinusitis, nasal polyps W1282X / D1152H 7/7 21 chronic sinusitis R347H / Y1092X 7/7 22 seminal vesicles agnesia 297-3C-GTT / 4279insA 7/7 23 G544V / F508C 7/7 24 D1152H / 2896insAG 7-9 25 F508 / - 9/5 26 F508 / - 9/5 27 F508 / - 9/5 28 F508 / - 9/5 29 F508 / - 9/5 30 chronic sinusitis, bronchitis F508 / - 9/5 31 sinusitis and allergy F508 / - 9/5 32 allergy F508 / - 9/5 33 F508 / - 9/5 34 F508 / - 9/5 35 F508 / - 9/5 36 F508 / - 9/5 37 bronchitis, asthma F508 / - 9/5 38 chronic sinusitis F508+A1067T / - 9/5 39 chronic sinusitis D1152H / - 7/5 40 2184delA / - 7/5 41 R764X / - 7/5 42 711+1G-GTT / - 7/5 43 F508 / - 9/7 44 F508 / - 9/7 45 F508 / - 9/7 46 F508 / - 9/9 47 R553X / - 7/7 48 -33G-GTA / - 7/7 49 K710X / - 7/7 50 - / - 5/5 51 - / - 5/7 52 - / - 5/7 53 - / - 7/7 54 - / - 7/7 55 - / - 7/7 56 - / - 7/7 57 - / - 7/7 58 - / - 7/7 59 - / - 7/7 60 - / - 7/7 61 - / - 7/9 62 - / - 7/9 63 NIDDb - / - 7/9 64 - / - 7/9 a : Cystic Fibrosis Transmembrane Regulator gene b : Non Insulino-Dependant Diabetis References Anguiano A, Oates RD, Amos JA, Dean M, Gerrard B, Stewart C, Maher TA, White MB, Milunsky A (1992) Congenital absence of the vas deferens: a primarily genital form of cystic fibrosis. Login to comment

PMID: 9439669 [PubMed] Casals T et al: "High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes."

No. Sentence Comment

33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes. Login to comment

PMID: 9272157 [PubMed] Dork T et al: "Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens."

No. Sentence Comment

86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p. Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment

PMID: 9375855 [PubMed] Casals T et al: "Missense mutation R1066C in the second transmembrane domain of CFTR causes a severe cystic fibrosis phenotype: study of 19 heterozygous and 2 homozygous patients."

No. Sentence Comment

56 The current clinical data for missense mutations derived from a relatively large number of cases are limited to a few mutations: N1303K (Osborne et al., 1992; CF genotype-phenotype Consortium 1993), R117H (CF genotype-phenotype Consortium 1993), P205S (Chillón et al., 1993), A455E (Gan et al., 1995), L206W (Desgeorges et al., 1995), R334W (Estivill et al., 1995), and G85E (Vázquez et al., 1996). Login to comment

PMID: 8933333 [PubMed] Vazquez C et al: "Thirteen cystic fibrosis patients, 12 compound heterozygous and one homozygous for the missense mutation G85E: a pancreatic sufficiency/insufficiency mutation with variable clinical presentation."

No. Sentence Comment

97 10 Rozen R, Ferreira-Rajabi L,Robb L, Colman N. L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis. Login to comment
95 10 Rozen R, Ferreira-Rajabi L, Robb L, Colman N. L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis. Login to comment

PMID: 8956039 [PubMed] Hughes DJ et al: "Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes."

No. Sentence Comment

53 35%) PAGE (278) Kerem et al.. 1989AF508 G551D R117H R560T G542X 621+1G>T A1507 E60X 3659delC R553X 3120G>A 1l54insTC 2789+5G>A N1303K MlI(G>T) QW P67L 557delT 711+3A>G L206W R297Q V520F V562L Y563N Y917C R1162X 3849G>A 3849 +10kbC>T 3850-1GBA W1282X 280 21 17 12 9 9 7 3 2 1 68.0 5.1 4.1 2.9 2.2 2.2 1.7 0.7 0.5 0.24 17-32-13 (38;27%j 17-31-13(24,17%) 16-07-17 16-30-13 plus14 rare haplotypes (29) 16-07-17 23-33-13 (4) 22-31-13 (2) 21-31-13 17-07-17 (5) 16-31-13 16-35-13 17-58-13 17-35-13 16-07-17 17-07-17 23-29-13 (1) 23-31-13 (1) 16-07-17 16-31-13 16-07-17 15-29-13 16-33-13 16-07-17 17-07-17 16-07-17 16-07-17 16-30-13 16-32-17 17-31-13 16-31-14 16-46-13 16-30-14 17-07-17 DGGE(2) ' RD ASO's (11) DGGE(6) RD AR (8) DGGE (1) RD PAGE (5) DGGE (2) SEQ SEQ (2) DGGE (1) RD DGGE DGGE DGGE SEQ DGGE DGGE DGGE SEQ DGGE DGGE SEQ DGGE DGGE DGGE DGGE DGGE SEQ RD DGGE DGGE Cutting et al.. 1990 Dean et al.. 1990 Kerem et al., 1990 Kerem et al.. 1990 Zielenski et al., 1991 Kerem et al.. 1990 Malone et al., CFGAC Kerem et al., 1990 Cutting et al., 1990 Zielenski et al., CFGAC lannuzzi et al., 1991 Highsmith et al., 1990 Osborne et al., 1991 this study Savov et al., 1994 Hamosh et al., CFGAC Graham et al., 1992 Petreska et al., CFGAC Claustres et al., 1993 Graham et al., 1991 Jones et al.. 1992 this study Kerem et al.. 1990 Edkins & Creegan, CFGAC Gasparini et al., 1991 Cutting et al.. 1992 Highsmith et al., 1994 Audriizet et al., 1993 Vidaud et al., 1990 "Numbers in parentheses after the microsatellite haplotypes refer to the number of alleles haplotyped when not all of the available chromosomeswere typed. Login to comment
74 441delA, 557delT 711+1G>T, 711+3A>G H199Y, L206W 977insA R297Q 1078delT,R334W, 1154insTC, R347P W401X l46linsAGAT 1525- 1G>A, A1507, AI5071AF508. Login to comment

PMID: 8889582 [PubMed] Hughes D et al: "Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes."

No. Sentence Comment

74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI. Login to comment

PMID: 8522333 [PubMed] Desgeorges M et al: "Four adult patients with the missense mutation L206W and a mild cystic fibrosis phenotype."

No. Sentence Comment

0 Hum Genet (1995) 96:717-720 9 Springer-Verlag 1995 Marie Desgeorges 9 Michel Rodier 9 Michel Piot Jacques Demaille 9 Mireille Claustres Four adult patients with the missense mutation L206W and a mild cystic fibrosis phenotype Received: 28 February 1995 / Revised: 17 April 1995 Abstract We report molecular and clinical analyses in four unrelated patients with cystic fibrosis (CF) with compound heterozygosity for the L206W mutation in the cystic fibrosis transmembrane conductance regulator gene (CFTR). Login to comment
2 On the basis of the clinical features presented by the four patients, we postulate that the L206W might be associated with pancreatic sufficiency and residual transmembrane transport of chloride in lung. Login to comment
10 We had previously identified in our population one of the four missense mutations found in TM3, named L206W (Claustres et al. 1993). Login to comment
12 As clinical and genetic analysis of CF patients help in our understanding of the genotype-phenotype relations and of the physiopathology of CF, we report the clinical features of four patients who were found to carry the putative mild mutation L206W. Login to comment
14 Materials and methods Clinical report The genotypes and the main clinical features presented by the four patients heterozygous for L206W are summarized in Table 1. Login to comment
23 At 22 years of age, Table 1 Clinical and laboratory features of individuals with L206W P S V A Ethnicity Andalusia Southern France Southern France Southern France Genotype G524X/L206W AI507/L206W AF508/L206W AFS08/L206W lntron 8 9T/9T 7T/9T 9T/9T 9T/gT Haplotype :' 6-B/g-B 6-D/8-B 6-B/8-B 6-B/8-B Sex Male Male Female Female Age at diagnosis 22 years 34 years 15 years 5 years Current age~' 29 years (1966) 40 years (1955) 17 years (1978) 15 years (1980) Professional activity Bricklayer Seasonal country worker Student Student Circumstances of Hypokaliemia, Hypokaliemia, DNA study Chronic bronchitis diagnosis diffuse muscle cramps, diffuse muscle cramps, extracellular depletion extracellular depletion Sweat chloride (mmol/l) 58, 78, 60 71, 58, 51 180, 200 60, 62 Meconium ileus No No No No Growth retardation No No Yes No Pancreatic sufficiency Yes Yes Yes Enzyme supplemented Respiratory function Normal course Repetitive upper airway Asthma, allergy Mild symptoms infections during infancy Other Azoospermia, Azoospermia, Obstructive uropathy, bilateral aplasia of vas bilateral aplasia of vas renal cyst (right) deferens deferens, alcoholism, nicotine addiction ~'6 or 8 is the number of (gatt) copies in intron 6a, B or D is the haplotype defined by the extragenic markers KM 19 and XV-2c h Birth date in parentheses Fig. 1 Structure of the families 1.206W studied. Login to comment
24 Open symbols, and J~ 0 halJ:filled symbols, healthy individuals filled symbols, CF (cystic fibrosis) G542X G542X G542X G542X L206W 1.,206W AI507 S L206W L206W A1507 O L206W AF508 AF508 V #, g g g AF508 L206W L206W AF508 AF508 while working in the sun in the hot and arid climate of southern France, he presented with two severe acute dehydration episodes, with excessive sweating and salt crystals on the skin. Login to comment
41 As L206W creates an StyI site, a simple PCR restriction test was designed to screen DNAs for this mutation: a site was not found among 100 non-CF alleles (data not shown). Login to comment
47 Results and discussion In this paper we present four patients with the L206W mutation in one of their CFTR genes; this condition has not been described to date in other populations. Login to comment
48 The missense mutation L206W replaces a leucine by a tryptophan residue at position 206 in exon 6a, in the middle of the third transmembrane domain (TM3) of the CFTR molecule. Login to comment
49 Several arguments suggest that L206W is a CF allele and not a neutral sequence variation. Login to comment
53 The study of DNA polymorphic sites revealed that, in each case, L206W is associated with haplotype 1-2-1-2-2 defined by the bi-allelic markers (XV2c-KM19-M470V- T854T-J.311), and with haplotype 16-7-17 defined by the three intragenic microsatellites (IVS8CA-IVS17BTA- IVS 17BCA). Login to comment
54 Interestingly, L206W was found on a chromosome carrying eight copies of the (gatt) repeat in front of exon 6b; this has not been reported so far for other mutations. Login to comment
55 Since L206W is associated with a 9T allele in intron 8, it can be deduced that exon 9 is correctly spliced into the corresponding CFTR mRNA (Kiesewetter et al. 1993). Login to comment
56 In the light of previous studies on a genotype-phenotype correlation between CFTR mutations and pancreatic function in CF patients (Kristidis et al. 1992), the L206W mutation may be considered as a mild allele, as it confers a pancreatic sufficient phenotype to patients. Login to comment
60 Based on previous studies on missense mutations in the first membrane-spanning domain (Sheppard et al. 1993), it is tempting to speculate that L206W might affect the function of the channel pore, resulting only in a reduction of the amount of C1- current. Login to comment

PMID: 7739684 [PubMed] Chillon M et al: "Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens."

No. Sentence Comment

74 OF PATIENTS POLYT GENOTYPE† ⌬F508/R668C ⌬F508/D1152H ⌬F508/D1270N ⌬;F508/R75L ⌬F508/R117H ⌬F508/L206W ⌬F508/R258G ⌬F508/S1235R ⌬F508/R347H ⌬F508/R347H R117H/G1349D R117H/712-1G→T G149R/R668C R347H/R1066H R553X/R668C R1070W/2869insG ⌬F508/- G542X/- W1282X/- R334W/- K1060T/- R1162X/- N1303K/- A800G/- ⌬F508/- ⌬F508/- ⌬F508/- ⌬E115/- R117H/- R347H/- G542X/- R553X/- 1677delTA/- 2184delA/- 2789ϩ5G→Α/- S1235R/- W1282X/- -/- -/- -/- -/- 2 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 22 4 3 1 1 1 1 1 7 1 1 1 1 2 1 1 1 1 1 1 1 3 3 1 19 9T/7T 9T/7T 9T/7T 9T/7T 9T/7T 9T/9T 9T/7T 9T/7T 9T/7T 9T/9T 7T/7T 7T/9T 9T/7T 9T/7T 7T/7T 7T/7T 9T/5T 9T/5T 7T/5T 7T/5T 7T/5T 7T/5T 9T/5T 5T/5T 9T/7T 9T/9T 7T/7T 7T/7T 7T/7T 9T/7T 9T/7T 7T/7T 7T/7T 7T/7T 7T/7T 7T/9T 7T/7T 9T/5T 7T/5T 5T/5T 7T/7T -/- 3 7T/9T *Data were obtained from the Spanish population analyzed in this study. Login to comment

PMID: 7543317 [PubMed] Pignatti PF et al: "Increased incidence of cystic fibrosis gene mutations in adults with disseminated bronchiectasis."

No. Sentence Comment

31 List of CFTR gene mutations and DNA polymorphisms screened Mutations R75Q/X/L, G85E, 394deITT 457TAT->G, R117H 621 + 1G->T 711 + 5G->A L206W 875 + 40 A->G 936 del TA 1001 + 11C->T R334W, R347 P/H/L, 1154insTC A455E, V456F DF5O8 1717-IG->A, 1717-8G->A G542X, G551D, Q552X, R553X P574H 1898 + 3A->G 2183 AA->G, 2184delA, R709X D836Y, 2694 T/G 2752-22 A/G 2789 + 5 G->A, 2790-2 A-»G Q890X 3041-71 G/C 3132delTG 3271 + 18 C-»T, 3272-26 A->G H1054D, G1061R, R1066C/H, A1067T, H1085R, Y1092X, 3320 ins5 D1152H R1162X, 3667ins4, 3737delA, 11234V 3849 + 10 kb C-»T, 3850-1 G-»A SI25IN, S1255P, 3905insT, 3898insC, D127ON, W1282X, R1283M, 4002 A/G 4005 + 1 G-»A N1303 K/H, 4029 A/G D1377H Q1411 X 4404 C/T, 4521 G/A Location e 3 e 4 i 4 i 5 e 6a i 6a e 6b i 6b e 7 e 9 e 10 i 10 e 11 e 12 i 12 e 13 e 14a i 14a i 14b e 15 i 15 e 17a i 17a e 17b e 18 e 19 i 19 e 20 i 20 e2l e 22 e 23 e24 Listing is in order of location along the CFTR gene, e = exon; i = intron. Login to comment

PMID: 7532150 [PubMed] Casals T et al: "Extensive analysis of 40 infertile patients with congenital absence of the vas deferens: in 50% of cases only one CFTR allele could be detected."

No. Sentence Comment

9 Only three CBAVD patients were found with more than one CFFR mutation (AF508/L206W, AF508/R74W + D 1270N, R 117H/712-1G--~T), highlighting L206W, R74W/ T. Casals -M. Chill6n. Login to comment
59 Direct sequencing of these two abnormal fragments identified mutation R ll7H, a known Table 1 Semen analysis of patients with CAVD, given as the mean (range) CBAVD CUAVD (n = 27) (n = 10) Sperm (x 106/ml) 0 10.6 (0-90) Seminal volume (ml) 0.9 (0.2-3.1) 2.5 (0.4 5.4) pH 6.7 (6.0-8.0) 7.3 (6.4-7.7) Fructose (retool/l) 2.6 (0-9) 10.3 (3-) '~Citrate (mmol/l) 77.5 (11-188) 48.6 (36-88) ~Reference values: fructose, 8 28 retool/l; citrate, 10 35 retool/1 Table 2 CFTR mutation analysis in 30 CBAVD and 10 CUAVD patients (CBAVD congenital bilateral absence of the vas deferens, CUAVD congenital unilateral absence of the vas deferens, ND not determined, - absence of mutations, RRI recurrent respiratory infection, R rhinitis, RS rhino-sinusitis, BR.ASTH bronchitis asthmatic) Table 3 Congenital malformations associated with CAVD in 40 patients 207 Patient Age Phenotype Sweat test Mutation Other clinical (years) (mEq/l) features 1 37 CBAVD 108 1677delTA 2 28 CBAVD 50 G542X 3 28 CBAVD 118 - 4 33 CBAVD 90 AF508/L206W RRI, R 5 26 CBAVD 118 R117H/712-1G-+T 6 42 CBAVD 66 - RS 7 31 CBAVD 170 AF508 R 8 27 CBAVD 100 AF508/R74W + D1270N RRI, R 9 32 CBAVD 74 AE115 RS 10 35 CBAVD 90 - Nasal polyps 11 33 CBAVD 78 KI060T RI, family history 12 45 CBAVD 150 R334W RS 13 42 CBAVD 60 - 14 40 CBAVD 110 R 1070W RS 15 29 CBAVD 110 G542X 16 37 CBAVD 80 R117H RI, RS, BR.ASTH 17 37 CBAVD 85 - Asthma 18 46 CBAVD 15 R1162X 19 37 CBAVD 110 AF508 RS, diarrhoea 20 42 CBAVD 45 2789+5G--)A RI 21 49 CBAVD 95 AF508 22 36 CBAVD 70 AF508 RRI, RS 23 42 CBAVD 90 - 24 15 CBAVD 150 AF508 25 26 CBAVD 60 - 26 39 CBAVD 100 AF508 RRI, RS 27 33 CBAVD 57 AF508 RRI 28 33 CBAVD 80 G542X 29 34 CBAVD 78 - 30 32 CBAVD 113 G542X 31 33 CUAVD ND AF508 RS, pancreatitis 32 37 CUAVD ND - 33 31 CUAVD 77 - BR.ASTH 34 39 CUAVD ND - 35 40 CUAVD 40 - 36 33 CUAVD 59 - 37 40 CUAVD 90 - 38 47 CUAVD 40 - RRI 39 39 CUAVD 50 - 40 35 CUAVD 100 - No. Login to comment
83 The analysis of this specific mutation/haplotype association allowed us to identify mutations L206W (167-17), 712-1G-+T (23-31-13), R334W (17-46-13), and 2789 + 5G--->A (17-7-17), on one mutated chromosome each. Login to comment
96 One patient was heterozygous AF508/L206W and had recurrent pulmonary infection and rhinitis episodes from the age of 24. Login to comment
97 Our data on Spanish CF patients with the mutation L206W (Claustres et al. 1993) suggest that L206W is a mild mutation associated with a benign CF phenotype (T. Casals, unpublished). Login to comment

PMID: 7881429 [PubMed] Teng H et al: "Identification of seven rather infrequent and one novel CFTR mutation in the Belgian population."

No. Sentence Comment

6 Seven of these were described previously: R117H (2), G551D (3), R553X (3), 394delTT (4), L206W (4), G85E (5) and D1152H (6). Login to comment

PMID: 7521710 [PubMed] Ravnik-Glavac M et al: "Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene."

No. Sentence Comment

120 Exon 1: S4X (24), 186-13C-G (F£rec et al., pers. comm.); Exon 2: G27X (Shacldeton and Harris, pers. comm.), Q30X (Chilldn aal., pers. comm.), R31L (Zielenski et al., pers. comm.), Q39X (25); Exon 3: 300delA (Malone et al., pers. comm.), W57G (Ferrari et al., pers. comm.), W57X (26), E60X (Malone et al., pers. comm.), R74W (Claustres et al., pers. comm.), R75Q (27), G85E (28), 394delTT (Claustres et al., pers. comm.), L88X (Maceketal., pers. comm.), L88S (Malone et al., pers. comm.), 405 + 1G-A (Dork and Tummler, pers. comm.); Exon 4: E92K (Chillon et al., pers. comm.), E92X (D6rk a al., pers. comm.), P99L (Schwartz and Holmberg, pers. comm.), 441delA (Zielenski et al., pers. comm.), 444delA (29), 457TAT-C- (F£rec et al., pers. comm., (21), Dl 10H (14), Rl 17C (D6rk et al., pers. comm.), Rl 17H (14), A120T (Chillon et al., pers. comm.), 541delC (30), 556delA (28), I148T (Rininsland et al., pers. comm.), Q151X (Shacldeton et al., pers. comm.), 621 + 1C-T (28), 622-2A-C (31); Exon5:G178R (28), 681delC (Zielenski a al., pers. comm.), 711 + 1G-T (28); Exon 6a: H199Y (Dork and Tummler, pers. comm.), H199Q (Dean etal., pers. comm.), L206W (Claustres et al., pers. comm.), Q220X (Shacldeton and Harris, pers. comm., Schwartz and Holmberg, pers. comm.), 852del22 (32); Exon 6b: 977insA (33); Exon7:F311L(34). Login to comment

PMID: 7513293 [PubMed] Chillon M et al: "Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes."

No. Sentence Comment

41 A Exon 13 4 0.41 621-1 G--~T Intron 4 3 0.31 P205S Exon 6a 3 0.31 936 del TA Exon 6b 3 0.31 1949 del 84 Exon 13 3 0.31 K710X Exon 13 3 0.31 CF del #1 Exon 4-7/11-18 3 0.31 L206W Exon 6a 2 0.20 R347H Exon 7 2 0.20 Y1092X Exon 17b 2 0.20 Q1100P Exon 17b 2 0.20 Q30X Exon 2 1 0.10 E92K Exon 4 1 0.10 A120T Exon 4 1 0.10 I148T Exon 4 1 0.10 H199Y Exon 6a 1 0.10 1078 del T Exon 7 1 0.10 1717-1 G--+A Intron 10 1 0.10 T582R Exon 12 1 0.10 E585X Exon 12 1 0.10 1898+3 A~---G Intron 12 1 0.10 W1098X Exon 17b 1 0.10 R1158X Exon 19 1 0.10 3667 del 4 Exon 19 1 0.10 3860 ins 31 Exon 20 1 0.10 3905 ins T Exon 20 1 0.10 Unknown 212 21.81 The Basque subset The Basques have a different genetic background with respect to other ethnic groups (Pancorbo et al. 1989) as they are the only pre-Indoeuropean group in Spain. Login to comment

PMID: 7691344 [PubMed] Claustres M et al: "Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France."

No. Sentence Comment

26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment
38 L206W. Login to comment
66 The (gatt)^ repeats in intron 6a were found associated to L206W in the three unrelated patients carrying this mutation (Figure 5). Login to comment
72 As the sensitivity of SSCP in detecting point Sequence -T-G SSCP SSCP <*M L206W L206W Sequence (gatt) repeats intron 6a 6x 7x 8x / 6x 7x / 6x 7x / 7x intron 6a (gatt) repeats Figure 5. Login to comment
73 Single stranded conformatkmal and sequence analysis of both the mutation L206W in exon 6a and the sequence repeat (gatt) immediately preceding exon 6b. Login to comment
74 The familial segregations of L206W together with the (gatt) 8x repeats are shown in two unrelated pedigrees. Login to comment
75 The SSCP analysis of L206W has been performed on 385-bp PCR fragments; the (gatt) repeats have been analyzed after digestion of PCR fragments containing exon 6b by Ddel. Login to comment

PMID: 14685937 [PubMed] Groman JD et al: "Variation in a repeat sequence determines whether a common variant of the cystic fibrosis transmembrane conductance regulator gene is pathogenic or benign."

No. Sentence Comment

37 Each of the 98 patients with CBAVD had 5T with one of the following mutations: DF508 (78), G542X (6), N1303K (3), 711af9;1GrT (2), R1066C (2), R1162X (2), R764X (1), Y563X (1), H609R (1), L206W (1), or R334W (1). Login to comment

PMID: 16963320 [PubMed] Perez MM et al: "CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent."

No. Sentence Comment

42 Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene. Login to comment
46 of chromosomes analysed p.F508del p.G542X p.W1282X p.N1303K p.R1162X p.L6VÌe; p.W57X p.R75X p.G85E p.R117H p.H199Y p.V201M p.L206W p.Q220X p.V232D p.Y275XÌe; p.R334W p.R347P p.Y362XÌe; p.I506T Argentina 98 61 440 258 18 12 12 2 1 1 3 1 5 1 310 181 20 7 5 5 7 0 5 0 222 135 15 7 5 1 26 14 2 1 1 150 88 6 6 1 2 3 Subtotal and frequency (%) 1246 100 737 59.15 61 4.90 27 2.17 28 2.25 9 0.72 1 0.08 1 0.08 13 1.04 1 0.08 13 1.04 1 0.08 Brazil 468 221 26 11 74 38 2 1 320 155 28 3 8 8 4 1 2 1 1 8 122 62 120 38 10 3 148 38 4 0 0 48 15 154 75 5 1 0 2 0 386 154 24 6 10 17 9 0 10 1 18 4 0 0 2 0 0 0 0 Subtotal and frequency (%) 1858 100 800 43.06 99 5.33 11 0.59 34 1.83 25 1.35 13 0.70 1 0.05 2 0.11 1 0.05 1 0.05 20 1.07 1 0.05 Chile 72 21 36 11 3 0 44 22 4 3 1 1 100 45 7 5 0 2 0 2 0 Subtotal and frequency (%) 252 100 99 41.28 14 5.55 8 3.17 3 1.19 3 1.19 Colombia 184 77 7 2 1 2 1 34 13 2 1 1 Subtotal and frequency (%) 218 100 90 41.28 9 4.13 3 1.38 2 0.92 2 0.92 1 0.46 Costa Rica Frequency (%) 48 100 11 22.91 12 25.00 0 0 0 0 0 Cuba Frequency (%) 144 100 49 34.03 Ecuador 32 11 1 50 16 2 2 20 5 0 0 0 Subtotal and frequency (%) 102 100 32 31.37 2 1.96 1 0.98 2 1.96 Mexico 194 79 12 4 3 1 1 1 2 80 36 4 1 Subtotal and frequency (%) 274 100 115 41.97 16 5.84 5 1.82 3 1.09 1 0.36 1 0.36 1 0.36 2 0.73 Uruguay Frequency (%) 76 100 43 56.58 6 7.89 2 2.63 3 3.95 3 3.95 2 2.63 Venezuela 54 16 2 82 41 Subtotal and frequency (%) 136 100 57 41.91 2 1.47 Total 4354 2033 221 49 72 42 1 1 3 32 1 1 1 2 1 1 1 39 1 1 2 Frequency (%) 100 46.69 5.08 1.13 1.65 0.96 0.02 0.02 0.07 0.73 0.02 0.02 0.02 0.05 0.02 0.02 0.02 0.90 0.02 0.02 0.05 The five most frequent mutations are shown on the left-hand side, followed by the rest of the mutations in 5'-3' and exon-intron order. Login to comment
98 As an example, in the case of Argentina and Uruguay, the p.F508del mutation shows the highest frequencies (59% and Table 5 Mutations with frequencies less than 0.1% Panel A Mutation Number of chromosomes % Country p.R75X 3 0.07 Mexico c.W1089X 3 0.07 Argentina, Brazil c.406-1GNA 3 0.07 Mexico c.1898+1GNA 3 0.07 Argentina, Brazil c.2686_2687insTÌe; 3 0.07 Argentina, Brazil p.L206W 2 0.05 Brazil p.I506T 2 0.05 Mexico p.S589I 2 0.05 Argentina c.711+1GNT 2 0.05 Argentina c.935delA 2 0.05 Mexico c.2055_2063del 2 0.05 Mexico c.2347delG 2 0.05 Brazil c.2566_2567insTÌe; 2 0.05 Argentina c.2789+2_2789+3insA 2 0.05 Argentina c.3199_3204del 2 0.05 Mexico c.3272-26ANG 2 0.05 Argentina c.4016_4017insT 2 0.05 Argentina Panel B Mutation N % each Country p.L6VÌe;, p.W57X, p.Q220X, p.Y362XÌe;, p.I1027T, p.G1061R, p.R1283M, c.297-2ANG, c.1353_1354insTÌe;, c.1460_1461delATÌe;, c.1782delA, c.1898+3ANG, c.2184delA, c.2594_2595delGTÌe;, c.2869_2870insG, c.4005Ìe;1GNA, c.4005-1GNA# 17 0.02 Argentina p.R117H, p.H199Y, p.G551S, p.L558S, p.P750L, p.V754M, p.W1069X#, p.W1098CÌe;, p.W1204X, c.297-1GNAÌe;, c.846delTÌe;, c.1078delT, c.1716GNA, c.1924_1930del, c.4160_4161insGGGGÌe; 15 0.02 Mexico p.V201M, p.V232D, p.Y275XÌe;, p.R347P, p.R851L, p.Q1238X, c.3171delC, c.3617_3618delGAÌe;# 8 0.02 Brazil p.A559T, p.H609RÌe;, c.1215delG, c.1323_1324insAÌe;, c.2185_2186insC, c.3500-2ANGÌe;, c.3849+1GNA, 7 0.02 Colombia c.-834GNT 1 0.02 Uruguay The upper part (Panel A) shows the mutations found in more than one patient, whereas the lower part (Panel B) of the table shows all the mutations that are present only once in each country. Login to comment

PMID: 22043142 [PubMed] Lilley M et al: "Newborn screening for cystic fibrosis in Alberta: Two years of experience."

No. Sentence Comment

125 Predicted splice site mutation 14780 35 69 F508del R352W Rare, no clinical data published 17316 53/35 74 F508del L206W Variable, ranging from classic CF to isolated CBAVD (8) 16053 26/62 72 F508del 5T Associated with atypical CF and CBAVD (9) 21739 N/A 98 F508del G458V Associated with classic CF (17) 16229 31/32 62 F508del - N/A 16369 38/48 79 711+G࢐T - N/A 12468 NSQ/30 103 F508del - N/A 5T 5 thymine; CBAVD Congenital bilateral absence of the vas deferens; CF Cystic fibrosis; IRT Immunoreactive trypsinogen; N/A Not available; NSQ Not sufficient quantity or absent phenotype, individuals with the R117H mutation may be underdiagnosed and the mutation frequency may be under-represented. Login to comment
142 Three mutations (D110H, L206W and 5T) were identified that are associated with a mild or variable phenotype. Login to comment

PMID: 23261175 [PubMed] El-Seedy A et al: "Consequences of partial duplications of the human CFTR gene on cf diagnosis: mutations or ectopic variations."

No. Sentence Comment

39 He revealed the heterozygous presence of c.1521_1523delCTT (p.Phe508del, F508del) and c.617TNG (p.Leu206Trp, L206W) mutations (Bienvenue T, personal communication). Login to comment

PMID: 23378603 [PubMed] Thauvin-Robinet C et al: "CFTR p.Arg117His associated with CBAVD and other CFTR-related disorders."

No. Sentence Comment

126 (Leu206Trp);( Arg117His) p.Ser1235Arg 2000 2 ICSI cycles, no pregnancy Offer of donor sperm - CFTR-RD p. Login to comment

PMID: 23523379 [PubMed] Rechitsky S et al: "PGD for cystic fibrosis patients and couples at risk of an additional genetic disorder combined with 24-chromosome aneuploidy testing."

No. Sentence Comment

41 Mutation Region Legacy name cDNA name Protein name # of Patient Number of cycles Number of transfers Number of embryos transferred Pregnancy Birth 125G/C c.-8G>C NA Promoter 1 2 2 2 1 (1) 0 E60X c.178G>T p.Glu60X Exon 3 1 1 1 1 0 0 G85E c.254G>A p.Gly85Glu Exon 3 1 1 1 2 1 1 R75Q c.224G>A p.Arg75Gln Exon 3 1 1 1 1 1 1 R75X c.223C>T p.Arg75X Exon 3 1 1 1 2 1 2 A120T c.358G>A p.Ala120Thr Exon 4 1 1 1 1 0 0 R117C c.349C>T p.Arg117Cys Exon 4 2 6 3 5 1 1 R117H c.350G>A p.Arg117His Exon 4 14 22 19 38 8 6 621+1G-T c.489 &#b1; 1G>T - Intron 4 4 7 4 6 2 1 852del22 c.720_741 p.Gly241GlufsX13 Exon 6 1 1 0 0 0 0 L206W c.617T>G p.Leu206Trp Exon 6 1 2 1 2 0 0 A349V c.1046C>T p.Ala349Val Exon 8 1 2 2 4 2 4 1078delT c.948delT p.Phe316LeufsX12 Exon 8 1 1 1 1 1 0 1154ins-TC c.1022_1023insTC p.Phe342HisfsX28 Exon 8 1 2 1 2 0 0 Q359K/T360K c. Login to comment

PMID: 23791427 [PubMed] Jabr S et al: "Quantification of major urinary metabolites of PGE2 and PGD2 in cystic fibrosis: correlation with disease severity."

No. Sentence Comment

113 Mutations Mutation class Severity Number Pancreatic sufficiency (n) W128X/W128X I/I Severe 1 0 I507/Q890X I/I Severe 1 0 F508del/G542X II/I Severe 2 0 F508del/2188AA4G II/I Severe 1 0 F508del/N1303K II/I Severe 3 0 F508del/1677delTA II/I Severe 1 0 F508del/2188AA4G II/I Severe 1 0 F508del/F508del II/II Severe 10 0 F508del/Q890X II/II Severe 1 0 F508del/E1308X II/II Severe 1 0 F508del/5T-12TG II/III Moderate 2 0 G542X/G85V I/III Moderate 1 0 F508del/124del23kbp II/III Moderate 1 0 G542X/M1137V I/III Moderate 1 1 I507/L206W I/IV Mild 1 0 F508del/L206W I/IV Mild 4 2 711+1G4L206W I/IV Mild 1 1 N1303K/3272-26A4G I/IV Mild 1 1 F508del/F587I II/V Mild 1 1 n&#bc;Number. Login to comment

PMID: 23810505 [PubMed] Prach L et al: "Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California."

No. Sentence Comment

170 Participant 11 was identified with novel variant c.-448A>G in cis with p.A559T and in trans with p.L206W. Login to comment
182 Participant 11, who was diagnosed as having CF, also carries known mutation p.L206W (case described earlier). Login to comment

PMID: 23891399 [PubMed] Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."

No. Sentence Comment

44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
86 For example, the baseline level of chloride transport and ivacaftor response was higher for mutant CFTR forms associated with mild defects in CFTR processing (e.g., E56K, P67L, L206W, A455E, D579G, S945L, S977F, A1067T, R1070Q, R1070W, F1074L, and D1270N) than for those associated with severe defects in CFTR processing (e.g., F508del, H1054D, R1066H). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment

PMID: 23924900 [PubMed] Ren HY et al: "VX-809 corrects folding defects in cystic fibrosis transmembrane conductance regulator protein through action on membrane-spanning domain 1."

No. Sentence Comment

60 There are several CF-associated mutations in MSD1 that cause defects in CFTR processing and function: N-terminal tail (E56K and P67L), TM1 (E92K), TM2 (L206W), and TM4 (V232D) (Figure 4, A-E). Login to comment
61 The severe folding (Figure 4, A-B) and functional (Figure 4E) defects exhibited by E56L, P67L and L206W were completely corrected by 5 bc;M VX-809. Login to comment
194 (C-D): n = 3 &#b1; SE. _ _ _ _ + + + _ + E56K P67L E92K L206W Wt _ _ + V232D Wt -C- -BC- BTub- CFTR . Login to comment
196 D. E92K F508 -B C -B C VX-809 0 3 10 30 M CFTR CFTR B17 15 14 17 C0 25 66 95 B18 30 28 27 C 1 8 9 8 % Norm VX-809 0 3 10 30 M C-100 1 81 1 83 N.D. 24 5 78 100 N.D. 15 B14 4 6 4 7 1 1 6 12 16 3 2 C. B11 10 11 12 C 1 1 1 7 VX-809 0 3 10 30 M -B C F508 CFTR E92K % Norm % Norm E. VX-809 0 50 100 150 200 250 -10 -9 -8 -7 -6 -5 -4 Chloride Transport ( A/cm 2 ) VX-809 (Log M) E92K-CFTR Normal 0 50 100 150 200 250 DMSO VX-809 Corr-4a Chloride Transport ( A/cm2) E92K-CFTR 0 100 200 300 400 E56K P67L E92K L206W V232V dF508 I SC ( A/cm 2 ) DMSO VX-809 Normal VX-809 on MSD1 has potential to promote high-level functional correction of CFTR in people with CF who harbor mutations other than F508del (Bobadilla et al., 2002). Login to comment

PMID: 24357848 [PubMed] Zvereff VV et al: "Cystic fibrosis carrier screening in a North American population."

No. Sentence Comment

60 The variants D1152H (4.0%) and L206W (2.4%), each associated with a variable CF phenotype, were the most common variants not present on the ACMG/ACOG 23-mutation panel. Login to comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
86 Two variants, L206W and D1152H, accounted for 19.1% of the mutant alleles detected in this ethnic group. Login to comment
99 Several alleles not found on the ACMG/ACOG panel were found at relatively high frequency (Table 2), including D1152H (4.0%), L206W (2.4%), c.3744delA (0.9%), F311del (0.8%), R117C (0.7%), and S549N (0.6%). Login to comment
118 Two variants, D1152H and L206W, account for 19.1% of all mutations identified in the Hispanic group and deserve special attention. Login to comment
121 Strom et al.7 advocate against adding these variants to CF panels, stating that detection of D1152H and L206W during carrier screening may increase the rate of pregnancy termination among parents who fear having a child with classic CF, not to mention inflating the mutation detection rate among Hispanic Americans.7 It is acknowledged now in the literature that the D1152H variant belongs to both the CF-causing and CFTR-related disorder groups,19-21 and, in conjunction with an established CF-causing mutation, it could still manifest as typical CF.19,22 Burgel et al.23 studied 42 patients with D1152H mutations and reported that the variant, in conjunction with a CF-causing mutation, can cause significant pulmonary disease, albeit with longer survival. Login to comment
125 The same disagreement exists with regard to the L206W variant. Login to comment
126 Clain et al.25 analyzed 36 clinical cases of CF patients who were compound heterozygous for L206W and a severe CF mutation. Login to comment
128 Using clinical and functional studies, the group demonstrated that L206W is a disease-causing mutation with variable phenotype ranging from CF with pancreatic insufficiency to congenital bilateral absence of the vas deferens. Login to comment
129 Data from the CFTR2 project indicated that the L206W variant was observed in 82 CF patients worldwide and should be considered a disease-causing mutation.26 As such, we support this conclusion. Login to comment

PMID: 24517344 [PubMed] Raju SV et al: "Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis."

No. Sentence Comment

81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

PMID: 24631642 [PubMed] Fanen P et al: "Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies."

No. Sentence Comment

106 Depending on the mutation, one may observe either a partial reduction (p.Leu206Trp, third transmembrane segment) or a complete absence (p.Arg1066Cys, fourth intracellular loop or p.Phe508del, NBD1) of mature CFTR. Login to comment
111 Initially, mutations belonging to this class were thought to cause severe CF similarly to p.Phe508del or p.Arg1066Cys, but p.Leu206Trp was shown to be associated with variable phenotype (Clain et al., 2005a). Login to comment

PMID: 25042876 [PubMed] Sharma H et al: "Function, pharmacological correction and maturation of new Indian CFTR gene mutations."

No. Sentence Comment

116 Supporting this hypothesis is the fact that VX-809 has been shown to act on MSD1 folding and that it also rescues functional defects in CFTR caused by disease-related mutations in the vicinity of the three amino acids highlighted here (P67L, L206W) [16]. Login to comment

PMID: 25122143 [PubMed] Audrezet MP et al: "Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy."

No. Sentence Comment

81 Some molecular defects that could belong to either the CF-causing group or the CFTR-related disorders group (group A/B) were reported in patients presenting a broad spectrum of phenotypes from classic CF to mild monosymptomatic presentations.16 These are four missense mutations (p.Leu206Trp (L206W), p.Arg347His (R347H), p.Asp1152His (D1152H), and p.Ser945Leu (S945L)) and three splice mutations (c.2657+5G>A (2789+5G>A), c.3718-2477C>T (3849+10kbC>T), and c.1210-34TG(13);1210-12T(5) (TG13T5)). Login to comment

PMID: 25287046 [PubMed] Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."

No. Sentence Comment

348 In addition, L206W and H199Y are situated nearby P205S, orientated toward the lipid bilayer. Login to comment

PMID: 25443471 [PubMed] Marion H et al: "The p.Gly622Asp (G622D) mutation, frequently found in Reunion Island and in black populations, is associated with a wide spectrum of CF and CFTR-RD phenotypes."

No. Sentence Comment

99 Other CFTR mutations have been associated with a large spectrum of phenotypes, such as c.3454G N C, p.Asp1152His (D1152H), c.617T N G, p.Leu206Trp (L206W), c.579 + 3A N G (621 + 3A N G). Login to comment

PMID: 25674778 [PubMed] Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."

No. Sentence Comment

15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment
424 The three actually discrepant alleles were L997F (p.Leu997Phe), without the R117L (p.Arg117Leu) in cis, L206W (p.Leu206Trp) and T338I (p.Thr338Ile). Login to comment
426 The L206W (p.Leu206Trp), which in our study was classified as a CFTR-RD-causing mutation, was classified as CF-causing in the CFTR2 study. Login to comment

PMID: 25963003 [PubMed] Ooi CY et al: "Inconclusive diagnosis of cystic fibrosis after newborn screening."

No. Sentence Comment

108 TABLE 3 Characteristics of Subjects With CFSPID Who Later Met Diagnostic Criteria of CF Subject Number Allele 1 Allele 2 Ethnicity NBS IRT, mg/L Initial Sweat Chloride, mmol/L Highest Sweat Chloride, mmol/L Country 1 F508del R117C White 105.8 36 61 Canada 2 F508del S1455X White 66.6 46 74 Canada 3 F508del P67L White 151.2 38 38 Canada 4 F508del L206W White 83.8 58 64 Canada 5 G542X L206W White 67 49 66 Canada 6 F508del L206W White 59.9 45 45 Canada 7 R1162X R117H-7T White 126 36 70 Italy 8 2183AA.G R117C White 129 32 32 Italy 9 F508del R117C White 80.4 48 56 Canada e OOI et al including in newborn-screened infants with equivocal CF diagnosis and in older individuals with single-organ manifestations of CF.17,18,20-22 As in the case of the 7 subjects who were initially classified as CFSPID but who were subsequently recognized to carry 2 disease-causing mutations on the basis of the CFTR2 project, the diagnostic consequences (benign versus disease-causing) of the CFTR mutations identified in all of the other subjects with CFSPID may not be apparent until later on, when new genetic information becomes available and classification of CFTR mutations currently considered to be of "unknown" consequences is updated. Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment
92 Well known examples include missense variants D110H, R117C, L206W, R347P, R347H, R1066H, or splice variants that produce both aberrant and full-length transcript such as 3849+10kbC4T, 2789+5G4A, 3272-26 A4G, 711+3 A4G. Login to comment
126 Prenatal diagnosis, Preimplantation genetic diagnosis, offered to Parents of a CF patient Carrier couples identified through carrier testing Carrier couples identified through investigations for fetal bowel anomalies Couples with one individual affected with CF and a carrier partner Couples with one individual affected with CBAVD and a carrier partner Table 4 Inclusion and exclusion criteria for CF-PGD according to countries France Italy Spain Belgium Greece UK USA Parents 1 affected+1 carrier S/LS A A A A A A A 1 affected+1 carrier M R A A A A A A 1 affected+1 carrier U A A A A R Aਭ A 2 carriers S/LS A A A A A A A 1 carrier S/LS+1 carrier M R A A A A A A 1 carrier S/LS+1 carrier U A A A A R Aਭ A Abbreviations: S, severe CF-causing variant (p.Phe508del, p.Gly542ਭߪ); LS, large spectrum variant (p.Leu206Trp, c.2657+5G4A ߪ); M, mild variant with variable disease penetrance (IVS8-5 T allele, p.Arg117His-7 T ߪ); U, variants of unproven or uncertain CF clinical relevance (p.Pro1013His, p.Arg1162Leu ߪ); A, accepted; R, refused. Login to comment

PMID: 26087176 [PubMed] Dupuis A et al: "Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene."

No. Sentence Comment

63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment
109 While non-CFTR modifier genes as well as environmental factors largely influence the development and progression of lung disease and nutritional decline,33-36 we demonstrate that the severity of the underlying CFTR genotype Table 2ߒ Meconium ileus prevalence scores and CFTR function CFTR mutation MIP score CFTR function (%wt) High MIP score ߓ V520F 0.38 0.2 ߓ N1303K 0.25 0.5 ߓ F508del 0.27 0.4 ߓ R560T 0.27 0.1 ߓ A559T 0.24 0 ߓ G551D 0.15 1 ߓ G85E 0.14 0.8 ߓ R1066C 0.13 0 Low MIP score ߓ R347P 0.1 0 ߓ R117C 0.1 2.9 ߓ R117H 0.07 33 ߓ R347H 0.06 5 ߓ R334W 0.05 1.3 ߓ A455E 0.05 6 ߓ L206W 0.04 5 ߓ M1101K 0.04 0 ߓ P67L 0.0 8 The table compares meconium ileus prevalence (MIP) scores and measured cystic fibrosis transmembrane conductance regulator (CFTR) function in Fisher rat thyroid determined by VanGoor et al.24 for the major and missense cystic fibrosis-causing variants for which patient group size was ࣙ10 in at least the US group. Login to comment

PMID: 26500004 [PubMed] Pepermans X et al: "Identification and frequencies of cystic fibrosis mutations in central Argentina."

No. Sentence Comment

99 rs name HGVS p. name HGVS c. name Legacy name n (%) Screening panel CFTR1 database CFTR2 database rs199826652 p.Phe508del c.1521_1523delCTT F508del 94 (56.6) Yes Yes CF-causing rs113993959 p.Gly542* c.1624G N T G542X 7 (4.2) Yes Yes CF-causing No p.Asn1303Lys c.3909C N G N1303K 5 (3) Yes Yes CF-causing rs74767530 p.Arg1162* c.3484C N T R1162X 4 (2.4) Yes Yes CF-causing rs75961395 p.Gly85Glu c.254G N A G85E 3 (1.8) Yes Yes CF-causing rs78756941 NA c.489 + 1G N T 621 + 1G N T 3 (1.8) Yes Yes CF-causing rs76713772 NA c.1585-1G N A 1717-1G N A 3 (1.8) Yes Yes CF-causing No p.Lys684Serfs*38 c.2051_2052delAAinsG 2183AA N G 3 (1.8) Yes Yes CF-causing rs397508173 p.Ser4* c.11C N A S4X 2 (1.2) No Yes No rs121909011 p.Arg334Trp c.1000C N T R334W 2 (1.2) Yes Yes CF-causing rs77010898 p.Trp1282* c.3846G N A W1282X 2 (1.2) Yes Yes CF-causing rs397508141 p.Leu34_Gln39del c.100_117delTTGTCAGACATATACCAA 232del18 1 (0.6) No Yes No No p.Leu49Pro c.146 T N C L49P &#a7; 1 (0.6) No No No rs77834169 p.Arg117Cys c.349C N T R117C 1 (0.6) Yes Yes CF-causing No p.Arg117Pro c.350G N C R117P 1 (0.6) No Yes No rs80282562 p.Gly178Arg c.532G N A G178R 1 (0.6) Yes Yes CF-causing rs121908803 p.Pro205Ser c.613C N T P205S 1 (0.6) No Yes CF-causing rs121908752 p.Leu206Trp c.617 T N G L206W 1 (0.6) Yes Yes CF-causing No p.Arg347Pro c.1040G N C R347P 1 (0.6) Yes Yes CF-causing rs397508155 p.Tyr362* c.1086 T N A Y362X 1 (0.6) No Yes No rs74597325 p.Arg553* c.1657C N T R553X 1 (0.6) Yes Yes CF-causing rs1800098 + rs1800100 p.[Gly576Ala(;)Arg668Cys] c. Login to comment
126 Genotype N Frequency (%) Total N Total frequency (%) Category I: p.Phe508del/p.Phe508del p.Phe508del/p.Phe508del 30 36.1 30 36.1 Category II: p.Phe508del/Other p.Phe508del/p.Gly542* 5 6 p.Phe508del/p.Asn1303Lys 3 3.6 p.Phe508del/p.Gly85Glu 2 2.4 p.Phe508del/c.1585-1G N A 2 2.4 p.Phe508del/c.2051_2052delAAinsG 2 2.4 p.Phe508del/p.Trp1282* 2 2.4 p.Phe508del/p.Arg117Pro 1 1.2 p.Phe508del/p.Pro205Ser 1 1.2 p.Phe508del/p.Leu206Trp 1 1.2 p.Phe508del/p.Arg553* 1 1.2 p.Phe508del/p.Ser589Ile 1 1.2 p.Phe508del/p.Ser737Phe 1 1.2 p.Phe508del/p.Arg1162* 1 1.2 p.Phe508del/c.1766 + 1G N A 1 1.2 p.Phe508del/p.Leu34_Gln39del 1 1.2 p.Phe508del/p.Leu812Phefs*11 1 1.2 p.Phe508del/c.3140-26A N G 1 1.2 p.Phe508del/c.3873 + 1G N A 1 1.2 p.Phe508del/p.Ser1297Phefs*5 1 1.2 p.Phe508del/c.4242_4242 + 1delGGinsTT 1 1.2 p.Phe508del/c.489 + 1G N T 1 1.2 31 37.5 Category III: Other/other p.Gly542*/p.Asn1303Lys 1 1.2 p.Asn1303Lys/p.Gly85Glu 1 1.2 c.489 + 1G N T/p.Lys684Serfs*38 1 1.2 c.489 + 1G N T/p.Gly542* 1 1.2 p.Arg1162*/p.Ser4* 1 1.2 p.Arg1162*/p.Tyr362* 1 1.2 p.Arg334Trp/c.1585-1G N A 1 1.2 p.Arg334Trp/p.Ser821Argfs*4 1 1.2 p.Arg347Pro/p.Ser4* 1 1.2 c.2657 + 5G N A/p.Tyr852Leufs*44 # 1 1.2 p.Arg1162*/p.Leu49Pro # 1 1.2 11 13.2 Category IV: A single mutation p.Phe508del/WT 3 3.6 c.2988 + 1G N A/WT 1 1.2 p.Arg117Cys/WT 1 1.2 p.Gly178Arg/WT 1 1.2 p.[Gly576Ala(;)Arg668Cys]/TG11-5T 1 1.2 7 8.4 Category V: Wild type 4 4.8 #: new mutation submitted to CFTR1 database [1]; other = other mutation than p.Phe508del. Login to comment

PMID: 26574590 [PubMed] Kharrazi M et al: "Newborn Screening for Cystic Fibrosis in California."

No. Sentence Comment

124 [1210-12[5]];[1210-34TG[13]] (IVS 8 (TG)13-5T) 34 / c.1521_1523delCTT (F508del)/ c.933_935delCTT (F311del) 48 / c.1521_1523delCTT (F508del)/ c.1521_1523delCTT (F508del) 51 / c.1521_1523delCTT (F508del)/ c.1521_1523delCTT (F508del) 52 / (mutations not identified) 54 / c.1521_1523delCTT (F508del)/ c.1792_1798delAAAACTA (1924del7) 58 / c.303_304insA (435insA)/ c.617T.G (L206W) 2. Login to comment