ABCMdb

ABCC7 p.Ile148Thr

None has been submitted yet.

Publications

PMID: 10229049 [PubMed] Lecoq I et al: "Blood immunoreactive trypsinogen concentrations are genetically determined in healthy and cystic fibrosis newborns."

No. Sentence Comment

61 Twins or unrelated patients with identical genotype had very similar neonatal IRT concentrations: DF508/I148T (twins), 1040 and 1055 mg LÀ1 ; N1303K/G149R (twins), 1600 and 1725 mg LÀ1 ; DF508/E585X, 900 and 945 mg LÀ1 ; DF508/ G542X, 1535 and 1660 mg LÀ1 ; DF508/L206W, 980, 1090 and 1100 mg LÀ1 . Login to comment
72 In this study, CF newborns with one mutation in an exon encoding for either NBD1 or NBD2 (DF508, G542X, G551D, E585X, N1303K, etc.) and the other affecting one of the MSD (R117H, 574delA, I148T, G149R, L206W, etc.) had significantly lower IRT concentrations than CF neonates with both mutations located in NBD. Login to comment

PMID: 10325788 [PubMed] Sarles J et al: "Blood concentrations of pancreatitis associated protein in neonates: relevance to neonatal screening for cystic fibrosis."

No. Sentence Comment

77 Other genotypes were F508/G542X (n=4), F508/N1303K (n=2), F508/I148T (n=2), F508/R117H, F508/R553X, F508/1717-1G->A, F508/ 1078delT, F508/2789+5G->A, F508/ E1308X (a novel CFTR mutation), R553X/ 394delTT, and N1303K/R553X. Login to comment

PMID: 10388469 [PubMed] Castaldo G et al: "Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations."

No. Sentence Comment

36 All patients were first analyzed for eight CF mutations, i.e., ⌬F508, N1303K, G542X, W1282X, 1717-1G3A, R553X, 2183AA3G, and I148T (9). Login to comment
39 methods The eight CF mutations (i.e., ⌬F508, N1303K, G542X, W1282X, 1717-1G3A, R553X, 2183AA3G, and I148T) were identified with a semi-automated procedure based on a single multiplex PCR amplification followed by the allele-specific oligonucleotide (ASO) identification we described previously (9). Login to comment

PMID: 10439967 [PubMed] Liechti-Gallati S et al: "Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease."

No. Sentence Comment

20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T). Login to comment
34 Intron 19, all 27 exons and their exon-intron boundaries, including the 24 most common mutations worldwide (G85E, R117H, 621 + 1G- > T, 711 + 1G- > T, 1078delT, R334W, R347P, A455E, I507, F508, 1717-1G- > A, G542X, S549N, G551D, R553X, R560T, 1898 + 1G- > A, 2184delA, 2789 + 5G- > A, R1162X, 3659delC, 3849 + 10kbC- > T, W1282X, N1303K) (Cystic Fibrosis Genetic Analysis Consortium 1994), and the 15 most common mutations in our population (I148T, 1078delT, R334W, R347P, F508, 1717-1G- > A, G542X, R553X, 2347delG, D1152H, R1162X, 3849 + 10kbC- > T, 3905insT, W1282X, N1303K), were considered in this study. Login to comment
92 The technique developed demonstrates excellent single-strand separation and non-radioactive visualisation on polyacrylamide gels, and is time-saving and directly Table 2 Known mutations identified in 198 CF patients analysed investigatively Exon (E) Number of CFTR mutations intron (I) chromosomes Patient`s nationality Highest prevalence ∆F508 E10 212 miscellaneous 3905insT E20 025 Swiss Swiss, Amish, Arcadian R553X E11 020 Swiss, German German 1717-1G->A I10 017 Swiss, Italian Italian N1303K E21 011 Swiss, French, Italian Italian W1282X E20 014 Swiss, Italian, Israelit Jewish-Askhenazi G542X E11 009 Swiss, Spanish, Italian Spanish 2347delG E13 008 Swiss R1162X E19 006 Swiss, Italian, Russian Italian 3849+10kbC->T I19 005 German, French R347P E07 004 Swiss T5 I08 004 Swiss R334W E07 003 Swiss Q525X E10 003 Swiss 3732delA E19 003 Swiss S1235R E19 003 Italian, Turkish G85E E03 002 Italian, Greek I148T E04 002 Austrian, Turkish French-Canadian 621+1G->T I04 002 French French-Canadian 1078delT E07 002 Swiss E585X E12 002 Italian 2176insC E13 002 Swiss, Italian 2789+5G->A I14b 002 Italian Spanish D1152H E18 002 Swiss, French 4016insT E21 002 Turkish Q39X E02 001 Swiss 394delTT E03 001 Swiss Nordic, Finnish R117H E04 001 Swiss A120T E04 001 Swiss G126D E04 001 Swiss 711+5G->A I05 001 Russian M348K E07 001 Italian L568F E12 001 Italian 2183AA->G E13 001 Italian Italian K710X E13 001 Swiss S945L E15 001 French 3272-26A.->G I17a 001 Swiss M1101K E17b 001 Swiss Huttite 3601-17C->T I18 001 Swiss R1158X E19 001 Swiss 4005+1G-A I20 001 Italian applicable to early diagnostic testing, carrier detection and prenatal diagnosis. Login to comment

PMID: 10636451 [PubMed] Schaedel C et al: "Three common CFTR mutations should be included in a neonatal screening programme for cystic fibrosis in Sweden."

No. Sentence Comment

54 patients 1 S549I/S549I Lebanon I148T/unknown1 Turkey 1 711+3GA/ Italy G1244E R553X/G551D1 France 2 R553X/unknown Sweden, Germany 175insT/175insT Sweden2 R117H/unknown2 Sweden 3 Unknown/unknown Sweden, Syria, Turkey early intervention (1, 3). Login to comment

PMID: 10746558 [PubMed] Bombieri C et al: "A new approach for identifying non-pathogenic mutations. An analysis of the cystic fibrosis transmembrane regulator gene in normal individuals."

No. Sentence Comment

79 Out of the 20 missense mutations, three (G85E, ∆F508, and N1303K) are certainly CF-causing, and several (R31C, K68E, R75Q, I148T, V562L, G576A-R668C, L997F, F1052V, S1235R) have been described in congenital bilateral absence of the vas deferens, in disseminated bronchiectasis, in pancreatitis, or in atypical CF cases mutations as reported in the CFGAC website (). Login to comment
80 Many (13 out of 20) of the missense mutations change highly conserved (5/5 species analyzed) amino acid residues (R75Q, G85E, I148T, I506V, R668C, G622D, L997F, I1027T, F1052V, L1096R, I1131V, R1162L, N1303K); others affect amino acid residues conserved in 4/5 species (K68 E, R170H, M470V, V562L, S1235R), or in 3/5 species (R31C and G576A; Tucker et al. 1992). Login to comment
96 Moreover, 1525-61 A/G (i 9) and 3601-65 C/A (i 18) were detected by SSCA performed in the Spanish sample only (14/82 and 12/80, respectively); these mutations were not identifiable by DGGE as used in the present work The totals are: a378; b362; c380; d356 genes eCertainly a CF-causing mutations fThe most common allele at this site is (TTGA)7 gThe most common allele at this site is T7 hThe frequency shown is that of the M allele Mutation Position North-Central Southern Spain Total East Italy Italy France 82 genes 100 genes 100 genes 100 genes 382 genes % 125 G/C 5`UTR 1 2 7 3 13 3.4 R31C 2 1 1 1 0 3 0.8 K68E 3 1 0 0 0 1 0.3 R75Q 3 1 1 2 0 4 1.0 G85Ee 3 0 1 0 0 1 0.3 406-6 T/C i 3 0 0 1 0 1 0.3 I148T 4 1 0 0 0 1 0.3 621+3 A/G i 4 0 1 0 0 1 0.3 R170H 5 1 0 0 0 1 0.3 875+40 A/G i 6a 11 5 5 2 23 6.0 (TTGA)6 f i 6a 17 11 7 13 48 12.6 1341+28 C/T i 8 1 0 0 0 1 0.3 IVS8-6g T5 i 8 8 2 4 3/78 17a 4.5 IVS8-6g T9 i 8 10 7 10 11/78 38a 10.0 M470Vh 10 42 30 39 27 138 36.1 I506V 10 1 0 0 0 1 0.3 ∆F508e 10 1 0 2 0 3 0.8 1716 G/A 10 2 1 0 5 8 2.1 V562L 12 0 0 1 0 1 0.3 G576A 12 1 0/80 1 0 2b 0.6 G622D 13 0 0/80 1 0 1b 0.3 R668C 13 1 0/80 1 0 2b 0.6 2082 C/T 13 1 0/80 0 0 1b 0.3 2377 C/T 13 0 0/80 0 1 1b 0.3 2694 T/G i 14a 33 23 33 14/80 103c 27.1 2752-15 C/G i 14b 0 3 0 0 3 0.8 3041-71 G/C i 15 0 1 2 0 3 0.8 L997F 17a 0 2 0 0 2 0.5 I1027T 17a 1 0 0 0 1 0.3 F1052V 17b 1 0 0 0 1 0.3 L1096R 17b 0 0 1 0 1 0.3 3417 A/T 17b 1 0 1 0 2 0.5 I1131V 18 0 1 0 0 1 0.3 R1162L 19 0 1 0 0 1 0.3 3690 A/G 19 0 0 0 1/80 1c 0.3 S1235R 19 1 0 0 0 1 0.3 4002 A/G 20 2 3 3 3/80 11c 2.9 4005+28insA i 20 0 1 0 0 0.3 4029 A/G 21 1 0 0 0 1 0.3 N1303Ke 21 1 0 0 0 1 0.3 4404 C/T 24 1 0 1 0 2 0.5 4521 G/A 24 21 16 14/80 15/76 66d 18.5 Total 165 113 137 98 513 encountered in the present survey are possible. Login to comment

PMID: 10777364 [PubMed] Wang J et al: "A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients."

No. Sentence Comment

570 SYLVAIN R RIVARD* CHRISTIAN ALLARD† JEAN-PIERRE LEBLANC† MARCEL MILOT† GERVAIS AUBIN† FERNAND SIMARD† CLAUDE FÉREC‡ MARC DE BRAEKELEER†§¶ *Département des Sciences Fondamentales, Université du Québec à Chicoutimi, Canada Table 1 Distribution of cystic fibrosis patients diagnosed before the age of 5 by age groups in Saguenay-Lac-Saint-Jean, (A) by genotype, (B) by mutation 0-10 years 10.1-20 years Over 20 years All ages No % No % No % No % (A) Genotype F508/ F508 15 (1) 40.5 21 (2) 36.2 18 (3) 42.9 54 (6) 39.4 F508/621+1G→T 12 (1) 32.4 16 (1) 27.6 10 (1*) 23.8 38 (3*) 27.7 F508/A455E 1 2.7 6 10.3 5 11.9 12 8.8 F508/I148T 1 2.7 1 1.7 2 1.5 F508/Y1092X 3 (1) 5.2 1 2.4 4 (1) 2.9 F508/Q890X 1 2.4 1 0.7 F508/R1158X 1 2.4 1 0.7 621+1G→T/621+1G→T 2 (1) 5.4 4 6.9 1 2.4 7 (1) 5.1 621+1G→T/A455E 1 2.7 4 6.9 3 7.1 8 5.8 621+1G→T/711+1G→T 2 (1) 5.4 2 (1) 3.4 4 (2) 2.9 621+1G→T/Y1092X 1 2.7 1 0.7 621+1G→T/S489X 1 2.7 1 0.7 621+1G→T/G85E 1 (1) 1.7 1 (1) 2.4 2 (2) 1.5 A455E/R117C 1 2.7 1 0.7 N1303K/I148T 1 2.4 1 0.7 Total 37 58 42 137 Death (4) 10.8 (6) 10.3 (5*) 11.9 (15*) 10.9 (B) Mutation F508 16 (1) 43.2 25 (3) 43.1 21 (3) 51.2 62 (7) 45.6 621+1G→T 18 (3) 48.6 23 (3) 39.7 12 (2*) 29.3 53 (8*) 39.0 A455E 3 8.1 10 17.2 8 19.5 21 15.4 Total 37 58 41 136 Death (4) 10.8 (6) 10.3 (5*) (12.2) (15*) (11.0) ( ): Number of deaths. Login to comment

PMID: 10777368 [PubMed] Rivard SR et al: "Correlation between mutations and age in cystic fibrosis in a French Canadian population."

No. Sentence Comment

PMID: 10798368 [PubMed] Orozco L et al: "Spectrum of CFTR mutations in Mexican cystic fibrosis patients: identification of five novel mutations (W1098C, 846delT, P750L, 4160insGGGG and 297-1G-->A)."

No. Sentence Comment

69 First, we tested these patients for 12 mutations selected for the following reasons: five are the most common mutations worldwide (∆F508, G542X, N1303K, G551D and R553X; CFGAC 1994); 362 Table 1 Frequency of the CFTR gene mutations in 97 (194 chromosomes) Mexican patients Mutation Number of Frequency affected alleles (%) ∆F508 79 40.72 G542X 12 6.18 ∆I507 5 2.57 S549N 5 2.57 N1303K 4 2.06 R75X 3 1.54 406-1G→A 3 1.54 I148T 3 1.54 2055del9→A 2 1.03 935delA 2 1.03 I506T 2 1.03 3199del6 2 1.03 2183AA→G 2 1.03 G551D 1 0.51 R553X 1 0.51 1924del7 1 0.51 G551S 1 0.51 1078delT 1 0.51 Y1092X 1 0.51 R117H 1 0.51 G85E 1 0.51 3849+10KbC→T 1 0.51 1716G→A 1 0.51 W1204X 1 0.51 W1098Ca 1 0.51 846delTa 1 0.51 P750La 1 0.51 V754M 1 0.51 R75Q 1 0.51 W1069X 1 0.51 L558S 1 0.51 4160insGGGGa 1 0.51 297-1G→Aa 1 0.51 H199Y 1 0.51 2869insG 0 0 R1162X 0 0 3120+1G→A 0 0 Total 34 145 74.58% aNovel mutations detected in this study Fig.1 Sequencing ladders showing the CFTR novel mutations. Login to comment

PMID: 10819640 [PubMed] Kilinc MO et al: "Genotype-phenotype correlation in three homozygotes for the cystic fibrosis mutation 2183AA-->G shows a severe phenotype."

No. Sentence Comment

468 Identification of four new mutations in the cystic fibrosis transmembrane conductance regulator gene: I148T, L1077P, Y1092X, 2183AA→G. Hum Mutat 1994;3:330-2. 3 Cystic Fibrosis Genetic Analysis Consortium. Login to comment

PMID: 10834512 [PubMed] Kambouris M et al: "Identification of novel mutations in Arabs with cystic fibrosis and their impact on the cystic fibrosis transmembrane regulator mutation detection rate in Arab populations."

No. Sentence Comment

70 One with the I148T (585C ® T) mutation in exon 4 and the other with DF508 in exon 10. Login to comment

PMID: 11242048 [PubMed] Choi JY et al: "Aberrant CFTR-dependent HCO3- transport in mutations associated with cystic fibrosis."

No. Sentence Comment

18 Two of the mutations, I148T and R117H, are relatively common, and thus the clinical data are solid. Login to comment
23 To validate the ability of this procedure to accurately report Cl-channel activity, we determined the correlation between expression ef®ciency (green ¯uorescent protein (GFP) ¯uorescence), Cl- current and changes in [Cl- ]i in cells transfected with CFTR, CFTR(I148T) and CFTR(R117H). Login to comment
24 Figure 1a±h shows that similar results are reported by measurement of Cl- current and [Cl- ]i for CFTR and the mutants. Therefore, the Cl-transport capacity of all other CFTR letters to nature 94 NATURE | VOL 410 | 1 MARCH 2001 |www.nature.com NO3 - NO3 - NO3 - Forskolin 5 µM Forskolin 5 µM Forskolin 5 µM Cl-free Forskolin 5 µM Cl-free Cl-free Forskolin 5 µM Forskolin 5 µM 0.25 pHunits 250 s e WT f I148T g R117H i WT j I148T k R117H 10mMCl- 200 s 0 0.2 0.4 [Cl- ]change (mMs-1 ) n=6 n=4 n=3 WT R117H I148T 0 0.2 0.4 0.6 0.8 1.0 HCO3 -transport (∆pH+ min-1 ) n=8 n=4 n=3 I148T R117H WT l a WT b I148T c d h R117H 0 8 16 24 n=5 n=4n=3 WT I148T R117H Current (pApF-1 perGFP fluorescence) 120 s 100pA For 5 µMFor 5 µMFor 5 µM Figure 1 cAMP-stimulated Cl- and HCO3 transport by wild-type (WT) CFTR and the CFTR mutants I148T and R117H. Login to comment
32 (c) 2001 Macmillan Magazines Ltd mutants was evaluated from changes in [Cl- ]i. Figure 1e±l shows the experimental protocols used to measure the effect of the I148T and R117H mutations on Cl- and HCO3 transport. Login to comment
33 The I148T mutant is normally processed and mediates macroscopicCl- current(Fig.1d;ref.16),single-channelproperties16 and Cl- ¯uxes (Fig. 1h) indistinguishable from those of wild-type CFTR, but is associated with CF with pancreatic insuf®ciency. Login to comment
34 Replacing external Cl- with NO3 in non-stimulated cells caused a slow Clef¯ux in cells expressing CFTR or the I148T mutant. Login to comment
36 Similar rates were measured for the I148T, G178R, A1067T, G1244E, S1255P and G1349D mutants (see Fig. 3 for location of these mutations in CFTR), all of which are associated with CF with pancreatic insuf®- ciency. Login to comment
44 Results for the I148T mutant are shown in Fig. 1, and the averaged results for all mutants are listed in Table 1 in the Supplementary Information. Login to comment
186 letters to nature 96 NATURE |VOL 410 |1 MARCH 2001 |www.nature.com HCO3 -/Cl- transportratio 0 0.25 0.50 0.75 1.00 WT I148T G178R R297Q G551D H620Q G970R A1067T G1244E S1255P G1349D E193K G551S A800G H949Y R1070Q Pancreatic insufficient Pancreatic sufficientD648V N CI148T G178R E193K R297Q R117H A1067T R1070Q G1244E S1255P G1349D NBD2 RD H949Y G970R CL4CL3CL2CL1 NBD1 G551D G551S H620Q D648V A800G Figure 3 The HCO3:Cl-transport ratio of CFTR mutants associated with CF. Login to comment

PMID: 11354633 [PubMed] Tzetis M et al: "CFTR gene mutations--including three novel nucleotide substitutions--and haplotype background in patients with asthma, disseminated bronchiectasis and chronic obstructive pulmonary disease."

No. Sentence Comment

47 Of the 17 mutations in the patients, 9 (Y301C, I148T, R297Q, S1235R, T896I, S977F, L997F, F1052 V, A120T) have been listed by the Cystic Fibrosis Genetic Analysis Consortium (see website: http://www.cf.genet.sickkids. Login to comment
60 of CFTR gene IVS8-(T)n IVS8-(TG)m M470 V tested cases mutationa Asthma 20 1 L997F, T338Mb 9/7 10/12 M/V 1 Y301C 7/7 11/11 V/V 1 M1Rb, V11Ib 7/7 12/10 M/M 1 I148T/- 9/9 10/10 M/V 1 L997F/- 9/9 11/9 M/V 1 R297Q/- 5/5 13/11 M/M 1 R297Q/- 7/7 11/11 V/V 1 R75Q/- 7/7 11/11 V/V 1 A120T/ 5/7 11/11 V/V 1 -/- 7/7 11/12 M/V 1 -/- 7/9 11/11 M/M 2 -/- 7/7 12/10 M/V 7 -/- 7/7 11/11 V/V DB 19 1 F508del, I1027T 9/9 10/10 M/M 1 D565G, R668C 7/7 11/11 M/V 1 T896I/- 7/7 11/10 M/V 1 I148T/- 7/9 11/10 M/V 1 F508del/S977F 5/9 12/10 M/V 1 -/- 7/9 12/10 V/V 1 -/- 7/9 10/10 M/V 1 -/- 7/7 11/12 M/M 2 -/- 7/7 11/10 1 M/V, 1 V/V 2 -/- 7/7 12/10 1 V/V, 1 M/M 3 -/- 7/9 11/10 1 M/M, 2 V/V 4 -/- 7/7 11/11 1 V/V, 3 M/V COPD 12 1 F1052 V/- 7/7 11/10 M/V 1 S1235R/- 7/9 12/10 M/M 1 -/- 5/5 11/12 M/V 1 -/- 7/9 10/10 M/M 2 -/- 7/9 11/10 1 M/M,1 M/V 3 -/- 7/7 11/10 M/V 3 -/- 7/7 11/11 1 M/V, 2 M/M Controls 52 1 F508del/- 7/9 10/10 M/M 1 F1052 V/- 5/7 10/11 M/V 1 F1052 V/- 7/7 11/11 M/M 1 R668C, D565G/- 7/7 11/11 M/M 1 R688C, D565G/- 7/7 11/10 M/V 1 R75Q/- 7/7 11/11 V/V 1 R297Q/- 7/7 11/10 M/V 1 L997F/- 7/9 10/10 M/V 1 -/- 7/7 10/10 M/V 1 -/- 7/9 10/10 M/M 1 -/- 7/9 12/10 M/M 4 -/- 7/9 11/10 1 M/M, 1 V/V, M/V 15 -/- 7/7 11/10 13 M/V, 2 V/V 22 -/- 7/7 11/11 18 V/V, 3 M/V, 1 M/M been found that affect the same codon, of which M1 K affects the same nucleotide (T>A) (Cystic Fibrosis Genetic Analysis Consortium website). Login to comment
72 The proportion of CFTR alleles in each group is expressed as c/d (e), where c indicates the number of alleles with the genotype indicated at left, d indicates the number of total alleles examined in each group and e represents the percentage aMutation name according to the Cystic Fibrosis Genetic Analysis Consortium bNovel mutations, reported for the first time in this study Mutationa Control Pulmonary disease patients Greek CF population patients (PS; PI) (n=52) Asthma DB COPD (n=426) (n=20) (n=19) (n=12) R75Q (356 G/A, exon 3) 1 (0.96%) 1 (2.5%) - - 1 (0.1%) R668C (2134 C/T, exon 13) 2 (1.9%) - 1 (2.6%) - 1 (0.1%) L997F (3123 G>C, exon 17a) 1 (0.96%) 2 (5%) - - - F508del 1 (0.96%) - 2 (5.3%) - 465 (54.6%) D565G (A>G at 1825, exon 12) 2 (1.9%) - 1 (2.6%) - 1 (0.1%) F1052 V (T>G at 3286, exon 17b) 2 (1.9%) - - 1 (4.2%) 1 (0.1%) R297Q (G>A at 1022, exon 7) 1 (0.96%) 2 (5%) - - - Y301C (A>G at 1034, exon 7) - 1 (2.5%) - - - I148T (T>C at 575, exon 4) - 2 (5%) - - 1 (0.1%) T388Mb (C>T at 1295, exon 8) - 1 (2.5%) - - - M1Rb (T>G at 134, exon 1) - 1 (2.5%) - - - V11Ib (G>A at 163, exon 1) - 1 (2.5%) - - - I1027T (3212 T/C, exon 17a) - - 1 (2.6%) - 1 (0.1%) T896I (C>T at 2819, exon 15) - - 1 (2.6%) - - S977F (C>T at 3062, exon 16) - - 1 (2.6%) - - A120T (G>A at 490, exon 4) - 1 (2.5%) - - - S1235R (T>G at 3837, exon 19) - - - 1 (4.2%) - Table 3 Frequency of M470 and (TG)mTn alleles in pulmonary disease patients and controls (DB disseminated bronchiectasis, COPD chronic obstructive pulmonary disease, n number of cases, ND not detected) Clinical status Allele M470 TG11/T7 TG10/T7 TG12/T7 TG10/T9 TG11/T5 TG12/T5 TG13/T5 Asthmaa (n=20) 13 (32.5%) 23 (57.5%) 3 (7.5%) 5 (12.5%) 3 (7.5%) 2 (5%) ND 1 (2.5%) DB (n=19) 17 (44.7) 18 (47.4%) 6 (15.8%) 4 (10.5%) 9 (23.7%) ND 1 (2.6%) ND COPD (n=12) 17 (70.8) 12 (50%) 5 (20.8%) 1 (4.2%) 4 (16.7%) 1 (4.2%) 1 (4.2%) ND Controls (n=52) 37 (35.5%) 71 (68.%) 23 (22.1%) 1 (0.96%) 6 (5.8%) 1 (0.96%) ND ND aAlleles TG11/T9 (2) and TG9/T9 (1) also detected alleles, P<0.01) were both found more frequently in patients with COPD. Login to comment
93 Mutation I148T is a CF-causing mutation, first reported in a pancreatic-insufficient CF patient (Cystic Fibrosis Genetic Analysis Consortium website). Login to comment

PMID: 11484207 [PubMed] Orozco L et al: "XV-2c/KM-19 haplotype analysis of cystic fibrosis mutations in Mexican patients."

No. Sentence Comment

65 Distribution of XK Haplotype on Chromosomes Bearing Uncommon Cystic Fibrosis (CF) Mutations A B C D S549N 4/4 DI507 3/3 N1303K 3/3 2055 del9!A 2/2 I148T 1/1 406-1G!A 1/1 R75X 1/1 I506T 1/1 935delA 1/1 2183AA!G 1/1 1924del7 1/1 G551S 1/1 1078delT 1/1 R117H 1/1 384910KbC!T 1/1 1716G!A 1/1 W1204X 1/1 W1098C 1/1 846delT 1/1 R75Q 1/1 W1069X 1/1 L558S 1/1 4160insGGGG 1/1 297-1G!A 1/1 Fig. Login to comment
84 As regards other mutations (Table II), DI507 was associated with haplotype D as previously described in southern France [Claustres et al., 1996]; I148T with haplotype B as described in Italy and southern France [Castaldo et al., 1996; Claustres et al., 1996]; and 1078delT with haplotype C as found in France [Claustres et al., 1996]. Login to comment

PMID: 11589722 [PubMed] Walkowiak J et al: "Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency."

No. Sentence Comment

86 Kristidis et al. [10] reported that pancreatic insufficiency strongly correlates also with two alleles of DI507, Q493X, G542X, R553X, W1282X, 621 1 1G-T, 1717±1G-A, 556delA, 3659delC, I148T, G480C, V520F and R560T while one or two mutations such as R117H, R334W, A455E, and P574H were correlated with a pancreatic sufficient phenotype. Login to comment

PMID: 11668613 [PubMed] Wong LJ et al: "Improved detection of CFTR mutations in Southern California Hispanic CF patients."

No. Sentence Comment

96 Seven other mutations, I148T, S549N, R334W, 3120+1G to A, 406-1G>A, 935delA, and R1066C, occurred twice. Login to comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment
122 Clinical Presentations of Hispanic Cystic Fibrosis Patients With Novel Genotypes Patient number 1 2 3 4 5 6 7 8 9 Age/age at 7/1 (31)/0.5 23/1.2 18/9.5 (21)/15 13/0.3 18/at birth 12/7 15/0.5 diagnosisa Genotype ∆F508/3171delC W1089X/Q179K ∆F508/R75X 3271delGG/S549N I148T/3199del6 ∆F508/406-1G->A R334W/3500-2A->T 406-1G->A/unk Y1092X/R1162X Sweat Cl- 87 mEq/L (1) 79 mEq/L (0.5) 86 mEq/L (0.5) 73 mEq/L (10) 102 mEq/L (15) 100 mEq/L (0.5) 104 mEq/L (at birth) 72 mEq/L (4) 64 mEq/L (1) (age) FVC (age)b NA 59% (29) 54% (22) 75% (17) 45% (22) 81% (11); 99 (12) 60% (18) 73% (11); 71 (12) 45% (13) FEV1 (age)c NA 26% (29) 38% (22) 53% (17) 24% (22) 59% (11); 78 (12) 44% (18) 30% (11); 58 (12) 31% (13) Pancreatic Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient functiond Microbial Enterobacter Pseudomonas Staphylococcus Pseudomonas E. coli Staphylococcus Pseudomonas Staphylococcus Pseudomonas colonization Cloacae Aspergillus Pseudomonas Pseudomonas Staphylococcus Pseudomonas Acintobacter Aspergillus Height/weight/ 5/18/4 5/5/30 5/5/22 77/91/17 20/46/20 9/11/12 5/5/18 12/5/12 24/31/13 agee Complications Hypothyroidism RU/RML Learning Diabetes, Hypersplenism, Meconium PPD converter Chronic bronchictasis disability, depression portal ileus constipation requiring chronic hypertension, lobectomy abdominal pain liver cysts a Age and age at diagnosis are in years. Login to comment
134 Patient 5 was also compound heterozygous for a missense mutation I148T. Login to comment

PMID: 11773581 [PubMed] Raman V et al: "Increased prevalence of mutations in the cystic fibrosis transmembrane conductance regulator in children with chronic rhinosinusitis."

No. Sentence Comment

15 Five patients had the ⌬F508, 1 had the R117H, and 1 had the I148T mutation. Login to comment
68 None of the patients had a family history of CF. Seven of the 58 patients were found to have CFTR mutations, including 5 with the ⌬F508 mutation, 1 with the R117H mutation, and 1 with the I148T mutation. Login to comment

PMID: 12007216 [PubMed] Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."

No. Sentence Comment

109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment
113 Mexico ∆F508 (41.6%) G551S (0.5%) 75.5 57.0 35 374/194 Orozco et al.[1993]; Villalobos- G542X (5.6%) 1078delT (0.5%) Torres et al. [1997]; Liang et al. ∆I507 (2.5%) Y1092X (0.5%) [1998]; Orozco et al. [2000] S549N (1.9%) R117H (0.5%) N1303K (1.7%) G85E (0.5%) R75X (1.5%) 1716G→A (0.5%) 406-1G→A (1.5%) W1204X (0.5%) I148T (1.5%) W1098C (0.5%) 3849+10KbC→T (1.5%) 846delT (0.5%) 621+1G→T (1.2%) P750L (0.5%) 2055del9→A (1.0%) V754M (0.5%) 935delA (1.0%) R75Q (0.5%) I506T (1.0) W1096X (0.5%) 3199del6 (1.0%) L558S (0.5%) 2183AA→G (1.0%) 4160insGGGG (0.5%) G551D (0.5%) 297-1G→A (0.5%) R553X (0.5%) H199Y (0.5%) 1924del7 (0.5%) United States ∆F508 (68.6%) R553X (0.9%) 79.7 63.5 10 25048 Cystic Fibrosis Foundation (total) G542X (2.4%) 621+1G→T (0.9%) [1998] G551D (2.1%) 1717-1G→A (0.7%) W1282X (1.4%) 3849+10KbC→T (0.7%) N1303K (1.3%) R117H (0.7%) United States ∆F508 (48.0%) S1255X (1.4%) 77.3 59.8 16 160/148 Carles et al. [1996]; Macek et al. (African 3120+1G→A (12.2%) 444delA (0.7%) [1997]; Dörk et al. [1998]; American) 2307insA (2.0%) R334W (0.7%) Friedman et al. [1998] A559T (2.0%) ∆I507 (0.7%) R553X (2.0%) 1717-1G→A (0.7%) ∆F311 (2.0%) G542X (0.7%) G480C (1.4%) S549N (0.7%) 405+3A→C (1.4%) G551D (0.7%) United States 1) L1093P - - 1 2 Yee et al. [2000] (Cherokee) United States Non-French: French: Non- Non- Non- Non- Bayleran et al. [1996] (Maine) ∆F508 (82.0%) ∆F508 (58%) French: French: French: French: G542X (2.6%) 711+1G→T (8.3%) 95.3 90.8 11 191 G551D (2.6%) I148T (4.2%) French: French: French: French: N1303K (2.1%) A455E (4.2%) 80.3 64.5 8 72 R560T (1.0%) 1717-1G→A (1.4%) Total: 621+1G→T (1.0%) G85E (1.4%) 263 711+1G→T (1.0%) 621+1G→T (1.4%) R117H (1.0%) Y1092X (1.4%) 1717-1G→A (1.0%) G85E (0.5%) W1282X (0.5%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS589 United States ∆F508 (46.0%) R334W (1.6%) 58.5 34.2 7 129 Grebe et al. [1994] (SW Hispanic) G542X (5.4%) W1282X (0.8%) 3849+10KbC→T (2.3%) R553X (0.8%) R1162X (1.6%) United States 1) R1162X - - 3 17 Mercier et al. [1992] (SW Native 2) D648V American) 3) G542X United States 1) R1162X 3) G542X - - 4 16 Mercier et al. [1994] (Zuni Pueblo) 2) 3849+10KbC®T 4) D648V Venezuela ∆F508 (29.6%) G542X (3.7%) 33.3 11.1 2 54 Restrepo et al. [2000] Other Regions Australia ∆F508 (76.9%) 621+1G→T (1.1%) 88.7 78.7 8 761/464 CFGAC [1994] G551D (4.5%) N1303K (0.9%) G542X (2.8%) W1282X (0.6%) R553X (1.3%) R117H (0.6%) East Asia 1) 1898+1G®T 2) 1898+5G®T - - 2 28 Suwanjutha et al. [1998] Hutterite 1) M1101K (69.0%) 2) DF508 (31.0%) - - 2 32 Zielenski et al. [1993] Brethren New Zealand ∆F508 (78.0%) N1303K (1.9%) 87.4 76.4 5 636 CFGAC [1994] G551D (4.4%) 621+1G→T (1.1%) G542X (2.0%) *This table presents the mutation panels for all regions investigated in this study. Login to comment
213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation. Login to comment

PMID: 12151438 [PubMed] Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."

No. Sentence Comment

20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
35 ACMG 25 mutation panel (ACMG25): The following mutations are the recommended core mutations for general population CF carrier screening by American College of Medical Genetics (ACMG) (Grody, et al 2001): ∆F508, G542X, N1303K, G551D, W1282X, 1717-1G→A, R553X, 621ϩ1G→T, R1162X, R117H, ∆I507, 1898ϩ1G→A, G85E, R347P, A455E, R560T, R334W, 3849ϩ10kbC→T, 3659delC, 1078delT, 2789ϩ5G→A, 711ϩ1G→T, 2184delA, 3120ϩ1G→A and I148T. Login to comment

PMID: 12167682 [PubMed] Groman JD et al: "Variant cystic fibrosis phenotypes in the absence of CFTR mutations."

No. Sentence Comment

71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

PMID: 12394343 [PubMed] Rohlfs EM et al: "The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis."

No. Sentence Comment

0 The I148T CFTR allele occurs on multiple haplotypes: A complex allele is associated with cystic fibrosis Elizabeth M. Rohlfs, PhD1 , Zhaoqing Zhou, PhD1 , Elaine A. Sugarman, MS1 , Ruth A. Heim, PhD1 , Rhonda G. Pace, BS2 , Michael R. Knowles, MD2 , Lawrence M. Silverman, PhD3 , and Bernice A. Allitto, PhD1 Purpose: To determine whether CFTR intragenic changes modulate the cystic fibrosis (CF) phenotype in individuals who are positive for the I148T allele. Login to comment
1 Methods: The CFTR genes from individuals who carried at least one copy of the I148T allele were analyzed for additional changes that may be acting as genetic modifiers. Login to comment
2 Results: Seven of eight individuals with a known or suspected diagnosis of CF who carried I148T in combination with a severe CF mutation also carried 3199del6. Login to comment
3 Eight apparently healthy adult individuals who were compound heterozygous for I148T and a severe CF mutation or homozygous for I148T did not carry the deletion (P ϭ 0.0014). Login to comment
4 The I148T allele occurs on at least three haplotypes: an IVS-8 9T background, a 7T background, or a 9T ϩ 3199del6 background. Login to comment
6 Conclusions: It is concluded that I148T occurs on at least three haplotypes and the complex allele I148T ϩ 9T ϩ 3199del6 is associated with a classic CF phenotype. Login to comment
13 The I148T allele has been identified in CF patients from several countries and has been characterized as a "severe" CF mutation be- causesomeofthesepatientshadpancreaticinsufficientCF.10-13 It accounts for 0.7% of CF chromosomes in Italian patients,12 0.2% in Canadian patients,14 1.1% in US patients from the state of Maine,15 0.08% in French patients,16 and 9.1% in French-Canadian patients.17 In addition, the substitution changes a conserved amino acid and occurs in the first cytoplasmic loop of the first membrane spanning domain (MSD1).18,19 Based on such data, I148T was included in the ACMG/ACOG recommended CF mutation screening panel.20,21 Functional analysis of the I148T allele in transfected cell lines indicates that the protein product from this allele is fully glycosylated and biosynthetically mature. Login to comment
14 Anion conduction, as measured by iodide efflux, is normal in cells containing the I148T allele, and the cells have gating properties identical with those of wild-type cells.19 While this analysis does not rule out the possibility that the I148T allele affects other functions, such as its ability to function as a sodium channel, several major CFTR functions are retained. Login to comment
21 5 a r t i c l e Genetics IN Medicine We now have evidence that the I148T allele is associated with variable phenotypes. Login to comment
22 First, we had previously identified apparently healthy individuals who were compound heterozygotes for ⌬F508 and I148T.22 Second, we observed that the frequency of I148T is significantly higher in CF carriers than CF patients.22,23 To determine whether additional changes within the CFTR gene were influencing the CF phenotype when I148T was present, we sequenced the coding regions of the CFTR gene in apparently healthy individuals and CF patients who were compound heterozygous or homozygous for I148T. Login to comment
23 Here we show that the variable phenotypes are due to the occurrence of an in-frame deletion in cis with I148T on some chromosomes. Login to comment
25 No age limit was applied when determining the frequency of I148T in carriers, CF patients, or suspected CF patients. Login to comment
27 As described below, carriers, CF patients, and suspected CF patients who carried I148T and a severe mutation were tested for the 3199del6 allele. Login to comment
28 Carriers of a single I148T allele were also tested for 3199del6. Login to comment
29 Individuals homozygous for I148T or compound heterozygous for I148T and a severe CF allele were ascertained from January 1, 1998, to December 1, 2001. Login to comment
38 Sequence analysis To search for additional sequence changes in individuals who carried the I148T allele, coding exons of the CFTR gene were sequenced by single PCR amplifications spanning each exon followed by BigDye terminator cycle sequencing. An ABI 310 automated sequencer was used to analyze the cycle sequencing products. Login to comment
49 RESULTS Frequency of I148T in carriers, CF patients, and suspected CF patients Carrier testing of 42,784 individuals without a family history of CF identified 1,754 individuals who carried one mutation (carrier frequency approximately 1/24). Login to comment
50 One hundred thirteen of the identified mutations were I148T (6.4%). Login to comment
52 However, only 6 (0.06%) of the affected CF chromosomes were I148T. Login to comment
53 This represents a 106-fold difference in frequency of I148T between the carrier and affected groups. Login to comment
54 In a group of 10,231 patients referred for testing due to a suspected diagnosis of CF, 1.1% of the identified CF chromosomes were I148T. Login to comment
55 CFTR analysis of apparently healthy individuals and CF patients with the I148T allele Carrier testing identified seven compound heterozygotes (⌬F508/I148T) and one I148T homozygote who were apparently unaffected with CF (Table 1). Login to comment
57 The presence of the I148T and ⌬F508 on the same chromosome was ruled out in two individuals by genotyping of additional family members. Login to comment
58 Diagnostic testing of individuals affected with CF, or suspected of having CF, identified eight individuals who were compound heterozygous for a severe mutation (⌬F508, N1303K, or Q890X) and I148T (Table 2). Login to comment
61 Analysis of the intron 8 polythymidine tract determined that there was no significant difference in the poly(T) background of the I148T chromosomes between the healthy and affected groups (Tables 1 and 2). Login to comment
62 The I148T allele appears to occur most frequently on a 9T chromosomal background. Login to comment
65 However, in individual 38 it is most likely that the ⌬F508 is on the 9T chromosome and the I148T is on the 7T chromosome.7 Analysis of additional CFTR exons from healthy and affected patients identified a 6-bp deletion at nucleotide 3199 in some individuals. Login to comment
73 Sequencing of all exons did not identify any CFTR mutations in addition to I148T and ⌬F508. Login to comment
74 None of the eight apparently healthy individuals (⌬F508/I148T or I148T/ I148T) carried the deletion. Login to comment
75 The frequency of 3199del6 in individuals who are compound heterozygous or homozygous for I148T and not affected with CF versus those who are affected with or suspected of having CF is significantly different (P ϭ 0.0014 by Fisher exact test). Login to comment
76 Analysis of 3199del6 on other chromosomal backgrounds Inasmuch as one individual in the healthy group is presumed to carry I148T on a 7T chromosomal background, we Table 1 3199del6 analysis in apparently healthy adult individuals compound heterozygous or homozygous for I148T Indiv no. Indication for testing Ethnicity Age (yr) Mutation 1 Mutation 2 Intron 8 poly(T) 3199del6 12 Carrier testing w/FH NEC 56 I148T I148T 9, 9 neg 13 Screening NEC 40 ⌬F508 I148T 9, 9 neg 14 Carrier testing w/FH Hispanic 32 ⌬F508 I148T 9, 9 neg 15 Carrier testing w/FH NEC 29 ⌬F508 I148T 9, 9 neg 16 Carrier testing w/FH NEC 21 ⌬F508 I148T 9, 9 neg 23 Screening NEC 34 ⌬F508 I148T 9, 9 neg 38 Carrier testing w/FH NEC, SEC 31 ⌬F508 I148T 7, 9 neg 40 Carrier testing Caucasian 30 ⌬F508 I148T 9, 9 neg FH, family history; NEC, Northern European Caucasian; SEC, Southern European Caucasian. Login to comment
77 Table 2 3199del6 analysis in patients with a known or suspected diagnosis of CF and compound heterozygous for I148T and a severe CF mutation Indiv no. Indication for testing Ethnicity Age (yr) Mutation 1 Mutation 2 Intron 8 poly(T) 3199del6 17 Suspected CF NEC 4 ⌬F508 I148T 9, 9 pos 18 Suspected CF Caucasian, N. American 1 ⌬F508 I148T 9, 9 pos 19 Affected CF NEC Ͻ1 N1303K I148T 9, 9 pos 20 Suspected CF NEC 5 ⌬F508 I148T 9, 9 nega 22 Affected CF NEC 14 ⌬F508 I148T 9, 9 pos 39 Pancreatic steatorrhea NEC 3 ⌬F508 I148T 9, 9 pos 41 Suspected CF Hispanic 10 Q890X I148T 7, 9 pos 42 Affected CF NEC 20 ⌬F508 I148T 9, 9 pos NEC, Northern European Caucasian. Login to comment
79 tested 14 individuals who carried one copy of I148T, and who were homozygous for 7T, for the 3199del6 deletion (Table 3). Login to comment
80 From this analysis, the I148T-7T haplotype does not appear to carry the 3199del6 deletion. Login to comment
81 Poly(T) analysis of 76 additional individuals who carried one copy of I148T identified 8 who were homozygous for 9T and 64 who were compound heterozygous for 7T and 9T. Login to comment
83 Of those individuals whose indication for testing was screening, 1 of 55 I148T carriers also carried the deletion. Login to comment
84 Since we did not identify any individuals who were 5T/5T, we were unable to determine whether I148T occurs on a 5T background. Login to comment
85 To determine whether 3199del6 occurred on CF chromosomes without I148T, we analyzed 95 CF patients with one or no identified CFTR mutations for the deletion. Login to comment
90 This was first appreciated when the frequency of R117H in carriers was observed to be 16-fold higher than the frequency in CF patients.25 In the ethnically diverse US population reported here, the I148T allele is 100-fold more frequent in carriers than in CF patients. Login to comment
93 In contrast, while considered a severe mutation, I148T has not been included in most routine testing. Login to comment
94 This has likely limited the detection of healthy carriers of I148T/⌬F508 up to this time. Login to comment
95 In addition, screening of affected CF populations by allele-specific assays continues to identify I148T in those with CF. Login to comment
97 The 3199del6 mutation was reported to the CF Consortium Mutation Database in 1998, and it was noted to occur on the same chromosome as I148T.28 Our data corroborate this finding since the CF patients with the deletion and I148T also carried one of three different severe CF alleles. Login to comment
105 The deletion is apparently a rare allele, inasmuch as it was identified in only 2 of 90 individuals who carried one copy of I148T and was not identified in 386 non-CF chromosomes. Login to comment
106 It appears most likely that 3199del6 arose on a chromosome that carried the I148T mutation, and thus all chromosomes that have the deletion also have I148T. Login to comment
109 In vitro studies of chloride channel function showed that R74W Table 3 3199del6 and poly(T) analysis in individuals who carry one copy of I148T Intron 8 poly (T) Indication for testing no. Login to comment
113 WehavenowdeterminedthattheI148Talleleoccursonatleast three chromosomal backgrounds (I148T ϩ 7T, I148T ϩ 9T, and I148T ϩ 9T ϩ 3199del6) and that only the complex allele, I148T ϩ 9T ϩ 3199del6, appears to be associated with a classic CF phenotype. Login to comment
114 Our data do not support the occurrence of the deletion alone;therefore,wecannotassesswhetherthecombinationofthe missense mutation and the deletion on the same chromosome is pathogenic or whether the entire phenotypic effect is due to the deletion.Withthecurrentrecommended25mutationCFscreen- ing panel in place,20,21 we recommend that an I148T positive result be followed by reflex testing for the 3199del6 mutation until the data presented here and from other laboratories are reviewed by the ACMG/ACOG Committee. Login to comment
115 The presence of the complex allele in combination with another severe CF allele confers a CF phenotype, whereas I148T alone, even when a severe allele is on the other chromosome, confers no apparent phenotype. Login to comment
116 Long-term follow-up studies may be necessary to confidently rule out an association with I148T alone and single-organ or late-onset clinical expression. Login to comment

PMID: 12394352 [PubMed] Richards CS et al: "Standards and guidelines for CFTR mutation testing."

No. Sentence Comment

87 For example, R117H and I148T mutations may produce a more variable clinical phenotype, depending upon genetic modifiers, some of which may not be well defined. Login to comment
307 ⌬F508 R553X R1162X 2184delA 3120ϩ1GϾA ⌬I507 G542X G551D W1282X N1303K 621ϩ1GϾT R117H 1717-1GϾA A455E R560T G85E R334W R347P 711ϩ1GϾT 1898ϩ1GϾA 1078delT 3849ϩ10kbCϾT 2789ϩ5GϾA 3659delC I148T CF 3.3.2 Inclusion of the common R117H mutation in the test panel screens for CBAVD as well as for CF: The phenotypic consequences of the R117H mutation are modulated in cis by the 5/7/9T polypyrimidine tract in intron 8 such that R117H/7T is associated with CBAVD and R117H/5T is associated with CF.34 Moreover, the 5T allele is associated as a trans mutation in CBAVD.35 It is recommended that the 5/7/9T variant be excluded from the routine carrier screen but tested as a reflex for carriers shown to be heterozygous for the R117H mutation. Login to comment

PMID: 12439892 [PubMed] Kilinc MO et al: "Highest heterogeneity for cystic fibrosis: 36 mutations account for 75% of all CF chromosomes in Turkish patients."

No. Sentence Comment

80 Haplotypes Associated With the Mutations Identified in 83 Turkish CF Patients* Mutation Total number of alleles Number of alleles Number of patients Haplotypes Homo Hetero DF508 39 (23.5) 6 7 23 M 28 13 1 0 1 6 7 23 M 30 13 1 0 1 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 11 4 3 6 7 23 M 7 17 2 0 2 6 7 16 M 31 13 3 1 1 6 7 17 M 31 13 17 5 7 6 7 17 M 32 13 3 1 1 1677delTA 12 (7.2) 7 7 16 V 30 13 12 5 2 2183AA > G 7 (4.2) 7 7 16 M 30 13 1 0 1 7 9 16 M 31 13 4 2 0 7 7 16 M 32 13 2 1 0 G542X 6 (3.6) 6 7 23 M 32 13 6 3 0 F1052V 5 (3.0) 6 7 17 M 7 13 4 1 2 7 5 17 M 7 17 1 0 1 W1282X 5 (3.0) 7 7 17 M 7 17 4 1 2 7 7 17 M 7 18 1 0 1 E92K 4 (2.4) 7 7 16 V 46 13 3 1 1 7 7 17 V 46 13 1 0 1 1525 À 1G > A 4 (2.4) 7 7 17 M 7 17 4 2 0 2789 þ 5G > A 4 (2.4) 7 9 17 M 7 17 3 1 1 7 5 17 M 7 17 1 0 1 N1303K 4 (2.4) 7 7 23 M 31 13 2 0 2 6 7 22 M 30 13 1 0 1 6 7 23 M 30 13 1 0 1 A46D 3 (1.8) 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 2 1 0 2184insA 3 (1.8) 7 5 17 V 30 13 1 0 1 7 7 16 V 30 13 2 0 2 R1070Q 3 (1.8) 7 7 16 M 31 13 1 0 1 7 7 17 M 31 13 2 0 2 Q493Pa 2 (1.2) 6/7 5 16 M 46 13 2 1 0 3849 þ 5G > Aa 2 (1.2) 7 7 16 M 31 13 2 1 0 CFTRdele17b,18a 2 (1.2) 6 9 16 V - - 2 1 0 K68Ea 1 (0.6) 6 9 17 M 7 13 1 0 1 R74W 1 (0.6) 6 7 16 M 32 16 1 0 1 306delTAGA 1 (0.6) 7 7 16 M 7 17 1 0 1 D110H 1 (0.6) 7 9 16 V 30 13 1 0 1 I125T 1 (0.6) 6 7 23 V 7 16 1 0 1 406 À 3T > Ca 1 (0.6) 7 7 16 V 33 17 1 0 1 I148T 1 (0.6) 6/7 7 16/17 M 7 17/23 1 0 1 621 þ 1G > T 1 (0.6) 6 7 21 V 31 13 1 0 1 R347P 1 (0.6) 7 9 17 V 30 13 1 0 1 S466X 1 (0.6) 7 7 23 M 33 13 1 0 1 L571S 1 (0.6) 7 7 16 V 29 13 1 0 1 1717 À 1G > A 1 (0.6) 7 9 17 M 7 16 1 0 1 E608Ga 1 (0.6) 7 9 16 M/V 29/31 13 1 0 1 2043delG 1 (0.6) 7 9 17 M 7 17 1 0 1 P1013L 1 (0.6) 6 5 16 M 21 18 1 0 1 R1066L 1 (0.6) 7 7 17 M 7 13 1 0 1 3129del4 1 (0.6) 7 7 16 V 29 13 1 0 1 V1147Ia 1 (0.6) 6 7 17 M 33 17 1 0 1 S1235R 1 (0.6) 6 7 17 M 39 13 1 0 1 CFTRdele2,3 1 (0.6) 7 7 16 V 33 13 1 0 1 Total 125 (75) 125 32 61 *The order of the polymorphisms is IVS6GATT, Tn, IVS8CA, M470V, IVS17BTA and IVS17BCA. Login to comment

PMID: 12509709 [PubMed] Watson MS et al: "Cystic fibrosis carrier screening: issues in implementation."

No. Sentence Comment

52 Efforts continue to maintain high standards for testing laboratories as new technologies are used in CFTR mutation testing.10 I148T The I148T mutation was included in the panel on the basis of its prevalence of 0.1% in CF patients. Login to comment
54 At the time the panel was determined, there were one or two anecdotal reports of individuals with I148T but without CF in families in which there were individuals with CF and I148T. Login to comment
55 After the introduction of general population carrier screening, it was observed that the I148T mutation was appearing at rates 60 to 100 times above that expected based on the rate in the CF patient population (E.M. Rohlfs, personal communication, 2002).11-14 This suggested that there was likely a modifier of the expression of I148T or that I148T was modifying the effects of another mutation. Login to comment
56 Rohlfs et al.13 recently reported that I148T segregates on at least two genetic backgrounds distinguished by the 5T/7T/9T polymorphism and a CFTR deletion, 3199del6. Login to comment
57 Among five unaffected individuals with I148T and the ⌬F508 or another I148T mutation, all had I148T on a 9T background. Login to comment
58 Among five individuals with CF and with ⌬F508 or N1303K mutation and I148T, four had I148T on a background of 9T and 3199del6. Login to comment
59 More cases with I148T on the 3199del6 background need to studied and predictive values established. Login to comment
60 In the meantime, when I148T is found in patients with CF, the haplotype background should be tested as a reflex test. Login to comment
61 When found in a carrier screening program, care should be taken communicating results and laboratories should consider reflex testing to determine the genetic background on which I148T sits. Login to comment
66 I148T represents an example of a genetic change that requires follow-up testing to fully understand its implications. Login to comment
100 Rohlfs EM, Zhou Z, Sugarman EA, Heim RA, Pace RG, Knowles MR, Silverman LM, Allitto BA. The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis. Login to comment

PMID: 12544470 [PubMed] Strom CM et al: "Extensive sequencing of the cystic fibrosis transmembrane regulator gene: assay validation and unexpected benefits of developing a comprehensive test."

No. Sentence Comment

54 Table 2 Mutant samples used for validation of sequencing assay Mutation expected wt/wt (3 patients) delta F508/wt (2 patients) R117H/wt (3 patients) 2789 ϩ 5 G 3 A/2789 ϩ 5 G 3 A (both parents confirmed carriers) R117H/delta F508 (2 patients) delta F508/I148T delta F508/R1066C delta F508/3848 ϩ 10 kb C 3 T delta F508/G542X R117H/I148T (2 patients) 2307 delA/N1303K deltaF 508/711 ϩ 1 G 3 T deltaF 508/1898 ϩ 1 G 3 A G551D/N1303K 2789 ϩ 5G3A. Login to comment
97 However, previous studies have shown that two such mutations, I148T and D1270N, are probably polymorphisms or low penetrance alleles.7 For those reasons, caution must be used when interpreting the presence of a rare or novel mutation found in the sequencing assay. Login to comment
127 The discovery that the I148T and D1270N mutations are likely to be polymorphisms and not causative CF mutations points out the danger in assuming that all mutations listed in the CF database are causative mutations. Login to comment
132 A new use for single exon sequencing is the recent observation that I148T is only a CF chromosome in a haplotype that includes the 9T IVS8 polymorphism and 3199del6.11 In patients with I148T and 9T, single exon sequencing can determine whether 3199del6 is present. Login to comment

PMID: 12651880 [PubMed] Witt H et al: "Chronic pancreatitis and cystic fibrosis."

No. Sentence Comment

494 Moreover, two of the CFTR mutations found were previously reported as non-disease causing polymorphisms (R1162L, T1220I), five alterations were described for the first time and have not been demonstrated in a previous study of 640 Spanish CF patients.154 In summary, only 4 of 144 asthmatic patients (2.8%) possessed a verified CF causing mutation (R74W, I148T, T582R, and R1066C). Login to comment

PMID: 12680831 [PubMed] Cimmino M et al: "Clinical characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis."

No. Sentence Comment

47 Analysis of mutations in the CFTR gene as tested by the multiplex polymerase chain reaction (PCR), followed by the reverse dot-blot technique, which searches for 29 of the most frequent mutations (DF508, N1303K, G542X, W1282X, 1717±1 G-A, R553X, 2183 AA-G, DI507, G551D, R560T, 3849 10kbC > T, R1162X, 3659delC, 3905insT, G85E, 621 1GT, R117H, R347P, R334W, A455E, 2789 5GA, Q552X, S1251N, 3905insT, 394delTT, E60X, 2143delT, 2184delA, 711 5G > A), and by ASO dot-blot for the following mutations: I148T, R1158X, 4016 1T, G1244E G >A.26 Statistical analysis was performed using multivariate analysis, by forward stepwise comparison; it was done to ®nd out which of the examined characteristics could be associated (P < 0.01) to nasal polyposis. Login to comment

PMID: 12881448 [PubMed] Malehorn DE et al: "Detection of cystic fibrosis mutations by peptide mass signature genotyping."

No. Sentence Comment

161 Several of the mutations (I148T, 1078⌬T, 1898 ϩ 1 GϾA, and 2789 ϩ 5 GϾA) could be represented in only heterozygous form using synthetic mixtures. Login to comment
181 The heterozygous mutations depicted are as follows: (A), exon 3 wt/G85E; (B), exon 4.1 wt/R117H; (C), exon 4.2 wt/I148T; (D), exon 4.2 wt/621 ؉ 1G>T; (E), exon 5 wt/711 ؉ 1G>T; (F), exon 7.1 wt/1078⌬T; (G), exon 7 wt/R334W; (H), exon 7 wt/R347P; (I), exon 9 wt/A455E; (J), exon 10.2 wt/⌬I507; (K), exon 10.2 wt/⌬F508; (L), exon 11.2 wt/1717-1G>A; (M), exon 11 wt/G542X; (N), exon 11 wt/G551D; (O), exon 11 wt/R553X; (P), exon 11 wt/R560T; (Q), exon 12 wt/1898 ؉ 1G>A; (R), exon 13.2A wt/2184⌬A; (S), exon 14B wt/2789 ؉ 5G>A; (T), exon 16 wt/3120 ؉ 1G>A; (U), exon 19 wt/R1162X; (V), exon 19 wt/3659⌬C; (W), intron 19 wt/3849 ؉ 10kbC>T; (X), exon 20 wt/W1282X; (Y), exon 21 wt/N1303K. typical yield of purified protein was 1-30 ␮g/test well, depending on the analyte species. Login to comment

PMID: 14641997 [PubMed] Raskin S et al: "High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing."

No. Sentence Comment

63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

PMID: 14711349 [PubMed] Richards CS et al: "Prenatal screening for cystic fibrosis: past, present and future."

No. Sentence Comment

209 The second example of a mutation with variable expression depending on haplotype is I148T. Login to comment
212 Using that standard, I148T had been reported by the CF registry at just over 0.1%. Login to comment
213 Within a relatively short period following screening (<1 year), reports from large testing laboratories surfaced indicating that I148T was identified almost 100-times more frequently in the general population as compared with the CF population, a story all-too familiar at this point [46,47]. Login to comment
214 Rolhfs and coworkers identified a genetic modifier, a deletion of six base pairs (3199del6), resulting in an in-frame deletion of two amino acids in the CFTR protein that traveled with I148T when it was a CF disease-causing allele [46]. Login to comment
215 No CF patients were identified with I148T that did not also have 3199del6. Login to comment
216 The questions then became: is 3199del6 the real CF mutation and I148T simply a polymorphism in linkage disequilibrium; does 3199del6 alone cause CF and is it ever found unlinked; or can it also be linked with other CFTR mutations? Login to comment
225 A danger of expanding to more rare and less studied mutations is that their clinical significance may be questionable, as has already been experienced with I148T. Login to comment
230 The committee to review the panel of mutations has reconvened and is currently deliberating the merits of inclusion or exclusion of the R117H, 5T, I148T and 3199del6 mutations/variants. Login to comment
358 The first changes are likely to be minor, perhaps involving the I148T or R117H mutations. Login to comment

PMID: 14998948 [PubMed] Danziger KL et al: "Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis."

No. Sentence Comment

59 Polyacrylamide gels were analysed for the presence of mutations following staining in ethidium bromide (EtBr) and image capture under UV using the Gel Doc 1000 system Table I. List of CFTR mutations included in common mutation panels American College of Medical Genetics CF panel (25 mutations) DF508 G542X G551D R117H W1282X N1303K R1162X 3849+10kbC®T DI507 R553X 1717-1G®A 621+1G®T R560T 3659delC 3120+1G®A I148T G85E R334W A455E 1898+1G®A 2148delA 711+1G®T 2789+5G®A R347P 1078delT Six additional mutations and one polymorphism in UCSF panel (31 mutations) Y1092X R347H 3849+4 Q493X 3905insT S549N F508C (polymorphism) (BioRad). Login to comment

PMID: 15319316 [PubMed] Johnson SC et al: "Multiplexed genetic analysis using an expanded genetic alphabet."

No. Sentence Comment

45 3199del6 was added because several lines of evidence indicate that 3199del6 is a disease-causing mutation and may replace I148T (20). Login to comment

PMID: 15354327 [PubMed] Palomaki GE et al: "Prenatal screening for cystic fibrosis: an early report card."

No. Sentence Comment

13 An unanticipated problem occurred when one of the mutations that had not been subjected to evaluation during pilot trials was introduced directly into routine practice. The I148T mutation is known to occur about once in every 1000 genes among patientsclinicallyaffectedwithcysticfibrosis.Whentestingisper- formed in the general population, however, this mutation is found100timesmoreoftenthanexpected.8 Itisnowthoughtthat I148T is a polymorphism that is tightly linked to the actual disease-causing mutation 3199del6. Login to comment

PMID: 15354331 [PubMed] Strom CM et al: "Cystic fibrosis screening: lessons learned from the first 320,000 patients."

No. Sentence Comment

14 Further work by another laboratory established that in CF patients, the I148T caused CF almost exclusively when coupled with a second, much rarer mutation, 3199del6.11-13 This haplotype also includes the IVS-8 9T allele. Login to comment
15 In response to these new data, the ACMG published an advisory recommending that any patient who is discovered to have I148T and 9T should be tested for 3199del6. Login to comment
17 Based on this new information it is possible an unaffected fetus might have been terminated based on a genotype of I148T and another CF mutation. Login to comment
24 3 testing is that one or both parents carries I148T, is to contact the physician and advise him or her. Login to comment
36 Because current evidence suggests that I148T is not CF causing mutation (see earlier) the 1,136 patients with I148T have been considered "wild type" and excluded from the table. Login to comment
42 Using the data from Table 1, which omits I148T cases, excludes carriers of the mild mutation R117H without 5T, and also excludes half of the patients with R117H and 5T (because only half would be predicted to have the 5T in cis), there are 10,139 carriers of classic CF. Login to comment
47 Frequency, all tests Frequency, CF mutations (%) delta F508 7610 1:44 75% R117H/7T or 9T 1030 1:325 NAb R117H/5T 103 1:3,254 0.51c W1282X 529 1:625 5.2 G542X 382 1:909 3.8 G551D 278 1:1,250 2.7 N1303K 201 1:1,668 2.0 3849ϩ10kb CϾT 167 1:2,007 1.6 1717-1 GϾA 102 1:3,286 1.0 R553X 102 1:3,286 1.0 621ϩ1 GϾT 98 1:3,420 0.97 2789ϩ5 GϾA 82 1:4,087 0.80 3120ϩ1 GϾA 73 1:4,591 0.72 R1162X 54 1:6,207 0.53 R334W 54 1:6,207 0.53 685E 52 1:6,446 0.51 R560T 52 1:6,446 0.51 Delta I507 51 1:6,572 0.50 711ϩ1 GϾT 40 1:8,380 0.39 1898ϩ1 GϾA 37 1:9,059 0.36 3659 del C 36 1:9,311 0.36 A455E 34 1:9,858 0.33 R347P 33 1:10,158 0.32 2184 del A 14 1:23,943 0.14 1078 del T 6 1:55,867 0.06 a I148T has been eliminated from these data. Login to comment
54 We detected 1,136 patients with I148T in this series. Login to comment
55 After the publication of the association of the haplotype I148T/ IVS-8 9T/3199del6 with CF,13 we began analyzing the IVS-8 status for all patients found to have I148T. Login to comment
56 Of 544 heterozygous patients for I148T, only 86 (16%) lacked the 9T allele. Login to comment
57 Because most patients with I148T will have the 9T allele and the number of patients in the initial published study13 was only 9, we believe that all patients found to have I148T should be offered 3199del6 testing regardless of their IVS-8 genotype. Login to comment
58 Approximately 1% of more than 400 patients with I148T were found to have 3199del6 (data submitted elsewhere). Login to comment
59 In our series of 335,204 tests, 1,136 patients had I148T, predicting that approximately 11 patients would be expected to have 3199del6. Login to comment
74 Excluding patients with I148T and R117H without 5T, in our series of 335,204 patients, only 4 patients were discovered to have 2 CF mutations who did not previously have the diagnosis of CF, yielding a "false positive" rate of 0.0012% for 2 CF mutations. Login to comment
80 In all, 5 prenatal diagnoses were performed identifying one parent as heterozygous for I148T. Login to comment
81 One mother was a compound heterozygote for delta F508 and R117H (without 5T), the father was heterozygous for I148T, and the fetal genotype was delta F508/I148T. Login to comment
82 This couple received counseling regarding the significance of I148T and elected to continue the pregnancy. Login to comment
86 Table 3 Patients with 2 CF mutations and unexpected phenotypes Genotype Gender Age Symptoms ⌬F508/R117H Female 22 years no respiratory symptoms (5T/9T) 3 episodes of pancreatitis ⌬F508/3849 ϩ 10kb CϾT Female Adult chronic pancreatitis 2789ϩ5 GϾA/2789ϩ5 GϾAa Female 29 years chronic sinusitis ⌬F508/2789ϩ5 GϾA Female 40 years recurrent sinusitits requiring surgery a Both parents confirmed to be carriers of 2789ϩ5 GϾA. I148T and the other for delta F508 had potentially affected genotypes and no pregnancy losses occurred. Login to comment
131 The single genotype/phenotype error regarding I148T was recognized quickly and interpretative reporting comments adjusted accordingly. Login to comment

PMID: 15354332 [PubMed] Monaghan KG et al: "Preconception and prenatal cystic fibrosis carrier screening of African Americans reveals unanticipated frequencies for specific mutations."

No. Sentence Comment

28 DOI: 10.1097/01.GIM.0000127269.42279.83 May/June 2004 ⅐ Vol. 6 ⅐ No. 3 a r t i c l e Genetics IN Medicine duplex analysis (exons 4 and 13) and RFLP analysis to test for 3 additional mutations recommended by ACOG/ACMG, but not included in CF OLA v2.0 (I148T, 2184delA, and 3120ϩ1G3A, respectively). Login to comment
36 Reflex testing for the 3199del6 and intron 8 polyT locus was performed for carriers of the I148T and R117H mutations, respectively. Login to comment
51 R117H has been previously reported at an increased frequency among individuals undergoing carrier screening compared to those with a diagnosis of cystic fibrosis.8 An unexpected result was the lack of 3120ϩ1G3A carriers, although 4 were expected given that this mutation accounts for Ϸ12% of the CF muta- Table 1 Summary of carrier screening results using various methods employed between December 2001 and September 2003 OLA v2.0, heteroduplex analysis (exons 4 and 13) and RFLP analysis (3120ϩ1G3A) OLA v3.0 INNO-LiPA Total screened 818 1274 97 No. of carriers identified 16 14 3 Observed carrier frequency 1/51 1/81 Mutations identified ⌬F508 (6), G622D (3), R117H/7T (3), I148T (3199del6 negative), Q98R, 1898ϩ1G3A, and G551Da ⌬F508 (14), R117H/7T, R553X, and G551D a In addition, 2 persons were positive for F693L (TTG) and 1 was positive for P140S (C3T at 550); both are variants of unknown clinical significance. Login to comment
80 However, laboratories, which receive a large proportion of specimens from individuals with a lower Table 2 Summary of ACOG/ACMG CF mutations identified among 2189 African Americans (4378 chromosomes) undergoing carrier screening Mutation Carriers identified Mutation frequency (%) (this study) Published mutation frequency (%)6,7 ⌬F508 20/33 61 29a -48 R117H/7T 4/33 12 1 G551D 2/33 6 1 I148T (3199del6 negative) 1/33 3 0 1898ϩ1G3A 1/33 3 1 R553X 1/33 3 0.5 3120ϩ1G3A 0 0 12-14 a The lower frequency of ⌬F508 reported by Heim et al. was most likely due to ascertainment bias. Login to comment
83 As we have learned from I148T,16,17 it is of limited benefit to screen for sequence changes that do not result in a classic CF phenotype. Login to comment

PMID: 15371902 [PubMed] Watson MS et al: "Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel."

No. Sentence Comment

54 The mutation/variant I148T occurs at rates 50 to 100 times higher than in the general population being tested for carrier status than in patients.8,9 It was shown that CFTR genes bearing I148T in CF patients have a second mutation termed 3199del6. Login to comment
55 The vast majority of individuals in the general population with I148T do not have the 3199del6 mutation. Login to comment
57 One, CF patients have been described who lack I148T but have 3199del6 in association with another CF causing mutation.10 Two, unaffected individuals have been described who have a CF mutation associated with severe CF and I148T but lacking 3199del6.7-11 Because the frequency of I148T alone is 0.05% and I148T with 3199del6 in this analysis is considerably lower than 0.1% and because I148T does not cause classical CF by itself, we recommend removing I148T from the CF carrier screening panel. Login to comment
79 Recent experience with I148T serves to demonstrate the importance of evaluating distribution among both affected and carrier screening populations to discern discrepancies before inclusion in a screening panel. Login to comment

PMID: 15371903 [PubMed] Sugarman EA et al: "CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations."

No. Sentence Comment

33 Specimens positive for D1270N (see later) or I148T in the absence of 3199del6 were reclassified as negative for the purpose of this analysis. Login to comment
34 Specimens identified as I148T positive before the start of 3199del6 reflex testing are included in the analysis because their disease causing status is unknown. Login to comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment
63 The most prevalent mutations were as follows: ⌬F508, D1152H, R117H, G542X, L206W, I148T (3199del6 status unknown), ⌬I507, R1066C, R553X, 3849ϩ10kbCϾT, and R334W representing 83.72% of the total identified. Login to comment
71 In the carrier screening group, 4 mutations, D1152H, R117H, ⌬I507, and L206W, had frequencies of 3.8% 1 CFTR mutation distribution among Hispanic CF patients and carrier screening referrals CFTR Mutation Identified CF Patients Carrier Screening Referrals # of CF Chromosomes % Detection # of Carrier Screen Referrals % of Positive Carriers ⌬F508a 118 37.11c 136 47.39 G542Xa 11 3.46 12 4.18 R334Wa 11 3.46 6 2.09 3120 ϩ 1G Ͼ Aa 7 2.20 5 1.74 3876delAb 7 2.20 4 1.39 W1089Xb 7 2.20 R1066Cb 6 1.89 9 3.14 3849 ϩ 10kbC Ͼ Ta 3 0.94 6 2.09 R1162Xa 2 0.63 5 1.74 G85Ea 2 0.63 3 1.05 S549Nb 2 0.63 2 0.70 711 ϩ 1G Ͼ Ta 2 0.63 1 0.35 2789 ϩ 5G Ͼ Aa 2 0.63 1 0.35 1949del84b 2 0.63 1 0.35 R117Ha 1 0.31 14 4.88 ⌬I507a 1 0.31 11 3.83 R553Xa 1 0.31 7 2.44 ⌬F311b 1 0.31 1 0.35 1078delTa 1 0.31 1 0.35 621 ϩ 1G Ͼ Ta 1 0.31 1 0.35 3659delCa 1 0.31 1 0.35 Q890Xb 1 0.31 1 0.35 G551Da 1 0.31 1812 - 1G Ͼ Ab 1 0.31 I148T ϩ 3199del6a 1 0.31 A559Tb 1 0.31 1717 - 1G Ͼ Aa 1 0.31 3905insTb 1 0.31 3821delTb 1 0.31 G178Rb 1 0.31 D1152Hb 18 6.27 L206Wb 11 3.83 I148T (3199del6 status unknown)a 10 3.48 N1303Ka 4 1.39 W1282Xa 4 1.39 R117Cb 4 1.39 R352Qb 2 0.70 712 - 1G Ͼ Tb 2 0.70 Y1092Xb 1 0.35 444delAb 1 0.35 S549Rb 1 0.35 1609delCAb 1 0.35 Negative for mutations analyzed 120 37.74 15046 Total 318 62.20d 15333 100.00 a Mutation included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening.4,5 b Mutation not included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening. Login to comment

PMID: 15371905 [PubMed] Palomaki GE et al: "Clinical sensitivity of prenatal screening for cystic fibrosis via CFTR carrier testing in a United States panethnic population."

No. Sentence Comment

32 Data from the International Cystic Fibrosis Consortium were taken from Table 1 of its publication.4 Data from the Cystic Fibrosis Foundation National Patient Registry were taken from the year 1999 and stratified according to whether or not the patient was seen Table 1 CFTR mutation frequencies among Hispanic Caucasians with cystic fibrosis within the recommended minimum testing panel Ordera Mutation Mutation frequency (%) CF Consortiumb CF Foundationc Average Cumulative 1 delF508 45.51 63.25 54.38 54.38 2 G542X 5.11 5.09 5.10 59.48 8 delI507 0.59 5.02 2.81 62.29 22 R334W 2.25 1.31 1.78 64.07 6 N1303K 1.65 1.67 1.66 65.73 10 3849 ϩ 10kbC Ͼ T 1.60 1.53 1.57 67.30 7 R553X 0.63 0.73 0.68 67.98 5 W1282X 0.53 0.73 0.63 68.61 19 R1162X 0.57 0.58 0.58 69.19 3 G551D 0.31 0.80 0.56 69.75 12 1717 - 1G Ͼ T 0.10 0.44 0.27 70.02 4 621 ϩ 1G Ͼ T 0.00 0.51 0.26 70.28 14 711 ϩ 1G Ͼ T 0.10 0.36 0.23 70.51 18 G85E 0.10 0.36 0.23 70.74 11 2789 ϩ 5G Ͼ A 0.10 0.22 0.16 70.90 13 R347P 0.10 0.22 0.16 71.06 20 2184delA 0.10 0.22 0.16 71.22 24 3120 ϩ 1G Ͼ T 0.10 0.22 0.16 71.38 17 3569delC 0.10 0.15 0.13 71.51 9 R117H 0.00 0.22 0.11 71.62 23 I148T 0.10 0.07 0.09 71.71 25 1078delT 0.10 0.07 0.09 71.80 16 A455E 0.10 0.00 0.05 71.85 21 1898 ϩ 1G Ͼ A 0.10 0.00 0.05 71.90 15 R560T 0.00 0.00 0.00 71.90 All 25 59.95 83.77 71.90 a The order is based on that found for non-Hispanic Caucasians.3 b Based on between 178 and 958 chromosomes (International Cystic Fibrosis Genetic Analysis Consortium.4 c Based on 1374 chromosomes from clinically diagnosed persons registered in the Cystic Fibrosis Foundation National Patient Registry. Login to comment
80 The larger data- Table 2 CFTR mutation frequencies among African American individuals with cystic fibrosis within the recommended minimum testing panel Ordera Mutation Mutation frequency (%) CF Consortiumb CF Foundationc Average Cumulative 1 delF508 35.50 52.63 44.07 44.07 24 3120 ϩ 1G Ͼ T 12.50 6.64 9.57 53.64 8 delI507 0.74 3.89 2.32 55.96 7 R553X 2.37 1.37 1.87 57.83 2 G542X 1.18 1.72 1.45 59.28 3 G551D 0.59 1.83 1.21 60.49 4 621 ϩ 1G Ͼ T 1.18 1.03 1.11 61.60 19 R1162X 0.74 0.57 0.66 62.26 22 R334W 0.74 0.23 0.49 62.75 12 1717 - 1G Ͼ T 0.74 0.00 0.37 63.12 6 N1303K 0.00 0.69 0.35 63.47 5 W1282X 0.00 0.47 0.24 63.71 10 3849 ϩ 10kbC Ͼ T 0.00 0.34 0.17 63.88 15 R560T 0.00 0.34 0.17 64.05 18 G85E 0.00 0.23 0.12 64.17 9 R117H 0.00 0.11 0.06 64.23 13 R347P 0.00 0.11 0.06 64.29 17 3569delC 0.00 0.11 0.06 64.35 21 1898 ϩ 1G Ͼ A 0.00 0.11 0.06 64.41 20 2184delA 0.10 0.00 0.05 64.46 23 I148T 0.10 0.00 0.05 64.51 11 2789 ϩ 5G Ͼ A 0.00 0.00 0.00 64.51 14 711 ϩ 1G Ͼ T 0.00 0.00 0.00 64.51 16 A455E 0.00 0.00 0.00 64.51 25 1078delT 0.00 0.00 0.00 64.51 All 25 56.46 72.42 64.51 a The order is based on that found for non-Hispanic Caucasians.3 b Based on between 79 and 169 chromosomes reported by the International Cystic Fibrosis Genetic Analysis Consortium.4 c Based on 874 chromosomes from clinically diagnosed persons registered in the Cystic Fibrosis Foundation National Patient Registry. Login to comment
107 An earlier article10 reported that 97% of mutations were identified in 90 chromosomes from Ashkenazi Jewish individ- Table 3 CFTR mutation frequencies among Ashkenazi Jewish Caucasian individuals with cystic fibrosis within the recommended minimum testing panel Ordera Mutation Mutation frequency (%) CF Consortiumb Cumulative 5 W1282X 45.92 45.92 1 delF508 31.41 77.33 2 G542X 7.55 84.88 10 3849 ϩ 10kbC Ͼ T 4.77 89.65 6 N1303K 2.78 92.43 12 1717 - 1G Ͼ T 0.67 93.10 7 R553X 0.22 93.32 3 G551D 0.22 93.54 24 3120 ϩ 1G Ͼ T 0.10 93.64 21 1898 ϩ 1G Ͼ A 0.10 93.74 20 2184delA 0.10 93.84 23 I148T 0.10 93.94 11 2789 ϩ 5G Ͼ A 0.10 94.04 14 711 ϩ 1G Ͼ T 0.10 94.14 8 delI507 0.00 94.14 19 R1162X 0.00 94.14 22 R334W 0.00 94.14 4 621 ϩ 1G Ͼ T 0.00 94.14 15 R560T 0.00 94.14 18 G85E 0.00 94.14 9 R117H 0.00 94.14 13 R347P 0.00 94.14 17 3569delC 0.00 94.14 16 A455E 0.00 94.14 25 1078delT 0.00 94.14 Sum 94.14 a The order is based on that found for non-Hispanic Caucasians.3 b Based on between 57 and 503 chromosomes reported by the International Cystic Fibrosis Genetic Analysis Consortium.4 uals with cystic fibrosis, using a panel of 11 mutations. Login to comment
115 In an- Table 4 CFTR mutation frequencies among Asian American individuals with cystic fibrosis within the recommended minimum testing panel Ordera Mutation Mutation frequency (%) Heim et al.1b CF Foundationc Average Cumulative 1 delF508 18.80 59.09 38.95 38.95 10 3849 ϩ 10kbC Ͼ T 0.00 10.61 5.31 44.26 3 G551D 6.30 0.00 3.15 47.41 6 N1303K 0.00 1.52 0.76 48.17 8 delI507 0.00 1.52 0.76 48.93 2 G542X 0.00 0.00 0.00 48.93 4 621 ϩ 1G Ͼ T 0.00 0.00 0.00 48.93 5 W1282X 0.00 0.00 0.00 48.93 7 R553X 0.00 0.00 0.00 48.93 9 R117H 0.00 0.00 0.00 48.93 11 2789 ϩ 5G Ͼ A 0.00 0.00 0.00 48.93 12 1717 - 1G Ͼ T 0.00 0.00 0.00 48.93 13 R347P 0.00 0.00 0.00 48.93 14 711 ϩ 1G Ͼ T 0.00 0.00 0.00 48.93 15 R560T 0.00 0.00 0.00 48.93 16 A455E 0.00 0.00 0.00 48.93 17 3569delC 0.00 0.00 0.00 48.93 18 G85E 0.00 0.00 0.00 48.93 19 R1162X 0.00 0.00 0.00 48.93 20 2184delA 0.00 0.00 0.00 48.93 21 1898 ϩ 1G Ͼ A 0.00 0.00 0.00 48.93 22 R334W 0.00 0.00 0.00 48.93 23 I148T 0.00 0.00 0.00 48.93 24 3120 ϩ 1G Ͼ T 0.00 0.00 0.00 48.93 25 1078delT 0.00 0.00 0.00 48.93 Sum 25.10 72.74 48.93 a The order is based on that found for non-Hispanic Caucasians.3 b Based on 20 chromosomes. Login to comment
163 An interesting finding is that two mutations originally included in the ACMG minimum recommended panel (I148T and 1078delT) fall below the 0.1% level in a panethnic population initially chosen as a lower limit for inclusion. Login to comment
167 the I148T mutation/polymorphism have been discussed elsewhere.18 All of the results provided in the current study assume that each individual belongs to a single racial/ethnic group and that both of the partners belong to the same racial/ethnic group. Login to comment
173 For exam- Table 7 Estimated number of carriers of the 25 recommended CFTR mutations by racial/ethnic group and weighted average, representing the panethnic population in the United States for 2002 Order CFTR mutation Number of CFTR Mutation Carriers Panethnic frequency, % Non-Hispanic Caucasian Hispanic Caucasian African American Asian American Ashkenazi Jewish Total 1 delF508 64,779 8,207 4,272 886 796 78,940 66.31 2 G542X 2,039 770 141 0 191 3,141 2.64 5 W1282X 1,342 95 23 0 1,164 2,624 2.20 3 G551D 2,013 85 117 72 6 2,293 1.93 4 621 ϩ 1G Ͼ T 1,404 39 108 0 0 1,551 1.30 6 N1303K 1,136 251 34 17 70 1,508 1.27 7 R553X 778 424 225 17 0 1,444 1.21 8 delI507 787 103 181 0 6 1,077 0.90 10 3849 ϩ 10kbC Ͼ T 519 237 16 121 121 1,014 0.85 24 3120 ϩ 1G Ͼ T 72 24 928 0 3 1,027 0.86 9 R117H 626 17 6 0 0 649 0.55 12 1717 - 1G Ͼ T 429 41 36 0 17 523 0.44 11 2789 ϩ 5G Ͼ A 429 24 0 0 3 456 0.38 13 R347P 403 24 6 0 0 433 0.36 14 711 ϩ 1G Ͼ T 385 35 0 0 3 423 0.36 22 R334W 125 269 47 0 0 441 0.37 15 R560T 340 0 16 0 0 356 0.30 19 R1162X 206 88 64 0 0 358 0.30 17 3569delC 304 20 6 0 0 330 0.28 16 A455E 304 8 0 0 0 312 0.26 18 G85E 259 35 12 0 0 306 0.26 20 2184delA 152 24 5 0 3 184 0.15 21 1898 ϩ 1G Ͼ A 143 8 6 0 3 160 0.13 23 I148T 80 14 5 0 3 102 0.09 25 1078delT 18 14 0 0 0 32 0.03 All 79,072 10,856 6,193 1,113 2,389 99,684 84.00 Bolded numbers indicate mutations that are more likely to be found in a racial/ethnic group other than non-Hispanic Caucasians. Login to comment

PMID: 15371906 [PubMed] Kornreich R et al: "Premarital and prenatal screening for cystic fibrosis: experience in the Ashkenazi Jewish population."

No. Sentence Comment

54 Among the over 2,300 AJ screenees tested, one screenee was identified who carried R117H, one carried G551D and two carried I148T. Login to comment
55 The two I148T carriers were tested for the 3199del6 mutation by direct sequencing and were found to be negative for this putative-disease causing mutation.18-20 In the DY program, over 7,000 100% AJ individuals were screened for up to 87 mutations and only one screenee was found to be an I148T carrier and another was an 1898ϩ1GϾA carrier. Login to comment
62 The additional mutations that were detected were R117H (n ϭ 7), I148T (6), A455E (2), R334W (2), G551D (1), and R553X (1). Login to comment
86 For example, W1282X was the most prevalent mutation among Ashkenazi Jews, present in 46.4% of AJ carriers, whereas it was present in only 1.5% of non-Hispanic Caucasian CF patients.8 ⌬F508, the most common mutation in non-Hispanic Caucasian CF pa- Table 3 Frequency of CFTR mutations among screenees reporting 100% AJ or Ͻ 100% AJ descent who requested carrier testing for CF and at least one other AJ recessive disease CF mutation % of mutations in carriers reporting 100% AJ descent (n ϭ 45,530-117,145) % of mutations among carriers reporting Ͻ100% AJ descent (n ϭ 7,393) % of Non-Hispanic Caucasian CF patient chromosomes8 (n ϭ 37,263) W1282X 46.4 (n ϭ 117,136) 32.3 1.5 ⌬F508 27.1 (n ϭ 117,145) 35.7 71.5 D1152H 12.0 (n ϭ 44,530) 8.7 0.03 G542X 5.3 (n ϭ 117,140) 6.1 2.3 3849ϩ10kb CϾT 4.8 (n ϭ 117,135) 4.9 0.7 N1303K 3.8 (n ϭ 117,141) 3.0 1.3 1717-1GϾA 0.6 (n ϭ 60,191) 1.9 0.7 R117H a 2.7 0.8 I148T a 2.3 0.05 R334W - 0.76 0.16 A455E - 0.76 0.19 G551D a 0.38 2.5 R553X - 0.38 1.0 a These mutations were detected when screening Ϸ2,300 100% AJ individuals with the ACMG recommended panel. Login to comment
94 When MSSM and DY testing laboratories introduced expanded screening panels, several other CF mutations were found among AJ screenees; these were R117H, G551D, I148T, and 1898ϩ1GϾA. Login to comment
96 In addition, three screenees were found to carry I148T. Login to comment
97 However, the two individuals identified at MSSM were found to be negative for the 3199del6 mutation that presumably is the disease-causing mutation in cis with the I148T variant.18-20 Of the five individuals identified by DY who were compound heterozygotes for D1152H and W1282X, ⌬F508 or 3849ϩ10kb CϾT, anecdotal information from the two individuals from one family with the D1152H/W1282X genotype indicated a mild form of CF. Login to comment
107 Approximately half of the MSSM 100% AJ screenees were also tested for the ACMG 25 panethnic mutation panel and only two had another mutation, excluding I148T. Login to comment

PMID: 15371907 [PubMed] Monaghan KG et al: "Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study."

No. Sentence Comment

36 Requested testing for 3199del6 was performed using a laboratory-developed direct sequence analysis of exon 17a of the CFTR gene.13 Baylor College of Medicine CF direct mutation analysis was done using a matrix assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry platform (Sequenom), which includes the I148T and 3199del6 mutations. Login to comment
37 Greenwood Genetic Center CF studies for I148T were performed by PCR amplification followed by either laboratory-developed sequencing analysis or oligonucleotide ligation assay (CF OLA v3.0) (Celera Diagnostics/Abbott Diagnostics/Applied Biosystems). Login to comment
39 RESULTS A summary of the 3199del6- and/or I148T-positive patients identified is shown in Table 1. Login to comment
40 Data were collected on 662 un- Table 1 Summary of 3199del6 and/or I148T chromosomes identified among 663 individuals undergoing CF DNA testing Indication for DNA testing Race/Ethnicity I148T positive 3199del6 positive Carrier screen Caucasian 71 0 Unspecifieda Caucasian 128 0 Carrier screen Hispanic 8 0 Unspecifieda Hispanic 14 1 Carrier screen Middle Eastern 7 0 Unspecifieda Middle Eastern 6 0 Carrier screen Other 2 0 Carrier screen Asian 5 0 Unspecifieda Asian 14b 0 Carrier screen African American 3 0 Carrier screen Unspecified 47 0 Unspecifieda Other 3 0 Unspecifieda Unspecified 341 3 Subtotal 649 4 (0.6%) Fetus with echogenic bowel Middle Eastern 1 0 Fetus with echogenic bowel Asian 1 0 Male infertility Caucasian 1 0 Male infertility Unspecified 2 0 Rule-out CF Unspecified 6 0 Rule-out CF African American 1 0 Clinical CF Caucasian 1 1 Family history of CF mutation Armenian 1 1 Family history of a CF mutation Caucasian 1 0 Subtotal 15 2 (13.3%) Total 664 6 (0.9%) a The majority of persons undergoing CF DNA testing for an unspecified indication are presumably undergoing carrier screening. Login to comment
41 b 12 individuals were heterozygous for I148T, and 1 individual was I148T homozygous. Login to comment
42 related I148T heterozygotes and 1 I148T homozygote (total of 663 persons or 664 I148T chromosomes). Login to comment
43 Overall, we identified 6 unrelated individuals positive for both I148T and 3199del6 (0.9%). Login to comment
44 With the exception of Case 6 (Table 2), the phase of the I148T/3199del6 was not determined; however, they are presumed in-cis based on previous haplotype studies.9 These studies demonstrated that I148T occurs on a 7T or 9T background, whereas the I148T/3199del6 occurs on a 9T background. Login to comment
46 Excluding 15 cases referred for CF DNA testing because of a known or suspected diagnosis of CF (including fetal echogenic bowel and male infertility) or a positive family history, 0.6% of I148T carriers were positive for 3199del6. Login to comment
48 An unaffected I148T homozygote (Case 1) was detected during routine prenatal screening. Three males (cases 2-4) with congenital bilateral absence of the vas deferens (CBAVD) (I148T/ ⌬F508), obstructive azoospermia (I148T carrier), and infertility (I148T/S1235R) were identified, the latter 2 negative for 5T at the intron 8 polyT locus. Login to comment
49 We cannot exclude the possibility that finding I148T in the heterozygous state in a male with obstructive azoospermia (Case 3) is merely a coincidence. Login to comment
51 Case 5 was a fertile male, compound heterozygous for I148T and ⌬F508, who had a child identified by newborn screening as heterozygous for ⌬F508. Login to comment
53 Case 6, a female for whom no clinical information is available, was compound heterozygous for D110H and I148T/ 3199del6. Login to comment
54 Her son was noted to be positive for I148T/3199del6, confirming the haplotype in this family (assuming that his father is not a carrier for I148T or 3199del6). Login to comment
55 Case 7 had a clinical diagnosis of CF and was positive for V520F, a CF mutation associated with pancreatic insufficiency, and I148T/3199del6. Login to comment
56 Two fetuses with I148T and echogenic bowel were identified, both before the availability of 3199del6 reflex testing for I148T carriers. Login to comment
60 Parental CF DNA testing identified one parent as a carrier for ⌬F508, and the other had an unusual heteroduplex pattern in exon 4, which was later identified as I148T (before the availability of 3199del6 reflex testing). Login to comment
63 DNA testing performed after delivery was positive for I148T, but negative for ⌬F508. Login to comment
66 Sex Race Indication Genotype Poly T status Clinical information 1 Female Asian Carrier screening I148Ta /I148Ta12 9T/9T Asymptomatic 2 Male Not provided Infertility I148Ta /⌬F508 Not determined CBAVD 3 Male Not provided Infertility I148Ta heterozygote Negative for 5T Obstructive azoospermia 4 Male Caucasian Infertility I148Ta /S1235R20 7T/9T None available 5 Male Caucasian Family history of CF mutation I148Ta /⌬F508 9T/9T Fertile male who underwent carrier screening after the identification of ⌬F508 in the heterozygous form in his child during newborn screening, child`s mother is negative for 25 mutation ACOG/ACMG CF panel 6 Female Armenian Family history of CF mutation D110H/I148T (3199del6 positive) Not determined Clinical information on this individual is not available, despite multiple attempts to obtain. Login to comment
67 DNA testing on her son revealed I148T/3199del6 7 Not provided Caucasian Affected with CF V520F/I148T (3199del6 positive) Not determined None available 8 Prenatal test Middle Eastern Fetal echogenic bowel I148Ta carrier Not determined Healthy male reported at age 2 years. Login to comment
68 A subsequent pregnancy of this couple was diagnosed with ⌬F508/I148T (before the availability of 3199del6 reflex testing) and was terminated. Login to comment
71 pregnancy, performed by CVS was positive for ⌬F508 and I148T (again, prior to the availability of 3199del6 reflex testing). Login to comment
72 The parents were counseled regarding the inability to prenatally predict the course of symptoms and severity of CF, though ⌬F508 and I148T were typically associated with pancreatic insufficient (PI) CF. Login to comment
75 In 2003, 3199del6 reflex testing was performed, and the I148T carrier parent was negative for 3199del6. Login to comment
78 One parent was positive for I148T. Login to comment
83 However, due to the presence of fetal echogenic bowel, one parent a carrier of I148T (classified as a CF mutation at that time), and the other parent a carrier of a variant of unknown clinical significance, prenatal CF testing was performed by amniocentesis. Login to comment
85 CF testing was positive for I148T and M82I. Login to comment
94 DISCUSSION I148T results from a T to C substitution at nucleotide 575 in exon 4 of the CFTR gene. Login to comment
95 This sequence change was initially reported to the CF Consortium in 1990.1 I148T is located in the first cytoplasmic loop of the first membrane spanning domain of CFTR14 and results in the substitution of a hydrophobic amino acid, isoleucine, for a polar amino acid, threonine. Login to comment
96 This region is conserved in humans, mouse, and bovine.15 Despite the fact that functional studies revealed normal processing, gating, and conductance of the CFTR,14 I148T was considered to be a severe CF mutation due to its presence in patients with classic CF and a second pathological CF mutation.4,5,7 3199del6, a deletion of ATAGTG from nucleotide 3199, is located in CFTR exon 17a and results in the deletion of isoleucine and valine at codons 1023 to 1024 within the second membrane-spanning domain. Login to comment
97 3199del6 was reported to the CF Consortium in 1998 in a pancreatic insufficient CF patient with I148T and 3199del6onthesamechromosomeand⌬F508ontheotherchro- mosome.1 Another study noted a patient with severe CF and 3199del6 and I148T, though it is not noted specifically whether thesemutationsarein-cisorin-trans.16 3199del6alsooccursinthe absence of I148T, as a patient with severe CF has been reported with 3199del6 (negative for I148T) and G542X.17 Recent data suggests that 3199del6 is the deleterious mutation among I148T/3199del6 complex alleles.9 It is puzzling that early reports of patients with classic CF and I148T/⌬F508 did not identify 3199del6, despite the fact that 2 reports described performing mutation analysis of the entire CFTR coding region and splice site junctions either by a screening method (DDGE) or DNA sequencing.5,7 However, a recent report identified 3199del6 in 24 French-Canadian CF patients originally described as compound heterozygous for I148T and a severe CF mutation.11 Though there is little doubt that 3199del6 is a deleterious CF mutation, the clinical significance of I148T in the absence of 3199del6 is unclear, as we have identified this genotype in 3 males with infertility, two of the obstructive type. Login to comment
98 In 2001, I148T was included in the ACMG/ACOG CF panel due to its high incidence in the general population.2,3 However, recent data revealed that I148T accounts for Ϸ0.06% of CF chromosomes,9 less than the 0.1% frequency for inclusion in the CF screening panel. Login to comment
99 Therefore, based on its low frequency among CF patients and questions concerning the phenotype associated with I148T, its inclusion in the CF screening panel should be reconsidered. Login to comment
102 In our collaborative study of 663 I148T carriers, 0.9% also had 3199del6. Excluding subjects tested because of a suspected or clinical diagnosis of CF or positive family history, the frequency of 3199del6 decreased to 0.6%. Login to comment
103 We identified 7 unrelated individuals with I148T and a second CF variant, 2 of whom also carried 3199del6. Login to comment
107 One of her sons was subsequently found positive for I148T/3199del6. Login to comment
108 D110H is a rare CF sequence variant, originally reported in a mildly affected CF patient,18 and recently in homozygous form in an infant with metabolic alkalosis.19 The remaining I148T compound heterozygotes were negative for 3199del6. Login to comment
109 Among these include a fertile male with the genotype I148T/⌬F508 who underwent carrier screening due to the presence of a ⌬F508 in his child identified by newborn screening and an asymptomatic female, homozygous for I148T, identified by routine CF prenatal carrier screening. Three males with infertility were I148T positive. Login to comment
110 One with obstructive azoospermia was heterozygous for I148T, but no other mutation (including 5T) was detected. Login to comment
111 A male with unspecified infertility was compound heterozygous for I148T and S1235R (7T/9T)20 and a male with CBAVD was compound heterozygous for I148T and ⌬F508 (polyT status not determined). Login to comment
112 Two fetuses with echogenic bowel and I148T were identified, both before the availability of 3199del6 reflex testing; however, both I148T carrier parents were subsequently shown to be negative for 3199del6. Login to comment
113 One fetus was compound heterozygous for I148T and M82I, a previously unreported variant of unknown clinical significance. Login to comment
116 One parent was identified as a ⌬F508 heterozygote and the other with an unknown sequence change in exon 4, later identified as I148T. Login to comment
117 Their child was positive for I148T only and at age 2 was reported as healthy. Login to comment
118 This couple underwent prenatal CF testing for a subsequent pregnancy, and the fetus was identified as positive for ⌬F508 and I148T. Login to comment
119 After genetic counseling, which included the inability to prenatally predict the course of symptoms and severity of CF, although ⌬F508 and I148T were typically associated with PI CF, the couple chose to terminate the pregnancy. Login to comment
120 The I148T carrier parent in this relationship is now known to be negative for 3199del6. Login to comment
121 Our data supports previous findings that a small number of individuals with I148T are positive for 3199del6. Login to comment
122 The identification of 3 males with infertility and I148T (2 of the obstructive type and 2 who are compound heterozygous for I148Tand another CF mutation) cannot exclude the possibility that I148T alone may be associated with atypical or mild CF. Login to comment
124 Unfortunately, we were unable to obtain detailed information for all patients in whom I148T was identified; therefore, we cannot make reliable predictions on the phenotype of I148T alone. Login to comment
125 Reflex testing for 3199del6 should be considered whenever I148T is identified. Login to comment
126 Such testing is of particular importance in any patient with features of CF or whenever one member of a couple carries a deleterious CF mutation and the other member carries I148T. Login to comment
127 Further studies are necessary to determine if I148T, in the absence of 3199del6, is associated with mild or atypical CF, including male infertility. Login to comment
128 In summary, these data suggest that I148T is not an appropriate mutation for CF screening in the general population. Login to comment
130 We recommend that I148T be deleted from the CF screening panel and that 3199del6 not be added. Login to comment

PMID: 15371908 [PubMed] Buyse IM et al: "Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation."

No. Sentence Comment

0 Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: Evidence that 3199del6 is a disease-causing mutation Inge M. Buyse, PhD1 , Sarah E. McCarthy1 , Paul Lurix, PhD1 , Robert P. Pace, MS1 , David Vo1 , George A. Bartlett1 , Eric S. Schmitt, PhD, MS1 , Patricia A. Ward, MS1 , Christopher Oermann, MD2 , Christine M. Eng, MD1 , and Benjamin B. Roa, PhD1 Purpose: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. Login to comment
3 He is negative for I148T, or other mutations assessed by CFTR gene sequencing. Login to comment
7 The disease-causing CFTR gene lies on chromosome 7q31.2 and was cloned in 1989.1-3 The clinical spectrum ranges from a severe CF phenotype characterized by progressive lung disease, pancreatic insufficiency, male infertility, and elevated sweat chloride, to a milder presentation that includes congenital bilateral absence of the vas deferens (CBAVD) in males.4 Over 1300 CFTR mutations have been identified to date, wherein certain mutations are correlated with a mild or severe clinical phenotype.5 CF carrier screening for couples of reproductive age is recommended in the U.S. using a core panel of 25 common CF mutations.6 Although laboratories vary in the number of mutations and methodologies used for CF testing, many labs offer a CF testing panel that is applied to both carrier screening and diagnostic cases. One controversial component of the recommended panel is I148T, which was initially classified as a severe CF mutation. Login to comment
8 However, in vitro studies indicated that the major CFTR functions are retained by the I148T protein.7 Population screening studies revealed that the frequency of I148T is approximately 100-fold greater in asymptomatic carriers versus CF patients, which is more consistent with a benign variant than a disease-causing mutation.8,9 An in-frame deletion in exon 17a, 3199del6, was previously identified in association with I148T; moreover, I148T was found to be associated with a severe CF phenotype only when present in a complex haplotype of I148T/3199del6/9T, paired with a severe CF mutation on the opposite chromosome.4,8 The clinical significance of the 3199del6/I148 haplotype is unclear from the limited data available, because the few laboratories that test for 3199del6 mostly do reflex testing limited to patients who are positive for I148T. Login to comment
12 Moreover, our testing strategy evaluates each patient`s 3199del6 status independently of I148T, which is useful for refining genotype-phenotype correlations. Login to comment
18 An additional 11 patients who were previously identified as I148T carriers by allele-specific oligonucleotide (ASO) anal- From the 1 Medical Genetics Laboratories, Department of Molecular and Human Genetics, and the 2 Department of Pediatrics, Baylor College of Medicine, Houston, Texas. Login to comment
39 Statistical analysis The observed CF carrier frequency in our screening population, and the frequency of I148T in particular, were statistically compared to previously reported CF and I148T carrier frequencies8 using the Fisher exact test, with a two-sided P-value reported. Login to comment
45 positives (Freq) I148T 3199del6 4839 Carrier screening 173 (3.5% Ϸ1/28) 16 1 155 Diagnostic 30 (19.4% Ϸ1/5) 0 1 34 Parental/FEBa 3 (8.8%) 1 0 10 Prenatal study 5 (50%)b 0 0 53 Family history 20 (37.7%) 0 0 277 Not specified 10 (3.6%) 0 0 a Fetal echogenic bowel b Either heterozygous or homozygous positive for parental mutations. Login to comment
46 Table 2 Description of 28 identified I148T heterozygous individualsa No. Login to comment
47 Genotype Indication EthnicityI148T 3199del6 Others 1 ϩ - - Diagnostic Not specified 1 ϩ - ⌬F508 Parental FEBb Caucasian 18 ϩ - - Carrier screen Caucasian 1 ϩ - - Carrier screen Asian Indian 4 ϩ - - Carrier screen Not specified 2 ϩ - - Not specified Not specified 1 ϩ ϩ - Carrier screen Caucasian a Includes 17 I148T carriers found in a consecutive dataset by MALDI-TOF Mass Spectrometry (also contributed to ref 14), and 11 I148T carriers previously identified by ASO analysis. Login to comment
55 We observed a disproportionately high frequency of the I148T allele among heterozygous carriers with no family history (16/173 CF carriers), compared to patients referred with a definite or possible diagnosis of CF (0/155 CF patients). Login to comment
56 Our findings are consistent with significantly elevated I148T allele frequencies in asymptomatic carriers versus CF patients by previous reports.8,9 In addition, two patients out of 5368 consecutive cases were found to be positive for 3199del6 (Table 1), and details on these two cases are provided in the following sections. Login to comment
57 Description of I148T-positive individuals A composite group of 28 individuals who tested positive for the I148T allele is listed in Table 2. Login to comment
58 This group included 17 individuals in our consecutive dataset who were simultaneously tested for I148T and 3199del6, plus 11 additional I148T carriers who were previously identified by ASO and subsequently tested by MALDI-TOF. Login to comment
59 Population screening was the indication for testing among the majority of the I148T carriers (24 out of 28); among these, 23 I148T carriers tested negative for 3199del6. Login to comment
60 One individual of European Caucasian descent referred to our lab for carrier screening was genotyped positive for both I148T and 3199del6. Login to comment
61 However, the configuration of the I148T and 3199del6 alleles could not be determined on this asymptomatic individual because parental samples were not submitted for analysis. Login to comment
62 Of the four remaining I148T carriers who were referred for reasons other than carrier screening, one was a male patient with obstructive azoospermia who was heterozygous positive for I148T and negative for the 3199del6 and 5T alleles. Login to comment
64 She tested heterozygous positive for the I148T and ⌬F508 mutations, and negative for the 3199del6 and the 5T alleles (9T/9T). Login to comment
66 These findings are consistent with reports of apparently healthy individuals with a ⌬F508-positive, I148T-positive, and 3199del6-negative genotype.8,9 This individual`s spouse was also referred for testing and found to be negative for 51 CF mutations and the 5T allele (7T/7T). Login to comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment
103 Among unaffected individuals who tested positive on carrier screening, the I148T allele was found in approximately 9.2% of carriers (16/173), compared to Ϸ6.4% from the previously cited study8 (P ϭ 0.21). Login to comment
104 In contrast to carrier screening results, none of the 155 diagnostic cases tested by MALDI-TOF mass spectrometry were positive for I148T. Login to comment
105 This finding is consistent with the significantly elevated I148T frequency in carrier screens versus diagnostic cases,8,9 and the relatively small number of diagnostic tests in our study. Login to comment
106 This observed difference in frequency suggests that I148T is a benign variant, and that 3199del6 could instead represent the actual mutation. Login to comment
107 Up until now, limited data had been available for 3199del6 because systematic analysis was largely based on reflex testing of I148T-positive samples. Login to comment
109 In contrast, our assay tests for 3199del6 simultaneously with I148T in an extended panel for CF. Login to comment
113 The identification of a CF patient with a compound heterozygous 3199del6/G542X genotype represents the first report of 3199del6 that is not associated with I148T on a CF chromosome. Login to comment
114 This indicates that 3199del6 is a disease-causing mutation that can occur on a haplotype without I148T. Login to comment
116 In addition to our Hispanic CF patient, we identified an asymptomatic Caucasian individual who tested positive on carrier screening for 3199del6 and I148T (phase unknown). Login to comment
119 Our results provide additional support to the interpretation of I148T as a benign variant, although its interaction with the 3199del6 mutation is not fully delineated. Login to comment
120 These findings provide additional support for removing I148T from the ACMG recommended carrier screening panel for CF. Login to comment

PMID: 15371909 [PubMed] Edelmann L et al: "Cystic fibrosis carrier screening: validation of a novel method using BeadChip technology."

No. Sentence Comment

35 Mutation controls included DNA from previously identified positive patient samples (I148T, D1152H, W1282X, R117H, G85E, A455E, delF508, N1303K) and DNA from NIGMS Human Genetic Cell Repositories (Coriell Cell Repositories) (delF508, delI507, G542X, R560T, 3849ϩ10kbCϾT, N1303K, G85E; G551D, R553X, 621ϩ1GϾT, 1717-1GϾA, A455E, R334W, R347P, R1162X, 3659delC; 711ϩ1GϾT, 2789ϩ5GϾA, 3120ϩ1GϾA). Login to comment
46 Mutant ASOs were end-labeled with ␥-32 P-ATP and pooled into three subgroups (IA-IC) for Group I and four subgroups (IIA-IID) for Group II mutations with the following breakdown of mutations: IA: delF508, delI507, W1282X, R117H; IB: G542X, R560T, 3849ϩ10kbCϾT, N1303K, G85E; IC: G551D, R553X, 621ϩ1GϾT, 1717-1GϾA, I148T; IIA: A455E, R334W, D1152H; IIB: R347P, 1078delT, R1162X, 3659delC; IIC: 711ϩ1GϾT, 1898ϩ1GϾA, 2789ϩ5GϾA, 3120ϩ1GϾA; IID: 2184delA. Login to comment
160 I II III IV V VI VII VIII Totals Samples tested 87 57 69 72 66 35 72 61 519 Controls testedk 0h 17h 20 29 22 16 20 21 145 PCR Failuresi 4 4 2 1 1 2 1 3 18 (3.5%) Assay Failuresi 2 0 1 0 2 2 1 1 9 (1.7%) Positives 4a 3b 0 3c 4d 2e 2f 1g 19 (3.7%) a W1282X, delF508, D1152H, W1282X b delF508, delF508, D1152H c delF508, R117H, R117H d G542X, delF508, D1152H, N1303K (does not include proficiency samplesj ) e W1282X, delF508 f I148T, 3849ϩ10kbCϾT g I148T h Runs I and II were amplified with the same master mix and used the same control samples. Login to comment

PMID: 15536480 [PubMed] Modiano G et al: "A large-scale study of the random variability of a coding sequence: a study on the CFTR gene."

No. Sentence Comment

33 In the Tajima`s test,19 the null hypothesis of neutrality is rejected if a statistically significant difference between p Common and rare nonsynonymous and synonymous cSNSs G Modiano et al European Journal of Human Genetics Table 1 List of the 61 cSNSsa encountered in the present survey The random samples of genes (and the technique utilized) cSNS variants found NE Italy (DGGE) Central Italy (DGGE) Southern France (DGGE) Northern France (DHPLC) Spain (SSCA) Czechia (DGGE) Hb Â 104 Exon Exon Length (bp) Ref. no. SNS SASc 1st 100d 2nd 500 1st 100d 2nde 1st 100d 2nd 500 1st 100 2nde 82d 72 Abs. Freq. Total sample size q Â 104 se Â 104 NSf Sf 1g 53 0 0 0 0 0/452 0 924 2 111 1 223C4T R31C 1 1 1/500 1 1 0 0/450 0 5 (11) 1 932 (2 432) 45.23 13.61 90 2 224G4T R31L 0 0 0/500 0 0 0 1/450 0 1 1 932 5.17 5.17 10 3 257C4T S42F 0 0 1/500 0 0 0 0/450 0 1 1 932 5.17 5.17 10 3 109 4 334A4G K68E 1 0 0 0/498 0 0 0 0/452 0 0 1 2 504 3.99 3.99 8 5 352C4T R74W 0 0 0 0/498 0 0 0 1/452 0 0 1 2 504 3.99 3.99 8 6 356G4A R75Q 1 7 1 7/498 2 9 2 9/452 0 2 40 (40) 2 504 (2 544) 157.23 24.66 310 7 386G4A G85E 0 0 1 1/498 0 0 0 0/452 0 0 2 2 504 7.99 5.65 16 4 216 8 482G4A R117H 0 0 0 0/292 0 2 0 1/456 0 0 3 2 302 13.03 7.52 26 9 528T4G I132M 0 0 0 0/292 0 0 0 1/456 0 0 1 2 302 4.34 4.34 8 10 575T4C I148T 1 2 0 1/292 0 0 0 1/456 0 1 6 2 302 26.06 10.63 52 5 90 11 640C4T R170C 0 0 0 0/6 0 0 1/448 0 1 1 436 6.96 6.96 14 12 641G4A R170H 1 1 0 0/6 0 0 2/448 0 4 (4) 1 436 (1 930) 20.73 10.35 41 6a 164 0 0 0/6 0 0 0/432 0 0 992 6b 126 0 0 0/6 0 0 0/454 0 942 7 247 0 0 0/6 0 0 0/796 0 1 284 8 93 13 1281G4A L383 0 0 0 0/6 0 0 1/456 0 0 1 1 516 6.60 6.60 13 9 183 14 1402G4A G424S 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 15 1459G4T D443Y 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 10 192 16 1540A4G M470Vh 42 197 30 37/96 39 199 (i) (i) 27 571(736) 1 484 (1 912) 3849.37 111.28 4 735 17 1598C4A S489X 0 0 0 0/96 0 0 0 1/796 0 1 2 374 4.21 4.21 8 18 1648A4G I506V 1 0 0 0/96 0 0 0 0/796 0 1 2 374 4.21 4.21 8 19 1655T4G F508C 0 1 0 0/96 0 0 0 1/796 0 2 2 038 8.42 5.96 17 20 1716G4A Q528 2 16 1 0/96 0 19 i I 5 43 (58) 1 478 (2 024) 286.56 37.08 557 11 95 21 1756G4T G542X 0 2 0 0/134 0 0 0/796 0 0 2 1 984 10.08 7.12 20 22 1764T4G G544 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 23 1784G4A G551D 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 12 87 24 1816G4A V562I 0 0 0 0 1 0 0/450 0 0 1 (1) 2 004 (2 504) 3.99 3.99 8 25 1816G4C V562L 0 0 0 1 0 0 1/450 0 0 2 (3) 2 004 (2 504) 11.98 6.91 24 26 1859G4C G576A 1 2 0 1 11 0 8/450 0 0 23 (27) 2 004 (2 538) 106.38 20.36 213 13 724j 449 27 1997G4A G622D 0 0 0/80 0/96 1 0 0 0/444 0 1 2 002 5.00 5.00 10 28 2082C4T F650 1 0 0/80 0/20 0 0 0 0/444 0 1 (1) 1 926 (2 412) 4.15 4.15 8 29 2134C4T R668C 1 2 0/80 0/96 1 11 0 12/444 0 27(32) 2 002 (2 558) 125.10 21.98 247 275 30 2377C4T L748 0 0 0/6 0 1 1 388 25.77 25.77 52 14a 129 31 2670G4A W846X 0 0 0/6 0 1 0/452 0/80 0 1 1 010 9.90 9.90 20 32 2694T4G T854 33 23 0/6 33 38 149/452 14/80 11 301 1 010 2980.20 143.92 4 184 33 2695G4A V855I 0 0 0/6 0 0 1/452 0/80 0 1 1 010 9.90 9.90 20 14b 38 0 0 0 0/520 0 0 0 0/446 0 2 448 15 251 34 2816G4C S895T 0 0 0/6 0 0 2/436 0 0 2 996 20.08 14.18 40 35 2831A4C N900T 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 36 2988G4C M952I 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 37 3030G4A T966 (2)k (1)k 0 6/436 0 6 (25)k 618 (1814)k 137.82 27.37 272 38 3032T4C L967S 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 16 80 0 0 0/498 0 0 0/450 0 0 1 502 17a 151 39 3123G4C L997F 0 2 2 1/494 0 7 1 4/454 0 0 17 2 502 67.95 16.42 135 40 3157G4A A1009T 0 2 0 0/494 0 0 0 0/454 0 0 2 2 502 7.99 5.65 16 41 3212T4C I1027T 1 0 0 0/494 0 0 0 0/454 0 0 1 2 502 4.00 4.00 8 17b 228 42 3286T4G F1052V 1 1 0 1/194 0 0 0 0/452 0 0 3 (3) 2 200 (2 240) 13.39 7.73 27 43 3337G4A G1069R 0 1 0 0/194 0 0 0 0/452 0 0 1 2 200 4.55 4.55 9 CommonandrarenonsynonymousandsynonymouscSNSs GModianoetal 186 EuropeanJournalofHumanGenetics 44 3345G4T Q1071H 0 0 0 0/194 0 1 0 0/452 0 0 1 2 200 4.55 4.55 9 45 3417A4T T1995 1 3 0 0/194 1 1 0 0/452 0 0 6 (8) 2 200 (2 506) 31.92 11.27 64 46 3419T4G L1096R 0 0 0 0/194 1 0 0 0/452 0 0 1 2 200 4.55 4.55 9 47 3477C4A T1115 0 0 0 0/194 0 0 0 1/452 0 0 1 2 200 4.55 4.55 9 18 101 48 3523A4G I1131V 0 0 1 0/10 0 0 0/448 0 0 1 (2) 1 512 (1 908) 10.48 7.07 21 49 3586G4C D1152H 0 0 0 0/10 0 0 1/448 0 0 1 1 512 6.61 6.61 13 19 249 50 3617G4T R1162L 0 0 1 1/494 0 0/260 0 0/454 0 0 2 2 262 8.84 6.25 18 51 3690A4G Q1186 0 0 0 0/494 0 0/260 0 0/454 1 0 1 2 262 4.42 4.42 9 52 3813A4G L1227 0 1 0 0/494 0 0/260 0 0/454 0 0 1 2 262 4.42 4.42 9 53 3837T4G S1235R 1 1 0 1/494 0 4/260 0 7/454 0 1 15 (15) 2 262 (2 310) 69.94 16.71 140 20 156 54 4002A4G P1290 2 3 0/6 3 5 18/454 3/80 2 36 1 012 357.73 58.22 690 21 90 55 4009G4A V1293I 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 56 4029A4G T1299 1 0 0/6 0 1/300 0 1/456 0 0 3 (8) 1 316 (2 330) 34.33 12.12 69 57 4041C4G N1303K 1 0 0/6 0 0/300 0 0/456 0 0 1 1 316 7.60 7.60 15 58 4085T4C V1318A 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 22 173 0 0 0/18 0 0 0/450 0 0 1 022 23 106 0 0 0 0/6 0 0 0/448 0 1 436 24l 198+3 59 4404C4T Y1424 1 0 0/6 1 2 5/420 0 2 11 (32) 980 (2 516) 127.19 22.34 251 60m 4521G4A Q1463 (21) (16) (3/32) (14/80) (30) (94/420) 15/76 (17) 15 (227) 76 (1052) 2142.86 131.07 3 367 61 4563T4C D1477 0 0 0/6 0 1 0/420 0 0 1 980 10.20 10.20 20 Totals 6 525 9 584 16 109 The bracketed figures include also the RFLP analysis data (see Materials and methods); the NE Italy, Central Italy, Southern and Northern France are each subdivided into two samples where the 1st is made up of 100 genes. Login to comment

PMID: 15591474 [PubMed] Rodman DM et al: "Late diagnosis defines a unique population of long-term survivors of cystic fibrosis."

No. Sentence Comment

117 GENOTYPE DISTRIBUTION Early Diagnosis Late Diagnosis ⌬F508/⌬F508 10 1 ⌬F508/⌬I507 1 ⌬F508/G551D 1 ⌬F508/M1101K 1 ⌬F508/P67L/11027T 1 ⌬F508/3120G-A 1 ⌬F508/2789ϩ5G-A 1 2 ⌬F508/W1282X 1 ⌬F508/621ϩ1G-T 1 ⌬F508/R347P 1 ⌬F508/3849ϩ10kbC-T 1 1 ⌬F508/A455E 2 ⌬F508/R347H 2 ⌬F508/D1152H 1 ⌬508/I148T 1 ⌬F508/R117H 1 ⌬F508/Y109N 1 ⌬F508/IVS8-5T 1 ⌬F508/unknown 3 5 S1251N/D1152H 1 G542X/R117C 1 R117H/G551D 1 W1282X/D1152H 1 Unknown 4 4 Values represent number of individuals in each diagnostic group with each genotype. Login to comment

PMID: 15638824 [PubMed] Castaldo G et al: "Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population."

No. Sentence Comment

4 The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. Login to comment
33 The 13 mutations in this panel are: F508del, N1303K, G542X, W1282X, 2183AA>G, 1717-1G>A, R553X, I148T, R1158X, 711+1G>T, 4016insT, L1065P and G1244E. Login to comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
71 Finally, two CF patients carried the I148T and 3195del6 mutations in cis, giving rise to a "complex allele." Login to comment
72 Another CF patient from the study, and five CF carriers (data not shown), carried I148T without 3195del6 in cis. Login to comment
73 Different haplotypes are linked to I148T alone and to the I148T "complex allele" (see Table 2, group c). Login to comment
103 Two CF patients from the present study carried the I148T mutation in cis with the 3195del6 mutation; another CF patient, five patients with CBAVD, and five unrelated CF carriers from our population (data not shown), carried I148T not associated in cis with 3195del6. Login to comment
104 The chromosomes bearing I148T alone are linked to a different haplotype (of two or three loci) than those linked to the I148T-3195del6 complex allele; a crossover event may be responsible for this. Login to comment
106 It is not clear whether I148T alone is a disease-causing mutation, even though it was described in a CF patient in whom no other CFTR mutation was detected in the whole coding region (Bozon et al. 1994). Login to comment
107 Furthermore, it has been demonstrated that I148T alone alters the transport of HCO3 - across the apical membrane of epithelial cells (Ahn et al. 2001). Login to comment
109 Genetists Table 4 Mutations linked to different haplotypes due to recombinant or recurrent events, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) Present study Other studies Cases Haplotype Cases Haplotype (n) (n. of repeats) (n) (n. of repeats) references* I148T and 3195del6 2/2 23-7-17 3 23-7-17 2,3 (in cis) I148T 1/1 23-32-13 S549R (A>C) 1/1 23-33-13 1 16-33-13 2 1717-1G>A 13/13 16-7-17 23 16-7-17 1,2,3 2 16-30-13 1 1 16-32-13 1 R1158X 6/6 16-7-17 1/2 16-7-17 2 1/2 6-45-13 2 1/1 16-31-13 3 1/1 16-45-13 3 3849 +10kbC>T 5/5 23-31-13 2 23-31-13 1 1 16-14-31 4 1 16-7-17 1 3 16-46-13 2 1 16-17-19 2 1 17-31-13 2 E585X 2/2 16-7-17 1 16-32-13 2 1 17-31-13 2 1 16-7-16 see 2 3272-26G>A 1/1 15-7-17 1 16-32-13 1 4 16-7-17 5 L558S 1/1 16-32-13 1 16-32-13 1 1 15-7-17 1 2184 ins A 1/1 16-29-13 1 16-45-13 1 1 16-7-17 1 1 16-24-13 3 * References 1: Morral et al. 1996b. Login to comment

PMID: 15775760 [PubMed] Ruchon AF et al: "Frequency and phenotypic consequences of the 3199del6 CFTR mutation in French Canadians."

No. Sentence Comment

53 Frequency and phenotypic consequences of the 3199del6 CFTR mutation in French Canadians To the Editor: The observation of healthy individuals bearing a severe cystic fibrosis (CF) mutation and I148T in trans but not carrying the 3199del6 mutation has suggested that I148T is not a CF-causing mutation.1,2 Moreover, 3199del6-positive CF patients lacking I148T, compound heterozygous with another CF mutation, indicate that 3199del6 is the disease-causing mutation in the complex allele I148T-3199del6.2,3 Here, we report on the 3199del6 testing results in our cohort of I148T-positive individuals, the frequency of this deletion in the French Canadian population, as well as the phenotype of our 3199del6-positive patients. Login to comment
54 The presence of the 3199del6 mutation was determined in a cohort of 32 I148T-positive samples: 27 unrelated CF French Canadian patients, referred for corroboration of CF diagnosis, and 5 carriers (3 French Canadians, 1 Lebanese, and 1 adopted of unknown origin). Login to comment
57 The phase of I148T and 3199del6 was verified in 17 patients and, in all (100%), both variants occurred in cis (I148T- 3199del6complexallele).Ofthepatientsreferredforcarrierstatus determination, the three French Canadians also carried the deletion, whereas the two others, one Lebanese and one of unknown origin, did not. Login to comment
60 This I148T-3199del6 frequency is in contrast to the previously reported I148T frequency of 9.1% in French Canadians.5 Explanations for this frequency discrepancy could be as follows: a sample bias, because we receive patients from all Quebec regions and the previousreportanalyzedonlyFrenchCanadiansfromtheQuebec Cityarea;ormorelikely,thatthe2.2%reflectsthefrequencyofthe real CF-causing mutation, 3199del6, in French Canadians, which inthispopulationcomplexesinciswithI148T,whereas9.1%corresponds to the I148T polymorphism frequency. Login to comment
66 In only one patient (F508del/I148T-3199del6) was a pancreatic sufficiency phenotype observed. Login to comment
69 Altogether, our observations further demonstrate that the 3199del6 mutation is associated with a classical pancreatic insufficiency CF phenotype, consistent with the suggestion of Buyse et al.7 Previous studies have identified 3199del6 in 1.8%, 0.9%, and 0.6% of I148T heterozygous carriers and determined the frequency of 3199del6 in the general North American population to beϽ0.1%,belowthefrequencythresholdcriteriaforinclusionin the ACMG CF mutation screening panel.1,8,9 In this study, we reporta2.2%frequencyforthe3199del6mutationamongFrench Canadian CF chromosomes. Login to comment
70 As mentioned, only two I148T carriers (one Lebanese and one of unknown origin) tested negative for the 3199del6 mutation in our cohort of 32 unrelated I148T individuals. Login to comment
71 In other words, in our samples, all I148T French Ca- nadianallelesalsohadthe3199del6mutation,probablyreflecting a founder effect, and justifying its inclusion in routine CF testing/ screening in this ethnic group. Login to comment
73 The 2004 ACMG mutation panel revision recommends exclusion of I148T from the CF mutation panel.10 However, in the French Canadian population, I148T testing must be replaced by 3199del6 testing, which can be done using a simple PCR-based heteroduplex assay. Login to comment
74 If I148T testing is continued, then the data presented here strongly support 3199del6 testing for every I148T-positive result. Login to comment
76 Rohlfs EM, Zhou Z, Sugarman EA, Heim RA, Pace RG, Knowles MR et al. The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis. Login to comment
94 Frequency of the cystic fibrosis 3199del6 mutation in individuals heterozygous for I148T. Login to comment
96 Monaghan KG, Highsmith WE, Amos J, Pratt VM, Roa B, Friez M et al. Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: Results from a collaborative study. Login to comment
104 To diagnose most of the Table 1 Genotype-phenotype correlation of CF patients bearing the complex allele I148T-3199del6 Genotype No. of patients Age (y) Pancreatic status Sweat test Age at diagnosis Ethnicity F508del/I148T-3199del6 18 3 to 31 PI 88 to 154 Birth to 12y Fr Cdn I507del/I148T-3199del6 1 4 PI 106 2 months Fr Cdn 621ϩ1GϾT/I148T-3199del6 1 PI 105 Fr Cdn N1303K/I148T-3199del6 1 35 PI 18 months Fr Cdn F508del/I148T-3199del6 1 24 PS 142 4 months Fr Cdn A455E/I148T-3199del6 2 23/55 PS 130 16/20 y Fr Cdn I148T-3199del6/Unk. Mut. 1 5 PI 108 3 months Fr Cdn I148T-3199del6/Unk. Mut. 1 Fr Cdn F508del/I148T-3199del6 1 Fr Cdn PI, pancreatic insufficiency; PS, pancreatic sufficiency; Fr Cdn, French Canadian. Login to comment
81 Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

PMID: 15789152 [PubMed] Langfelder-Schwind E et al: "Cystic fibrosis prenatal screening in genetic counseling practice: recommendations of the National Society of Genetic Counselors."

No. Sentence Comment

133 In addition, mutations such as R117H and I148T have been found at unexpectedly high frequencies in healthy populations, suggesting that they are not completely penetrant (Rohlfs et al., 2002; Strom et al., 2002; Witt et al., 1996). Login to comment
169 Complex CFTR genotypes-where more than one CFTR mutation or variant is present in the same copy of the gene (in cis) and the presence or absence of that variant affects phenotype- characterize two common CFTR mutations, I148T and R117H. Login to comment
170 With an allele frequency of 0.1% among affected CF patients, I148T is included in the ACMG/ACOG recommended panel (Grody et al., 2001). Login to comment
171 After testing for I148T in the general population, it has become apparent that its frequency among apparently healthy individuals is 60-100 times that expected based on the CF affected population (Buller et al., 2004). Login to comment
172 In addition, several asymptomatic individuals (including fertile males) were identified as compound heterozygotes for I148T and other CF mutations (Rohlfs et al., 2002; Strom et al., 2002). Login to comment
173 These observations led to the identification of the 3199del6 allele whose presence in cis with the I148T allele influences phenotype (Rohlfs et al., 2002). Login to comment
174 Among 8 apparently healthy adults who were compound heterozygotes or homozygotes for I148T, all were negative for 3199del6. Login to comment
175 In contrast, 7 of 8 individuals with a suspected or confirmed clinical diagnosis of CF had the 3199del6 allele in cis with I148T and a second CF mutation on the other chromosome. Login to comment
176 I148T in the absence of 3199del6 appears to be a polymorphism, given its presence in apparently healthy adults who are compound heterozygotes. Login to comment
177 Further studies would be required to determine whether I148T alone with a CFTR mutation on the other chromosome is associated with single-organ or late onset expression of disease. Login to comment
178 Counseling for I148T positive individuals is therefore best done with knowledge of 3199del6 status. Login to comment
179 The ACMG Cystic Fibrosis Working Group has recommended the removal of I148T from the ACMG panel because 3199del6 is the pathogenic finding (Watson et al., 2004). Login to comment
182 As with I148T, the background contributes to the phenotypic expression. Login to comment

PMID: 15828773 [PubMed] Chen Y et al: "Parallel single nucleotide polymorphism genotyping by surface invasive cleavage with universal detection."

No. Sentence Comment

170 508 of the protein product.23 The CF mutations chosen in this study, ∆F508, G551D, W1282X, N1303K, R117H, R560T, 3849+10kbCT, V520F, R334W, and I148T, are a subset of the standard panel. Login to comment

PMID: 15860566 [PubMed] Krafft AE et al: "Time-motion analysis of 6 cystic fibrosis mutation detection systems."

No. Sentence Comment

43 These included 58 patient DNA samples initially characterized by CF Gold 1.0, of which 28 were wild type and 30 contained 1 of the following 16 mutant alleles: F508del, R553X, 2184delA, 3120 ϩ 1GϾA, I507del, G542X, G551D, W1282X, N1303K, 621 ϩ 1GϾT, R117H, 1717-1GϾA, R560T, R334W, R347P, and I148T. Login to comment
169 The INNO-LiPA was the only system to test for the 3199del6 allele, which is now believed to be the pathogenic mutation that occurs on a haplotype with I148T (4). Login to comment

PMID: 15891431 [PubMed] Rubenstein RC et al: "Novel, mechanism-based therapies for cystic fibrosis."

No. Sentence Comment

90 However, I148T, which is associated with a severe CF phenotype and pancreatic insufficiency, is defective in regulation of HCO3 ÿ transport, but transports Clÿ with similar efficiency to wild-type CFTR [63]. Login to comment

PMID: 15987793 [PubMed] Weiss FU et al: "Complete cystic fibrosis transmembrane conductance regulator gene sequencing in patients with idiopathic chronic pancreatitis and controls."

No. Sentence Comment

256 The reason why numbers for compound heterozygous ICP patients in these studies are diverse (4/67 = 6% in our study) may be due to differences Table 1 CFTR and SPINK1 sequence variations identified in 30 of the 67 ICP patients PatientSex CFTR mutation T allele TG repeats PSTI mutation 1 M DF508/R117H 7/7 9/10 -/- 2 W DF508/A1087P 7/9 10/11 -/- 3 M DF508/D1152H 7/9 10/10 -/- 4 M S1235R/R668C 7/7 11/12 -/- 5 M 2184insA/- 7/7 10/12 -/- 6 M R31C/- 7/7 10/11 -/- 7 M R75Q/- 7/7 11/11 -/- 8 M R347P/- 7/7 11/12 -/- 9 M S1235R/- 7/7 11/12 -/- 10 W S1235R/- 7/7 11/12 -/- 11 M G576A/- 7/7 10/10 -/- 12 W M348V/- 7/9 10/10 -/- 13 M V754M/- 7/7 10/11 -/- 14 M -/- 5/7 11/12 -/- 15 W -/- 5/7 11/12 -/- 16 M -/- 5/7 11/12 -/- 17 W -/- 5/9 11/12 -/- 18 M -/- 5/7 11/12 -/- 19 M -/- 5/7 10/10 -/- 20 W -/- 5/7 10/10 -/- 21 W -/- 5/7 11/12 N34S/- 22 W -/- 7/7 10/11 N34S/- 23 M -/- 7/9 10/11 N34S/- 24 M -/- 7/7 11/11 N34S/- 25 M -/- 7/7 11/11 N34S/- 26 W -/- 7/7 11/11 N34S/- 27 M -/- 7/7 11/11 N34S/- 28 W -/- 7/7 10/11 N34S/- 29 W -/- 7/7 11/11 P55S/- 30 W -/- 7/7 11/11 IVS3+2TC/- Table 2 CFTR sequence variations identified in 11 of 60 healthy controls Control group Number DF508/- 3 R117H/- 2 I148T/- 1 L997F/- 1 5T/12TG 1 5T/11TG 3 in patient recruitment, the catchment populations, or the stringency with which cystic fibrosis patients were excluded. Login to comment

PMID: 16088537 [PubMed] Luisetti M et al: "Genetics of idiopathic disseminated bronchiectasis."

No. Sentence Comment

42 Greek M/F 11/12 5/16 na Mean age (yrs) 53 Ϯ 15 53 Ϯ 14 na CFTR gene 1 G576A-R668C/L997F 1 ⌬F508/D192N 1 ⌬F508,I1027T mutation 1 ⌬F508/L997F 1 ⌬I507/3849 + 10kb C → T 1 D565G, R668C 1 ⌬F508/- 1 ⌬F508/3849 + 10kb C → T 1 T896I/- 1 R1066C/- 1 H949Y/T1220I 1 I148T/- 1 3667ins4/- 1 ⌬F508/- 1 ⌬F508/S977F 1 R75Q/- 1 2183AA→G 1 M1137V/- 1 L997F/- IVS8-5T 5 5/7 1 5/9 1 5/5 CFTR, cystic fibrosis transmembrane conductance regulator; na, not available. Login to comment

PMID: 16088579 [PubMed] Gallati S et al: "Genetics of cystic fibrosis."

No. Sentence Comment

50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment

PMID: 16191501 [PubMed] Chou LS et al: "A comparison of high-resolution melting analysis with denaturing high-performance liquid chromatography for mutation scanning: cystic fibrosis transmembrane conductance regulator gene as a model."

No. Sentence Comment

31 ❚Table 1❚ Mutations Analyzed in the Study Position From 5' Exon (or Intron) Genotype* No. of Samples Nucleotide Change SNP Class† End/Amplicon Size (bp) 3 394delTT 1 Del‡ - 132/234 4 R117H 1 G→A 1 83/270 Y122X 1 T→A 4 99/270 I148T 2 T→C 1 176/270 Intron 4 621+1 2 G→T 2 233/270 7 R334W 1 C→T 1 208/345 R347P 1 G→C 3 248/345 9 A455E 2 C→A 2 155/263 10 I507del 1 Del‡ - 171/292 F508del 3 Del‡ - 174/292 F508del/F508del 1 Del - 174/292 F508C 1 T→G 2 175/292 11 G542X 1 G→T 2 90/175 G542X/G542X 1 G→T 2 90/175 G551D 1 G→A 1 118/175 R553X 2 C→T 1 123/175 R560T 1 G→C 3 145/175 13 2184delA 1 Del‡ - 356/458 17b M1101K 1 T→A 4 196/292 21 N1303K 1 C→G 3 175/250 bp, base pairs; SNP, single nucleotide polymorphism. Login to comment
55 Mutations altering a wild-type G::C bp (R117H and 621+1) showed greater differences than those that altered a wild-type T::A bp (I148T). Login to comment
57 The sequenced wild-type control sample showed a single peak, whereas the 621+1 and I148T traces had multiple peaks. Login to comment
72 Such double peaks usually are interpreted as Temperature (°C) Fluorescence 79 80 81 82 83 84 85 86 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - R117H het C::A T::G WT G::C Temperature (°C) Fluorescence 79 80 81 82 83 84 85 86 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - 621+1 het C::T A::G WT G::C Temperature (°C) Fluorescence 79 80 81 82 83 84 85 86 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - I148T het C::A T::G WT T::A Time (min) Absorbance(mV) 0 1 2 3 20 - 19 - 18 - 17 - 16 - 15 - 14 - 13 - 12 - 11 - 10 - 9 - 8 - 7 - 6 - 5 - 4 - 3 - 2 - 1 - 0 - 621+1 het I148T het R117H het WT A B C D ❚Figure 1❚ High-resolution melting and denaturing high-performance liquid chromatography (dHPLC) analysis of exon 4 of the cystic fibrosis transmembrane conductance regulator gene. Login to comment
73 Melting data were normalized and temperature shifted as previously described.19 A, Heterozygous (het) R117H and the wild-type (WT) control sample. B, Heterozygous I148T and the WT control sample. C, Intronic heterozygous 621+1 G/T and the WT control sample. D,The dHPLC profile of heterozygous mutations in exon 4. Login to comment

PMID: 16202788 [PubMed] Rock MJ et al: "Newborn screening for cystic fibrosis in Wisconsin: nine-year experience with routine trypsinogen/DNA testing."

No. Sentence Comment

30 Mutations included in this assay are 2184delA, A455E, DI507, DF508, G542X, G551D, R553X, R560T, 1717-1G>A, R1162X, 3659delC, N1303K, W1282X, R334W, R347P, 1078delT, R117H, I148T, 62111G>T, 278915G>A, 3849110kbC>T, G85E, 109811G>A, 71111G>T and 312011G>A. Login to comment
56 §Eight cases of DF508/DF508, 1 case of DF508/312011G>A, 1 case of DF508/3849110kbC>T, 1 case of DF508/W1282X, 1 case of DF508/ R347P, 1 case of DF508/278915G>A, 1 case of DF508/I148T. Login to comment
64 Two alleles, with 1 being an R117H: 5 cases of DF508/R117H(7T/9T), 1 case of G542X/ R117H(7T/9T), 1 case of R117H/R117H(5T/7T), and 1 case of I148T/R117H(7T/9T). Login to comment
66 The sweat test values for these infants ranged from 20 to 40.8 mEq/L, with the exception of the infant with I148T/R117H(7T/9T), whose sweat chloride value was 11 mEq/L (testing for 3199del6 was not performed). Login to comment

PMID: 16251901 [PubMed] Pompei F et al: "Haplotype block structure study of the CFTR gene. Most variants are associated with the M470 allele in several European populations."

No. Sentence Comment

30 The T2A rate was much lower than 1 Frequencies of the CFTR variants within the M or the V alleles exon or intron VARIANT SITES in the M genes (MM subjects) in the V genes (VV subjects) A 5' UTR 125 g/c 8/144 (0.056) 3/356 (0.008) -80 1 2 R31C 5/226 (0.004) 1/576 (0.002) -56 in M genes in V genes 6 2 R75Q 1/226 (0.004) 15/576 (0.026) -51 M V (ttga)n 0.461 0.017 7 3 G85E 0/226 (0) 1/576 (0.002) -51 2.214 0.362 (tg)n 0.616 0.114 B i 3 406-6 t/c 0/226 (0) 6/576 (0.010) -29 (t)n 0.499 0.036 8 4 R117H 2/226 (0.009) 0/576 (0) -29 10 4 I148T 3/224 (0.013) 0/576 (0) -29 C i 4 621+3 a/g 1/224 (0.004) 0/576 (0) -29 12 5 R170H 1/158 (0.006) 0/402 (0) -26 D i 6a 875+40 a/g 6/36 (0.167)c 0/118 (0)c -25 i 6b (ttga)6 13/36 (0.361) 1/118 (0.008) -23 E i 6b 1001+11 c/t 5/60 (0.083) 0/166 (0) -23 F i 8 1341+28 c/t 1/152 (0.007) 0/464 (0) -18 i 8 (tg)10 39/76 (0.513) 5/218 (0.023) -11 i 8 (tg)11 21/76 (0.276) 205/218 (0.940) -11 i 8 (tg)12 16/76 (0.211) 8/218 (0.037) -11 i 8 t5 4/76 (0.053) 2/218 (0.009) -11 i 8 t7 48/76 (0.632) 214/218 (0.982) -11 i 8 t9 24/76 (0.316) 2/218 (0.009) -11 16 10 M470V H ex 10 F508del 3/226 (0.013) 0/572 (0) 0 19 10 F508C 0/226 (0) 1/572 (0.002) 0 20 10 1716g/a 15/226 (0.066) 0/572 (0) 0 21 11 G542X 1/158 (0.006) 0/400 (0) +28 24 12 V562I 1/226 (0.004) 0/576 (0) +30 25 12 V562L 1/226 (0.004) 0/576 (0) +30 26 12 G576A 3/226 (0.013) 0/576 (0) +30 28 13 2082c/t 1/104 (0.010) 0/226 (0) +32 29 13 R668C 3/224 (0.013) 0/562 (0) +32 32 14a 2694t/g 45/70 (0.643) 9/208 (0.043) +35 I i 14a 2752-15 c/g 0/226 (0) 5/576 (0.009) +44 37 15 3030g/a 1/158 (0.006) 7/402 (0.017) +44 O i 15 3041-71 g/c 5/226 (0.022) 0/576 (0) +47 39 17a L997F 1/226 (0.004) 4/576 (0.007) +51 40 17a A1009T 0/226 (0) 1/572 (0.002) +51 42 17b F1052V 1/226 (0.004) 0/572 (0) +52 43 17b G1069R 1/226 (0.004) 0/572 (0) +52 44 17b Q1071H 1/226 (0.004) 0/572 (0) +52 45 17b 3417a/t 0/226 (0) 4/572 (0.007) +52 46 17b L1096R 1/226 (0.004) 0/572 (0) +52 52 19 3813a/g 0/118 (0) 1/484 (0.002) +68 53 19 S1235R 3/100 (0.030) 0/294 (0) +68 54 20 4002a/g 5/56 (0.089) 1/168 (0.006) +83 q in the M alleles q in the V alleles 56 21 4029a/g 0/194 (0) 3/506 (0.006) +93 57 21 N1303K 1/92 (0.011) 0/272 (0) +93 59 24 4404c/t 3/226 (0.013) 14/576 (0.024) +107 60 24 4521g/a 21/56 (0.375) 2/172 (0.012) +107 "slow evolution" markers "fast evolution" markers (i.e. STRs) H is the sum of the degrees of heterozygosity of all the markers Ref.No.a ABSOLUTE AND RELATIVE FREQUENCIES distance from the M470V siteb (Kb) H associated with the…. Login to comment

PMID: 16639412 [PubMed] Haig D et al: "Congenital bilateral absence of the vas deferens and recombination at CFTR."

No. Sentence Comment

1 A conservative estimate of the region of 'extended haplotype homozygosity` that they report would extend from I148T (29 kb 50 of V470) to S1235R (68 kb 30 of V470). Login to comment

PMID: 16778595 [PubMed] Sun W et al: "CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype."

No. Sentence Comment

102 This comes to only a fraction (22%) of the individuals compound heterozygous for a CF mutation and the 5T variant (1/222) in that population.30 Previously,31 we described that the I148T CF mutation has a 113-fold increase in prevalence in our screening population when compared with a patient population with CF. Login to comment
103 An explanation for the differential pathogenicity of this apparently low penetrant mutation is that only 0.6% of the I148T alleles contains the 3199del6 mutation in exon 17a and 9T in IVS-8.29 Similarly, the penetrance of the 5T allele can also be caused by different gene background on which the variant arose. Login to comment

PMID: 16786510 [PubMed] Niel F et al: "A new large CFTR rearrangement illustrates the importance of searching for complex alleles."

No. Sentence Comment

13 Conversely, other mutations were initially reported as mutations because they were identified in CF patients, but are now reclassified as polymorphisms, as is the case for p.Ile148Thr (Rohlfs et al., 2002; Claustres et al., 2004). Login to comment

PMID: 16822950 [PubMed] Suaud L et al: "Abnormal regulatory interactions of I148T-CFTR and the epithelial Na+ channel in Xenopus oocytes."

No. Sentence Comment

1 First published 5 July 2006;Am J Physiol Cell Physiol Laurence Suaud, Wusheng Yan and Ronald C. Rubenstein oocytesXenopuschannel in+the epithelial Na Abnormal regulatory interactions of I148T-CFTR and You might find this additional info useful... 35 articles, 19 of which can be accessed free at:This article cites http://ajpcell.physiology.org/content/292/1/C603.full.html#ref-list-1 2 other HighWire hosted articlesThis article has been cited by [PDF][Full Text][Abstract] , April 1, 2007; 292 (4): C1553-C1561.Am J Physiol Cell Physiol Ronald C. Rubenstein Laurence Suaud, Wusheng Yan, Marcelo D. Carattino, Amal Robay, Thomas R. Kleyman and chloride transport is not necessary for inhibition of ENaC oocytes: evidence thatXenopusRegulatory interactions of N1303K-CFTR and ENaC in [PDF][Full Text][Abstract] , January , 2011; 300 (1): L88-L101.Am J Physiol Lung Cell Mol Physiol Yael Grumbach Ronald C. Rubenstein, Shannon R. Lockwood, Ellen Lide, Rebecca Bauer, Laurence Suaud and airway epithelial cells F508-CFTR in∆Regulation of endogenous ENaC functional expression by CFTR and including high resolution figures, can be found at:Updated information and services http://ajpcell.physiology.org/content/292/1/C603.full.html can be found at:AJP - Cell PhysiologyaboutAdditional material and information http://www.the-aps.org/publications/ajpcell This infomation is current as of August 8, 2011. Login to comment
7 It is published 12 timesAJP - Cell Physiology CALL FOR PAPERS Protein and Vesicle Trafficking, Cytoskeleton Abnormal regulatory interactions of I148T-CFTR and the epithelial Naϩ channel in Xenopus oocytes Laurence Suaud,1 Wusheng Yan,1 and Ronald C. Rubenstein1,2 1 Division of Pulmonary Medicine, Children`s Hospital of Philadelphia, and 2 Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania Submitted 23 February 2006; accepted in final form 30 June 2006 Suaud L, Yan W, Rubenstein RC. Abnormal regulatory interactions of I148T-CFTR and the epithelial Naϩ channel in Xenopus oocytes. Login to comment
12 We tested this hypothesis for I148T-CFTR, where the mutation is located in CFTR`s first intracellular loop. Login to comment
13 I148T-CFTR has been associated with a severe CF phenotype, perhaps because of defects in its regulation of bicarbonate transport, but it transports chloride similarly to wild-type CFTR in model systems (Choi JY, Muallem D, Kiselyov K, Lee MG, Thomas PJ, Muallem S. Login to comment
15 cRNAs encoding ␣beta␥-mENaC and I148T-CFTR were injected separately or together into Xenopus oocytes. Login to comment
18 Injection of I148T-CFTR cRNA alone yielded high levels of CFTR functional expression. Login to comment
19 In coinjected oocytes, mENaC functional and surface expression was not altered by activation of I148T-CFTR with forskolin/ IBMX. Login to comment
20 Furthermore, the CFTR potentiator genistein both enhanced functional expression of I148T-CFTR and restored regulation of mENaC surface expression by activated I148T-CFTR. Login to comment
21 These data suggest that the ability to transport chloride is not a critical determinant of regulation of mENaC by activated CFTR in Xenopus oocytes and provide further evidence that I148T-CFTR is dysfunctional despite maintaining the ability to transport chloride. Login to comment
33 We aimed to test these alternate hypotheses by examining the regulatory interactions of murine ENaC (mENaC) with I148T-CFTR. Login to comment
34 I148T is a rare mutation of CFTR where the mutation is localized in CFTR`s first cytoplasmic loop (CL-1). Login to comment
36 sickkids.on.ca/cftr), I148T can be associated with phenotypically severe, pancreatic-insufficient CF. Login to comment
37 However, this association has been questioned by others, because I148T-containing alleles from patients with CF can harbor a second mutation in cis, 3199del6, which causes deletion of I1023 and V1024, that may itself be sufficient to cause CFTR dysfunction (10). Login to comment
38 Interestingly, in heterologous cells in the absence of this second mutation in cis, I148T-CFTR appears to maintain the ability to transport chloride at levels similar to wild-type CFTR (WT-CFTR) but appears deficient in its ability to regulate HCO3 - transport (9); this defective regulation of HCO3 - transport is hypothesized to underlie the pancreatic dysfunction associated with this mutation in CF. Login to comment
39 Our data suggest that cAMP-activated I148T-CFTR has robust capability to conduct Address for reprint requests and other correspondence: R. C. Rubenstein, Division of Pulmonary Medicine, Children`s Hospital of Philadelphia, Abramson 410C, 34th St. and Civic Center Blvd., Philadelphia, PA 19104 (e-mail: rrubenst@mail.med.upenn.edu). Login to comment
49 Expression of human I148T-CFTR and mouse ENaC in Xenopus oocytes. Login to comment
50 Human I148T-CFTR was constructed by site-directed mutagenesis of WT-CFTR cDNA by using a PCR-based mutagenesis technique, and its sequence was confirmed by automated analysis in The Children`s Hospital of Philadelphia Nucleic Acid and Protein Core. Login to comment
51 I148T-CFTR and ␣beta␥-mENaC were expressed in Xenopus oocytes as previously described (16, 33, 34, 37). Login to comment
52 I148T-CFTR and mouse ␣-, beta-, and ␥-ENaC cRNAs were prepared using the mMESSAGE mMACHINE cRNA synthesis kit (Ambion, Austin, TX) according to the manufacturer`s protocol, and cRNA concentrations were determined spectroscopically. Login to comment
55 Each batch of oocytes obtained from an individual frog was injected using a Nanoject II microinjector (Drummond Scientific, Broomall, PA) with either ␣-, beta-, and ␥-subunits of mENaC (0.33 ng/subunit), I148T-CFTR (10 ng), or a combination of ␣beta␥-mENaC and I148T-CFTR cRNAs dissolved in RNase-free water (50 nl/ oocyte). Login to comment
65 I148T-CFTR was activated by perfusion of the oocyte with modified ND96 buffer containing 10 ␮M forskolin and 100 ␮M IBMX for 25 min (16, 33, 34, 37). Login to comment
67 In all experiments, chloride current carried by I148T-CFTR was defined as the difference between amiloride-insensitive current measured before and after perfusion with forskolin/IBMX (or before and after perfusion with forskolin/IBMX/genistein). Login to comment
73 cRNAs for ␣beta-V5␥-mENaC were either injected into Xenopus oocytes alone or coinjected with cRNA encoding I148T-CFTR. Login to comment
83 A two-tailed t-test was used when comparing currents obtained from oocytes injected with a cRNA for a single transporter (i.e., ␣beta␥-mENaC or I148T-CFTR) versus oocytes coinjected with cRNAs for both ␣beta␥- mENaC and I148T-CFTR. Login to comment
87 RESULTS Functional expression of I148T-CFTR in Xenopus oocytes. Login to comment
88 We used the Xenopus oocyte expression system and TEV technique to examine the functional expression of I148T-CFTR. Login to comment
89 Prior data suggest that I148T-CFTR exhibits intracellular maturation (as assessed by molecular weight shifts due to glycolytic processing) and functional chloride transport similar to that of WT-CFTR but is deficient in its ability to regulate HCO3 - transport (4, 9, 32). Login to comment
90 We measured whole cell currents at varying clamping potentials in oocytes injected with 10 ␮g of I148T-CFTR cRNA and generated current/voltage (I-V) curves from data obtained before and after 20 min of incubation with 10 ␮M forskolin and 100 ␮M IBMX to activate endogenous protein kinase A (Fig. 1A). Login to comment
91 I148T-CFTR had a CFTR-characteristic linear I-V relationship, and whole cell currents, measured at a holding potential of -100 mV, increased 28-fold from -0.12 Ϯ 0.02 to -3.42 Ϯ 1.18 ␮A (mean Ϯ SE, n ϭ 19, P Յ 0.001) in response to forskolin/IBMX. Login to comment
93 These data suggest that expression of I148T leads to robust forskolin/IBMX-stimulated chloride currents in oocytes that are similar in magnitude to those of WT-CFTR. Login to comment
94 C604 REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org onAugust,2011ajpcell.physiology.orgDownloadedfrom The isoflavone and CFTR potentiator genistein increases chloride transport by activated WT and mutant CFTRs, including ⌬F508-CFTR and G551D-CFTR (13, 33, 34). Login to comment
95 We assessed whether genistein would also enhance the function of I148T-CFTR. Login to comment
96 Figure 1B demonstrates the I-V relationship of I148T- expressing oocytes before and after incubation with 10 ␮M forskolin/100 ␮l IBMX for 25 min followed by incubation with 10 ␮M forskolin/100 ␮M IBMX/50 ␮M genistein for an additional 20 min. Login to comment
98 This enhancement of activated I148T-CFTR by genistein is similar in magnitude to the effect of genistein on WT-CFTR (ϳ2-fold; Ref. 34) but slightly smaller in magnitude compared with our previously observed enhancement of ⌬F508-CFTR-and G551D-CFTR-mediated currents by genistein (5.7and 4-fold, respectively) (33, 34). Login to comment
99 The forskolin/IBMX-stimulated currents mediated by I148T-CFTR were markedly reduced in Fig. 1B vs. Fig. 1A. Login to comment
102 Regulatory interactions of I148T-CFTR and ␣beta␥-ENaC. Login to comment
109 We therefore assessed the interregulation of I148T-CFTR and mENaC in oocytes. Login to comment
110 Figure 2 depicts whole cell currents measured at a holding potential of -100 mV in oocytes injected with I148T-CFTR (10 ng) or ␣beta␥-mENaC (0.33 ng/subunit) or both I148T-CFTR and ␣beta␥-mENaC cRNAs. Login to comment
111 Oocytes coinjected with I148T-CFTR and ␣beta␥-mENaC had no change in forskolin/IBMX-stimulated, amiloride-insensitive (I148T-CFTR-mediated) current compared with oocytes injected with I148T-CFTR alone [ICl ϭ -3.20 Ϯ 1.20 (I148T-CFTR, n ϭ 19) vs. -2.86 Ϯ 0.78 ␮A (I148T-CFTR/␣beta␥- mENaC, n ϭ 17), P ϭ not significant (NS); Fig. 2A]. Login to comment
112 Thus coexpression of ␣beta␥-mENaC in oocytes does not alter the functional expression of I148T-CFTR. Login to comment
115 Oocytes coinjected with both I148T-CFTR and ␣beta␥-mENaC expressed amiloride-sensitive whole cell currents before forskolin/IBMX stimulation (-0.32 Ϯ 0.10 ␮A, n ϭ 17) that were significantly lower than the amiloride-sensitive whole cell currents recorded under the same conditions in oocytes injected with ␣beta␥-mENaC alone (-2.06 Ϯ 0.62 ␮A, n ϭ 18, P ϭ 0.01). Login to comment
117 However, unlike WT-CFTR, activation of I148T-CFTR with forskolin/IBMX did not lead to a further Fig. 1. Login to comment
118 Expression of I148T-CFTR in Xenopus oocytes. Login to comment
119 A: I148T-CFTR was expressed in oocytes and two-electrode voltage clamp (TEV) was performed as described in EXPERIMENTAL PROCEDURES. Login to comment
122 B: I148T-CFTR was expressed in oocytes and TEV was performed. Login to comment
123 I-V relationships before stimulation of I148T-CFTR (F), after stimulation with 10 ␮M forskolin and 100 ␮M IBMX (E), and after stimulation with 10 ␮M forskolin, 100 ␮M IBMX, and 50 ␮M genistein () are shown. Login to comment
126 C605REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org reduction in ␣beta␥-mENaC-mediated amiloride-sensitive whole cell currents in coinjected oocytes (-0.32 Ϯ 0.10 ␮A before forskolin/IBMX vs. -0.40 Ϯ 0.13 ␮A after forskolin/IBMX, n ϭ 17, P ϭ NS; Fig. 2B). Login to comment
128 These data are therefore consistent with activated I148T-CFTR having defective regulatory interactions with ␣beta␥-mENaC in Xenopus oocytes despite maintaining a robust ability to transport chloride. Login to comment
130 Expression of I148T-CFTR and murine epithelial sodium channel ␣beta␥-subunits (␣beta␥-mENaC) in Xenopus oocytes. Login to comment
131 I148T-CFTR (10 ng of cRNA) and ␣beta␥-mENaC (0.33 ng cRNA/subunit) were expressed separately or together in oocytes, and TEV was performed as described in EXPERIMENTAL PROCEDURES. A: changes in whole cell currents that were not inhibited by 10 ␮M amiloride (-100 mV holding potential) in oocytes injected with I148T-CFTR alone or in oocytes coinjected with I148T-CFTR and ␣beta␥-mENaC after stimulation with 10 ␮M forskolin/100 ␮M IBMX are shown. Login to comment
132 B: amiloride-sensitive whole cell currents (-100 mV holding potential) were determined in oocytes expressing ␣beta␥-mENaC or coexpressing ␣beta␥-mENaC and I148T-CFTR before (open bars) and after (shaded bars) stimulation with 10 ␮M forskolin/100 ␮M IBMX. Login to comment
133 Data obtained from the same I148T-CFTR/␣beta␥- mENaC coinjected oocytes are shown in A and B. Values are means Ϯ SE. Login to comment
135 Influence of I148T-CFTR on surface and whole oocyte expression of mENaC. Login to comment
136 ␣beta␥-mENaC (0.33 ng cRNA/subunit) where the beta-subunit contained a COOH-terminal V5 epitope was expressed in oocytes without or with I148T-CFTR (10 ng of cRNA). Login to comment
150 As shown in Fig. 3A, mENaC(beta-V5) expression at the oocyte surface was unaltered by treatment with forskolin/IBMX in oocytes injected with ␣beta␥-mENaC alone and decreased after coinjection of I148T-CFTR in the absence of forskolin/IBMX activation. Login to comment
151 Furthermore, mENaC surface expression did not change upon activation of I148T-CFTR with forskolin/IBMX in coinjected oocytes. Login to comment
154 The whole oocyte content of mENaC(beta-V5) was not altered by acute treatment with forskolin/IBMX in oocytes injected with ␣beta␥-mENaC alone, was decreased by coinjection with I148T-CFTR cRNA, and was not further decreased upon activation of I148T-CFTR by forskolin/IBMX. Login to comment
157 These data are therefore consistent with I148T-CFTR, in the absence of activation, maintaining the ability to decrease the whole oocyte expression of mENaC. Login to comment
158 This decrease in whole oocyte expression in coinjected oocytes parallels the decrease in surface expression and may result from I148T-CFTR decreasing the synthesis of mENaC and its trafficking to the oocyte membrane or increasing the rate at which mENaC is degraded either before or after reaching the plasma membrane. Login to comment
159 Interregulation of I148T-CFTR and ␣beta␥ mENaC after IBMX/forskolin/genistein stimulation. Login to comment
160 We examined whether the CFTR potentiator genistein, which improves functional interactions between ␣beta␥-mENaC and the G551D-CFTR and ⌬F508-CFTR mutants (33, 34), is similarly able to restore I148T-CFTR`s regulatory interactions with mENaC. Login to comment
161 As shown in Fig. 4A, the amiloride-insensitive, or I148T-CFTR-mediated, component of the forskolin/IBMX/genistein-stimulated whole cell current in oocytes coexpressing I148T-CFTR and ␣beta␥-mENaC was 1.7-fold greater than the forskolin/IBMX/ gensitein-stimulated current measured in oocytes expressing I148T-CFTR alone (I148T-CFTR: -3.06 Ϯ 0.81 ␮A, n ϭ 21 vs. I148T-CFTR/␣beta␥-mENaC: -5.29 Ϯ 0.81 ␮A, n ϭ 23, P ϭ 0.005). Login to comment
162 As described above, I148T-CFTR-mediated currents were increased approximately threefold with the addition of genistein alone (Fig. 1B), and coinjected oocytes had no greater amiloride-insensitive forskolin/IBMX-stimulated currents than oocytes injected with I148T-CFTR alone (Fig. 2A). Login to comment
163 In contrast, I148T-CFTR/mENaC coinjected oocytes had ϳ5.5-fold greater current with addition of genistein (-5.29 Ϯ 0.81 ␮A, n ϭ 23) than in forskolin/IBMX-stimulated oocytes injected with I148T-CFTR alone (-0.97 Ϯ 0.31 ␮A, n ϭ 19). Login to comment
164 These data suggest synergistic enhancement of I148T-CFTR functional expression by genistein and ␣beta␥-mENaC in the presence forskolin/IBMX, and are qualitatively similar to our previous observations of synergistic activation of G551D-CFTR by genistein and ␣beta␥-mENaC (33). Login to comment
165 These data are therefore consistent with genistein improving the regulation of I148T-CFTR by ␣beta␥-mENaC in oocytes. Login to comment
167 Influence of genistein on the regulatory interactions between I148T-CFTR and ␣beta␥-mENaC. Login to comment
168 I148T-CFTR (10 ng of cRNA) and ␣beta␥-mENaC (0.33 ng cRNA/subunit) were expressed separately or together in oocytes, and TEV was performed as described in EXPERIMENTAL PROCEDURES. A: changes in whole cell currents (-100 mV holding potential) after stimulation with 10 ␮M forskolin/100 ␮M IBMX/50 ␮M genistein that were not inhibited by 10 ␮M amiloride. Login to comment
169 B: amiloride-sensitive whole cell currents (-100 mV holding potential) were determined in oocytes expressing ␣beta␥-mENaC or coexpressing ␣beta␥-mENaC and I148T-CFTR before (open bars) and after (shaded bars) stimulation with 10 ␮M forskolin/100 ␮M IBMX/50 ␮M genistein. Login to comment
170 Data obtained from the same I148T-CFTR/␣beta425;-mENaC coinjected oocytes are presented in A and B. Values are means Ϯ SE. Login to comment
171 C607REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org -4.44 Ϯ 1.12 ␮A (ϩforskolin/IBMX/genistein) n ϭ 17, P ϭ 0.048] in oocytes injected with ␣beta␥-mENaC alone (Fig. 4B). Login to comment
172 In oocytes coexpressing ␣beta␥-mENaC and I148T-CFTR, the amiloride-sensitive currents did not change following stimulation with forskolin/IBMX/gensitein [-0.82 Ϯ 0.17 ␮A (-forskolin/IBMX/gensitein) vs. -0.84 Ϯ 0.18 (ϩforskolin/IBMX/ genistein), n ϭ 23, P ϭ NS]. Login to comment
173 These data are similar to our previous observations with WT-, ⌬F508-, and G551D-CFTR, where this forskolin/IBMX/genistein stimulation in mENaC-mediated current observed in oocytes injected with ␣beta␥- mENaC alone was not present in CFTR/␣beta␥-mENaC coinjected oocytes; such data are consistent with improved regulation of ␣beta␥-mENaC by the forskolin/IBMX-activated mutant CFTRs in the presence of genistein (33, 34). Login to comment
174 We performed surface biotinylation and whole oocyte expression experiments to probe the mechanism by which genistein acts on mENaC and influences mENaC regulation by activated I148T-CFTR (Fig. 5). Login to comment
175 Data shown in Fig. 5A suggest that mENaC(beta-V5) expression at the oocyte surface was unaltered by treatment with forskolin/IBMX/genistein in oocytes injected with ␣beta␥-mENaC alone, was decreased with coinjection of I148T-CFTR in the absence of forskolin/IBMX/ genistein activation, and was further decreased upon activation of I148T-CFTR with forskolin/IBMX/genistein in coinjected oocytes. Login to comment
178 Furthermore, in coinjected oocytes, mENaC(beta-V5) surface expression acutely decreased upon activation of I148T-CFTR with forskolin/IBMX/genistein. Login to comment
180 These data are therefore consistent with genistein restoring the regulation of mENaC surface expression by activated I148T-CFTR. Login to comment
182 Similar to Fig. 3B, the whole oocyte content of mENaC(beta-V5) was not altered by acute treatment with forskolin/IBMX/genistein in oocytes injected with ␣beta␥- mENaC alone, was decreased by coinjection with I148T-CFTR cRNA, and was not further decreased upon activation of I148T-CFTR by forskolin/IBMX/genistein. Login to comment
183 These data are consistent with genistein not acutely altering whole oocyte expression of mENaC in oocytes injected with either ␣beta␥- mENaC alone or upon activation of I148T-CFTR in coinjected oocytes. Login to comment
186 ␣beta␥-mENaC (0.33 ng cRNA/subunit) where the beta-subunit contained a COOH-terminal V5 epitope was expressed in oocytes without or with I148T-CFTR (10 ng of cRNA). Login to comment
200 In the present study, we assessed the functional interactions of I148T-CFTR and mENaC to gain further insight into the mechanism underlying these interactions, as well as to examine in more detail potential functional defects in I148T-CFTR. Login to comment
201 These findings are discussed in the context of our group`s previous observations regarding the interactions of mENaC with WT-, ⌬F508-, and G551D-CFTR, which are summarized in Table 1. Login to comment
202 I148T-CFTR/mENaC functional interactions. Login to comment
203 Previous observations that I148T-CFTR maintains robust chloride transport function but may be clinically associated with a CF phenotype, perhaps because of an inability to regulate bicarbonate transport (9), prompted us to test the hypothesis that I148T-CFTR may also have defective interactions with ENaC. Login to comment
204 Of note, the I148T-CFTR construct used in this work, and in the work of Choi et al. Login to comment
205 (9), did not harbor a second mutation in cis, 3199del6, which causes deletion of I1023 and V1024, as has been described in patients with CF and an I148T allele. Login to comment
207 Thus any functional defects in I148T-CFTR noted in this or the previous studies regarding bicarbonate transport (9) are solely due to the I148T mutation and are not potentially confounded by a second mutation in cis. Login to comment
208 Our data confirm the observations of others (9) that I148T-CFTR maintains the ability to transport chloride at levels similar to WT-CFTR. Login to comment
209 However, despite this robust chloride transport, we found that I148T-CFTR had functional and regulatory interactions with mENaC that differed significantly from those of WT-CFTR previously observed by our group (34, 37). Login to comment
210 These data provide additional molecular support for the hypothesis that I148T-CFTR may be associated with a clinically apparent CF phenotype due to aberrant functional interactions with the transporters of other ions that result in defective regulation of transport of these other ions, such as Naϩ and bicarbonate, in epithelia. Login to comment
216 Furthermore, our present data suggest that forskolin/IBMX-stimulated I148T-CFTR does not acutely alter mENaC functional and surface expression despite the presence of robust ability to transport chloride. Login to comment
219 We have not directly measured changes in intracellular Cl- because of expression of WT- vs. I148T-CFTR in these experiments. Login to comment
220 However, it seems somewhat unlikely to us that intracellular Cl- would increase significantly more with activation of WT- vs. I148T-CFTR given the similar levels of whole oocyte CFTR-mediated current measured by TEV in the present study for I148T-CFTR and in our previous studies for WT-CFTR (34, 37). Login to comment
225 Wild type N/A Same Decrease* Decrease* Increased 34, 37 ⌬F508 NBD-1 Decreased No change No change No change 34 G551D NBD-1 Same Decrease No change Increased 33 I148T Intracellular loop 1 Same Decrease* No change* No change Present study WT, wild type; mENaC, murine epithelial sodium channel; NBD-1, nucleotide binding domain-1. Login to comment
227 C609REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org regulation, these data also implicate NBD-1 as a critical element in such regulation. Login to comment
228 That a similar NBD-1/R peptide fragment containing the G551D mutation (20) and the CFTR mutants G551D (33) and ⌬F508 (34) do not manifest forskolin/ IBMX-regulated inhibition of ENaC also suggests that a structurally and functionally intact NBD-1 is required for this regulatory interaction. Login to comment
229 At first glance, I148T-CFTR should have a structurally and functionally intact NBD-1, because this mutation is located within CFTR`s first cytoplasmic loop. Login to comment
230 One would therefore have predicted that I148T-CFTR should demonstrate forskolin/ IBMX-dependent inhibition of mENaC functional and surface expression. Login to comment
231 Since I148T-CFTR does not acutely decrease mENaC functional activity and surface expression upon stimulation, these data suggest either that domains of CFTR other than NBD-1 may be important in the regulatory interactions of CFTR and mENaC or that changes in CFTR`s first cytoplasmic loop may influence NBD-1 form and/or function. Login to comment
235 Genistein potentiates CFTR (WT, ⌬F508, and G551D) chloride transport by increasing channel open probability (1, 36). Login to comment
237 In the present study, we have demonstrated that genistein is able to potentiate chloride transport by I148T-CFTR, to enable mENaC to potentiate chloride transport by I148T-CFTR in a synergistic fashion, and to restore the ability of activated I148T-CFTR to acutely decrease the surface expression of mENaC in coinjected oocytes. Login to comment
238 These latter two observations suggest that genistein improves the regulatory interactions of I148T-CFTR with mENaC. Login to comment
239 These effects are similar to genistein`s actions to potentiate ⌬F508- and G551D-CFTR-mediated chloride transport and improve the regulatory interactions of these mutants with mENaC (33, 34). Login to comment
241 Our data suggest that genistein slightly increases mENaC functional expression without altering surface expression in the absence of CFTR but is also able to "repair" the regulatory interactions between I148T-CFTR and mENaC. Login to comment
242 If there is a common mechanism by which activated CFTR regulates HCO3 - transport and ENaC trafficking/surface expression, we can speculate that genistein may also repair regulation of HCO3 - transport by I148T-CFTR. Login to comment
243 In conclusion, we have demonstrated that I148T-CFTR has abnormal regulatory interactions with mENaC in Xenopus oocytes despite maintaining robust levels of chloride transport. Login to comment
245 These data provide further molecular and physiological evidence that the I148T mutation is associated with significant CFTR regulatory dysfunction and are consistent with I148T being a CF disease-causing mutation. Login to comment
134 Fig. 3. Influence of I148T-CFTR on surface and whole oocyte expression of mENaC. Login to comment
149 As shown in Fig. 3A, mENaC(beta-V5) expression at the oocyte surface was unaltered by treatment with forskolin/IBMX in oocytes injected with ␣beta␥-mENaC alone and decreased after coinjection of I148T-CFTR in the absence of forskolin/IBMX activation. Login to comment
153 The whole oocyte content of mENaC(beta-V5) was not altered by acute treatment with forskolin/IBMX in oocytes injected with ␣beta␥-mENaC alone, was decreased by coinjection with I148T-CFTR cRNA, and was not further decreased upon activation of I148T-CFTR by forskolin/IBMX. Login to comment
156 These data are therefore consistent with I148T-CFTR, in the absence of activation, maintaining the ability to decrease the whole oocyte expression of mENaC. Login to comment
166 I148T-CFTR (10 ng of cRNA) and ␣beta␥-mENaC (0.33 ng cRNA/subunit) were expressed separately or together in oocytes, and TEV was performed as described in EXPERIMENTAL PROCEDURES. A: changes in whole cell currents (-100 mV holding potential) after stimulation with 10 ␮M forskolin/100 ␮M IBMX/50 ␮M genistein that were not inhibited by 10 ␮M amiloride. Login to comment
176 Furthermore, in coinjected oocytes, mENaC(beta-V5) surface expression acutely decreased upon activation of I148T-CFTR with forskolin/IBMX/genistein. Login to comment
181 These data are consistent with genistein not acutely altering whole oocyte expression of mENaC in oocytes injected with either ␣beta␥- mENaC alone or upon activation of I148T-CFTR in coinjected oocytes. Login to comment
197 In the present study, we assessed the functional interactions of I148T-CFTR and mENaC to gain further insight into the mechanism underlying these interactions, as well as to examine in more detail potential functional defects in I148T-CFTR. Login to comment
199 I148T-CFTR/mENaC functional interactions. Login to comment
206 However, despite this robust chloride transport, we found that I148T-CFTR had functional and regulatory interactions with mENaC that differed significantly from those of WT-CFTR previously observed by our group (34, 37). Login to comment
213 Furthermore, our present data suggest that forskolin/IBMX-stimulated I148T-CFTR does not acutely alter mENaC functional and surface expression despite the presence of robust ability to transport chloride. Login to comment
217 However, it seems somewhat unlikely to us that intracellular Cl- would increase significantly more with activation of WT- vs. I148T-CFTR given the similar levels of whole oocyte CFTR-mediated current measured by TEV in the present study for I148T-CFTR and in our previous studies for WT-CFTR (34, 37). Login to comment
222 Wild type N/A Same Decrease* Decrease* Increased 34, 37 ⌬F508 NBD-1 Decreased No change No change No change 34 G551D NBD-1 Same Decrease No change Increased 33 I148T Intracellular loop 1 Same Decrease* No change* No change Present study WT, wild type; mENaC, murine epithelial sodium channel; NBD-1, nucleotide binding domain-1. Login to comment
224 C609REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org regulation, these data also implicate NBD-1 as a critical element in such regulation. Login to comment
226 At first glance, I148T-CFTR should have a structurally and functionally intact NBD-1, because this mutation is located within CFTR`s first cytoplasmic loop. Login to comment
234 In the present study, we have demonstrated that genistein is able to potentiate chloride transport by I148T-CFTR, to enable mENaC to potentiate chloride transport by I148T-CFTR in a synergistic fashion, and to restore the ability of activated I148T-CFTR to acutely decrease the surface expression of mENaC in coinjected oocytes. Login to comment
240 In conclusion, we have demonstrated that I148T-CFTR has abnormal regulatory interactions with mENaC in Xenopus oocytes despite maintaining robust levels of chloride transport. Login to comment

PMID: 17003641 [PubMed] Keiles S et al: "Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis."

No. Sentence Comment

71 Patients With 1 CFTR Mutation CFTR Mutation 1 No. of Patients 1717-1 G9A 1 2789+5 G9A 1 3849+10kb C9T 2 3849+45 G9A 1 621+3 A9G 2 A1364V 1 A349V 1 A455E 1 D1152H 1 D1445N 1 deltaF508 16 E217G 1 F1286C 1 F316L 1 G542X 1 G551D 1 I148T 1 I807M 1 L206W 1 L967S 2 L997F 2 P55S 1 Q179K 1 Q220X 1 R117H 3 R1453W 1 R297Q 1 R31C 1 R668C 2 S1235R 1 S573C 1 S945L 1 V562A 1 V754M 2 Y1092X 1 Total patients 58 MutationsinboldfacewouldnothavebeendetectedbytheACOG/ACMGmutationpanel. Login to comment

PMID: 17182731 [PubMed] Suaud L et al: "Regulatory interactions of N1303K-CFTR and ENaC in Xenopus oocytes: evidence that chloride transport is not necessary for inhibition of ENaC."

No. Sentence Comment

212 These data demonstrate synergistic enhancement of N1303K-CFTR functional expression by genistein and ␣beta␥-mENaC in the presence of forskolin-IBMX, and are similar to our previous data suggesting synergistic enhancement of G551D-CFTR (31) and I148T-CFTR (33) function by genistein and ␣beta␥-mENaC. Login to comment
253 In contrast, we recently demonstrated that activation of I148T-CFTR, which maintains the ability to transport Cl- at levels similar to WT CFTR (9, 33), did not lead to inhibition of mENaC in oocytes despite supporting significantly higher Cl-transport (33) than N1303K-CFTR did in the present experiments. Login to comment

PMID: 17204147 [PubMed] Rosendahl J et al: "Hereditary chronic pancreatitis."

No. Sentence Comment

99 However, the role of some CFTR mutations has to be reconsidered since Rohlfs et al. demonstrated that the mutation I148T in Exon 4, which was classified as a severe cystic fibrosis causing mutation, is not associated to cystic fibrosis. Login to comment
100 According to their data the complex allele 3199del6 and I148T seems to be the relevant factor [55]. Login to comment

PMID: 17489851 [PubMed] Tzetis M et al: "Contribution of the CFTR gene, the pancreatic secretory trypsin inhibitor gene (SPINK1) and the cationic trypsinogen gene (PRSS1) to the etiology of recurrent pancreatitis."

No. Sentence Comment

63 Nine patients (36%) were compound heterozygotes for two CFTR mutations, both mild (class IV or V): p.I148T/p.R75Q, c.278915G.A/p.R75Q or mild and severe: three with p.F508del/p.R334W and four withc.444delA/p.R334W,p.E822X/c.278915G.A, p.E822X/p.R347H and p.F508del/c.3272226A.G, each. Login to comment
84 It is especially of note that p.I148T in our patient cohort was not found linked to c.3199del6, which has been considered the classic CF causing allele (27). Login to comment
90 Mutations and variants in the CFTR gene CFTR mutation/variant Patients with pancreatitis, n ¼ 25 (%) Controlsa , n ¼ 211 (%) Classic patients with CF, n ¼ 426 (%) p vs controls p vs patients with CF p.F508del 5 (10) 2 (0.47) 465 (54.6) ,0.0001 ,0.0001 p.R334W 4 (8) - 7 (8.2) 0.00011 0.0019 c.444delA 1 (2) - 1 (0.1) c.278915G.A 2 (4) - 11 (1.3) 0.011 CFTRdel2,3 (21 kb) 1 (2) - 2 (0.2) c.E822X 2 (4) - 12 (1.5) 0.011 p.R347H 1 (2) - - 0.055 p.R1070Q 3 (6) 1 (0.24) 7 (0.8) 0.004 0.013 p.G576A 1 (2) - 1 (0.1) p.F1052V 1 (2) 4 (0.95) 1 (0.1) p.I148T 1 (2) - 1 (0.1) c.3272226A.G 1 (2) - 7 (0.82) p.R75Q 2 (4) 4 (0.95) 1 (0.1) 0.0086 c.2752215G/C 1 (2) 4 (1) 5 (0.6) TG11T7 26 (52) 286 (67.7) ND TG11T5 2 (4) 5 (1.18) ND TG10T7 8 (16) 79 (18.7) ND TG10T9 8 (16) 14 (3.3) ND 0.0005 TG12T7 2 (4) 8 (1.9) ND M470 6 (12) 48 (11.4) ND V470 8 (16) 166 (39.3) ND 0.008 CF, cystic fibrosis; ND, not determined. Login to comment

PMID: 17890437 [PubMed] Montgomery J et al: "Scanning the cystic fibrosis transmembrane conductance regulator gene using high-resolution DNA melting analysis."

No. Sentence Comment

145 2 223CϾT R31C 3 355CϾT R75X 386GϾA G85E 4 482GϾA R117H 575TϾC I148T 621 ؉ 1GϾTb 5 711 ؉ 1GϾT 7 1078delT 1132CϾT R334W 1150delA 1172GϾC R347P 8 1341 ϩ 18AϾCc 9 1496CϾA A455E 10 1651-1653del I507del 1653-1655del F508deld 11 1717 - 1GϾA 1756GϾT G542Xe 1784GϾA G551Db 1789CϾT R553Xf 1811GϾC R560T 12 1898 ؉ 1GϾA 13 2184delA 14b 2789 ؉ 5GϾAe 16 3120 ؉ 1GϾA 18 3500 - 2AϾTg 19 3616CϾT R1162X 3659delC Intron 19 3849 ؉ 10kbCϾTe 20 3978GϾA W1282X 21 4041CϾG N1303K 22 4178GϾA G1349Dc a Disease-causing variants recommended for genotyping by the ACMG (4) are in bold. Login to comment

PMID: 17949287 [PubMed] Lebo RV et al: "One multiplex control for 29 cystic fibrosis mutations."

No. Sentence Comment

167 The I148T mutation included in clone 1 is also detected on the same strip (Fig. 3, f1, left strip). Login to comment

PMID: 18616886 [PubMed] Tamburino L et al: "Molecular analysis of mutations and polymorphisms in the CFTR gene in male infertility."

No. Sentence Comment

136 Cystic fibrosis transmembrane regulator (CFTR) and IV.S8-Poly T genotypes according to semen parameters. Semen analysis Group 1 Total Group !l Total Group m TutuI Group IV Total CFTR genotype AF508/- AF508/- 2789+5G_^A/- N13O3K/- G542X/- - / - - / - - / - AF508/- AF508/R1I7H» NI3Ü3K/- 3849+ 10kbC_T/3849+1 O k b C ^ P - / - -/_ - / - AF5O8/- N1303K/- 3849+!0kbC-+T/- - / - - / - - / - - / - - / - - / - AF508/- N1303K/- 3849+10kbC->T/- I148T/- WI282X/- - / - - / - _/_ - / - - / - -/_ genotype 5T/9T 7T/9T 7T/7T 5T/9T 5T/9T 5T/7T 5T/9T 7T/7T 7T/9T 7T/9T 7T/9T 7T/7T 5T/7T 7T/7T 7T/9T 5T/9T 7r/7T 7T/9T 5T/5T 5T/7T 5T/9T 7T/7T 7T/9T 9T/9T 7T/9T 7T/9T 7T/7T 7T/9T 7T/7T 5T/5T 5T/7r 5T/9T 7T/7T 7T/9T 9T/9T No. Login to comment

PMID: 18685558 [PubMed] Dequeker E et al: "Best practice guidelines for molecular genetic diagnosis of cystic fibrosis and CFTR-related disorders--updated European recommendations."

No. Sentence Comment

149 I148T Was initially described as a frequent CF-causing mutation. Login to comment
151 I148T should not be routinely screened for and is currently being removed from the panels of commercial assays.25 R117H Can be found in cis with IVS8 (T)5 or (T)7. Login to comment

PMID: 18716917 [PubMed] George Priya Doss C et al: "A novel computational and structural analysis of nsSNPs in CFTR gene."

No. Sentence Comment

125 The nsSNPs which were predicted to be Table 1 List of nsSNPs that were predicted to be deleterious by SIFT and PolyPhen SNPs ID Alleles AA change Tolerance index PSIC rs1800072 G/A V11C 1.00 0.150 rs1800073 C/T R31C 0.18 2.288 rs1800074 A/T D44V 0.01 2.532 rs1800076 G/A R75Q 0.03 1.754 rs1800078 T/C L138P 0.01 2.192 rs35516286 T/C I148T 0.41 1.743 rs1800079 G/A R170H 0.05 1.968 rs1800080 A/G S182G 0.03 1.699 rs1800086 C/G T351S 0.30 1.600 rs1800087 A/C Q353H 0.03 2.093 rs4727853 C/A N417K 1.00 0.015 rs11531593 C/A F433L 0.65 0.694 rs1800089 C/T L467F 0.15 1.568 rs213950 G/A V470M 0.17 1.432 rs1800092 C/A/G I506M 0.00 1.574 rs1801178 A/G I507V 0.38 0.314 rs1800093 T/G F508C 0.00 3.031 rs35032490 A/G K532E 1.00 1.525 rs1800097 G/A V562I 0.13 0.345 rs41290377 G/C G576A 0.33 1.262 rs766874 C/T S605F 0.03 2.147 rs1800099 A/G S654G 0.03 1.611 rs1800100 C/T R668C 0.01 2.654 rs1800101 T/C F693L 0.61 0.895 rs1800103 A/G I807M 0.01 1.554 rs1800106 T/C Y903H 0.52 0.183 rs1800107 G/T S909I 0.10 1.624 rs1800110 T/C L967S 0.07 1.683 rs1800111 G/C L997F 0.24 1.000 rs1800112 T/C I1027T 0.03 1.860 rs1800114 C/T A1067V 0.04 1.542 rs36210737 T/A M1101K 0.05 2.637 rs35813506 G/A R1102K 0.52 1.589 rs1800120 G/T R1162L 0.00 2.038 rs1800123 C/T T1220I 0.22 0.059 rs34911792 T/G S1235R 0.45 1.483 rs11971167 G/A D1270N 0.12 1.739 rs4148725 C/T R1453W 0.00 2.513 Highly deleterious by SIFT and damaging by PolyPhen are indicated as bold deleterious in causing an effect in the structure and function of the protein by SIFT, PolyPhen and Pupasuite correlated well with experimental studies (Tsui 1992; Ghanem et al. 1994; Bienvenu et al. 1998) (Table 3). Login to comment

PMID: 18953248 [PubMed] Frulloni L et al: "Clinical and radiological outcome of patients suffering from chronic pancreatitis associated with gene mutations."

No. Sentence Comment

31 All patients were tested for 25 CFTR gene mutations ($F508, $I507, R117H, R1162X, 2183AAYG, N1303K, 3849 + 10KbCYT, G542X, G551D, 1717-1GYA, R347P, R352Q, R553X, Q552X, G85E, 711 + 5GYA, W1282X, 3272-26AYG, 3132delTG, R334W, I148T, 3659del_C, 3120 + 1GYA, 1898 + 1GYA, and 2789 + 5GYA), which cover approximately 72% of the cystic fibrosis mutations in the Italian population. Login to comment

PMID: 19092437 [PubMed] Moskowitz SM et al: "Clinical practice and genetic counseling for cystic fibrosis and CFTR-related disorders."

No. Sentence Comment

155 A longer TG tract (12 or 13) in conjunction Table 7 Molecular genetic testing used in CFTR-related disorders Test method Mutations detected Population Mutation detection rate (%) Targeted mutation analysis117,118 CFTR mutations using the original 25-mutation panela Ashkenazi Jewish 97 Non-Hispanic white 88.3 African American 69 Hispanic American 57 Asian American Unknown Sequence analysis73 CFTR sequence variantsb All groups 98.7 Deletion analysis CFTR exonic and whole gene deletions All groups Unknown a The original 25-mutation panel recommended by the ACMG includes the mutations listed in Table 3 as well as 1078delT and I148T.117 The 23-mutation panel recommended in 2004 is expected to have a similar mutation detection rate.7 Other panels may have significantly different mutation detection rates. Login to comment

PMID: 19372188 [PubMed] Bickmann JK et al: "A novel approach to CFTR mutation testing by pyrosequencing-based assay panels adapted to ethnicities."

No. Sentence Comment

86 The resulting PSQ assays targeted 44 CF/CBAVD mutations (potential detection of adjacent mutations not included) and 2 variations [I148T and 1342-6 (T)n (5T/7T/9T)]. Login to comment

PMID: 19491324 [PubMed] Caputo A et al: "Mutation-specific potency and efficacy of cystic fibrosis transmembrane conductance regulator chloride channel potentiators."

No. Sentence Comment

91 To this respect, we considered I148T, I175V, Q179K, and E193K in ICL1 (Seibert et al., 1997) and G970R in ICL3 (Seibert et al., 1996). Login to comment
99 In contrast, I148T and Q179K had a forskolin response that was 45 to 55% than that of the normal protein, a behavior that is not consistent with such amino acid changes being CF-causing mutations (Fig. 1A). Login to comment
222 However, I148T and Q179K activity was ϳ50% that of wild-type CFTR. Login to comment
224 In fact, it has been shown that I148T is in linkage disequilibrium with a deletion of two amino acids (3199del6) localized more distantly toward the carboxyl terminus (Rohlfs et al., 2002; Monaghan et al., 2004) and that this latter sequence change is the one causing CFTR loss of function. Login to comment
228 Therefore, it is possible that some mutations such as I175V and I148T have a more profound effect on CFTR as a regulator of other proteins (Schreiber et al., 1999). Login to comment

PMID: 19844201 [PubMed] Cavestro GM et al: "Connections between genetics and clinical data: Role of MCP-1, CFTR, and SPINK-1 in the setting of acute, acute recurrent, and chronic pancreatitis."

No. Sentence Comment

90 Seven patients were heterozygous for the ΔF508 gene mutation; one patient was compound-heterozygous for the I148T and 711+1GtoT gene mutations. Login to comment
114 Endogenous and exogenous factors in ARP patients Sex Age Pancreas divisum SPINK-1 N34S mutation CFTR gene mutations MCP-1 G polymorphism Alcohol ≤10g/day Alcohol 10-40g/day Alcohol >40g/day M 39 Yes wt/wt No G/G (10-40) M 18 No N34S/wt No A/G ≤10 F 20 Yes wt/wt No A/G ≤10 F 27 No wt/wt No A/G ≤10 M 39 No wt/wt delF508/wt A/G (10-40) M 26 No wt/wt No A/G >40 M 30 No wt/wt No A/G ≤10 M 49 No wt/wt No A/G (10-40) F 33 Yes wt/wt No A/G ≤10 F 22 No wt/wt No A/G ≤10 F 31 Yes wt/wt No A/G ≤10 M 74 No wt/wt No A/G ≤10 F 35 No wt/wt No A/G ≤10 M 33 No wt/wt delF508/wt A/G ≤10 M 46 No wt/wt No A/G ≤10 M 40 No wt/wt No A/G ≤10 F 60 No wt/wt No G/G ≤10 M 50 No wt/wt No A/G ≤10 F 43 No wt/wt No A/G ≤10 M 23 No wt/wt No A/G ≤10 M 23 No wt/wt No A/G >40 F 55 No wt/wt No A/G ≤10 M 48 No wt/wt No A/G ≤10 M 50 No wt/wt No A/G >40 M 37 No wt/wt No A/G >40 M 33 No wt/wt delF508/wt A/G >40 F 33 No wt/wt No A/G ≤10 F 36 No wt/wt No G/G ≤10 F 64 No wt/wt delF508/wt A/G ≤10 M 28 No wt/wt No A/G (10-40) M 68 No wt/wt No G/G ≤10 F 46 No wt/wt No G/G ≤10 M 22 No wt/wt No A/G (10-40) F 21 No wt/wt delF508/wt A/G ≤10 M 37 No wt/wt I148T/wt and 711+1GtoT/wt A/G >40 F 34 No wt/wt No A/G ≤10 M 62 No delF508/wt A/G (10-40) F 32 No wt/wt No A/G ≤10 M 31 No wt/wt delF508/wt A/A ≤10 M 34 Yes wt/wt No A/A ≤10 ARP, acute recurrent pancreatitis. Login to comment
125 Furthermore, we found that 18 ARP patients (28.1%) were alcohol consumers with a mean intake of 57.1±48.8g/day. Only five (7.8%) of them had daily alcohol intake≥80g/dayandtheyallpossessedtheGalleleoftheMCP-1 gene. Two of these patients also had the CFTR heterozygous genemutation:onewithΔF508mutationandtheotheronewith compound heterozygosity (I148T; 711+1GtoT). Login to comment

PMID: 19893581 [PubMed] Forzan M et al: "Is CFTR 621+3 A>G a cystic fibrosis causing mutation?"

No. Sentence Comment

11 An example is the I148T variant initially reported as a CF mutation, which is now considered a non-pathogenic nucleotide change.3 We have chosen to study the 621+3 A4G nucleotide change because one of us had tested positive for this variant during a CFscreening program. Login to comment
92 However, this technique cannot detect heterozygous deletions of individual exons, that may be present in up to 60% of classic CF patients in whom a single-point mutation is detected.20 This case is similar to that of the I148T variant, which by itself is not a CF disease-causing mutation, but in some patients it is found in cis with the 3199del6 mutation.21 Extensive analysis of CFTR, including gene rearrangements, should be performed in all patients with typical CF symptoms harboring the 621+3 A4G allele, to identify a possible other mutation in cis with this variant, which could account for the severe phenotype. Login to comment
139 21 Monaghan, K. G., Highsmith, W. E., Amos, J., Pratt, V. M., Roa, B., Friez, M. et al. Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study. Login to comment
101 3 Claustres, M., Altieri, J. P., Guittard, C., Templin, C., Chevalier-Porst, F. & Des Georges, M. Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

PMID: 19897426 [PubMed] Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."

No. Sentence Comment

111 Differently from previous reports, point mutation I148T was never found in close association with 3199del6 and similarly 3601-111 G→C with 1811+1,2KB A→G. Login to comment
130 Recently, a study of 335,204 patients screened for their CF carrier status revealed 4 individuals with Table 3 Frequency of less common CFTR mutations in the general population. Mutation Frequency Reference S1235R 1/77 [22,23] L997F 1/77 [24] I148T 1/129 [19] F1052V 1/200 [25] 621+3A→G 1/335 [26] 3601-111 G→C 1/690 [27] Table 4 New CFTR mutations found in the general population following 2nd level analysis. Login to comment
137 In North America, for example, missense mutations I148T and D1270N were found N100 and N200 times, respectively, more frequently in CF carriers than in patients. Login to comment
140 Similarly, I148T was shown to be associated with a CF phenotype only when associated with mutation 3199del6 on the same gene [19]. Login to comment

PMID: 20021716 [PubMed] Gallati S et al: "Cystic fibrosis transmembrane conductance regulator mutations in azoospermic and oligospermic men and their partners."

No. Sentence Comment

81 In 70 women whose partners had tested positive for either CFTR mutations or 5T alleles, extended screening of the CFTR gene was also performed revealing a mutation spectrum similar to that of oligospermic men including four 5T alleles, three S1235R, three F508del and one I148T, V754M, V920M, D1152H, 3905insT and Q1352H each (Table 1). Login to comment
99 Couple no. Infertile male CFTR mutation Female partner CFTR mutation Offspring genotype Risk for genotype (%) 01 F508del/wt azoospermia F508del/wt F508del/ F508del 25 F508del/wt 50 wt/wt 25 02 F508del/T5 CAVD F508del/wt F508del/ F508del 25 F508del/T5 25 F508del/wt 25 T5/wt 25 03 F508del/S13Ya azoospermia T5/wt F508del/T5 25 S13Y/T5 25 F508del/wt 25 S13Y/wt 25 04 I148T/wt oligospermia F508del/wt F508del/ I148T 25 I148T/wt 25 F508del/wt 25 wt/wt 25 05 1717À1G>A/wt oligospermia T5/wt 1717À1G>A/ T5 25 1717À1G>A/ wt 25 T5/wt 25 wt/wt 25 06 T5/wt oligospermia 3905insT/wt 3905insT/T5 25 3905insT/wt 25 T5/wt 25 wt/wt 25 07 T5/wt azoospermia D1152H/wt D1152H/T5 25 D1152H/wt 25 T5/wt 25 wt/wt 25 08 T5/F1052V oligospermia S1235R/wt F1052V/ S1235R 25 S1235R/T5 25 F1052V/wt 25 T5/wt 25 09 S1235R/wt oligospermia T5/wt S1235R/T5 25 S1235R/wt 25 T5/wt 25 wt/wt 25 10, 11 T5/wt oligospermia S1235R/wt S1235R/T5 25 S1235R/wt 25 T5/wt 25 wt/wt 25 12 V754M/wt oligospermia T5/wt V754M/T5 25 V754M/wt 25 T5/wt 25 wt/wt 25 13 T5/wt oligospermia Q1352H/wt Q1352H/T5 25 Q1352H/wt 25 T5/wt 25 wt/wt 25 (continued on next page)(continued) female partner is a carrier. Login to comment
117 Based on discriminant analysis, this study predicts a high probability for the presence of CFTR mutations especially in patients with reduced ejaculate volumes (<3 ml) and structural abnormalities such as CAVD, inguinal hernia, hypotrophic testes or cryptorchidism, confirming former findings reported by Casals et al. (2000) and representing symptoms that are also frequently observed in Table 3 (continued) Couple no. Infertile male CFTR mutation Female partner CFTR mutation Offspring genotype Risk for genotype (%) 14 R31C/wt oligospermia V920M/wt R31C/V920M 25 R31C/wt 25 V920M/wt 25 wt/wt 25 15 R31C/wt azoospermia I148T/wt R31C/I148T 25 R31C/wt 25 I148T/wt 25 wt/wt 25 16 V754M/wt oligospermia V754M/wt V754M/V754M 25 V754M/wt 50 wt/wt 25 Bold = mutations associated with classic cystic fibrosis; italic = mutations associated with a mild or uncertain, unpredictable phenotype; CAVD = congenital absence of the vas deferens; wt = wildtype allele. Login to comment

PMID: 20059485 [PubMed] Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"

No. Sentence Comment

64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment
157 Also, prediction tools will fail to account for missense mutations that are found as complex alleles (29) such as I148T (30), which subsequently was shown to be a neutral mutation, which cosegregates with a bona fide disease-causing deletion 3199del6 in exon 20 (31). Login to comment

PMID: 20167849 [PubMed] Bienvenu T et al: "Cystic fibrosis transmembrane conductance regulator channel dysfunction in non-cystic fibrosis bronchiectasis."

No. Sentence Comment

58 In DB-1, 12 patients carried a severe loss-of-function mutation: 3 patients carried a class 1 mutation (G542X, 2183AA.G, and W1282X), and 9 patients carried the F508del class 2 mutation; 10 patients carried a mild mutation predicted to retain some residual CFTR function: 7 patients carried the IVS8-5T class 5 mutation, and 3 patients carried a class 4 mutation (S1235R, R347P-I148T, and R117H-7T) (Table 1). Login to comment
79 GENOTYPE AND PHENOTYPE OF PATIENTS WITH DIFFUSE BRONCHIECTASIS BEARING ONE CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR MUTATION Patient No. Age (yr) Sex (M/F) CFTR Mutation Sweat Cl2 (mmol/L) Basal PD (mV) NPD Index Age at Onset (yr) FEV1 (% pred) Bacterial Colonization 1 46 F F508del/2 10 215 0.44 20 124 Pa 2 51 M S1235R/2 8 219 0.56 10 40 Sa/Pa 3 19 F R347P-I148T/2 13 219 0.48 10 91 None 4 31 F F508del/2 35 220 0.20 2 76 None 5 34 M IVS8-5T/2 10 221 0.51 2 27 None 6 49 F IVS8-5T/2 15 222 0.30 40 92 None 7 20 F IVS8-5T/2 13 223 0.42 16 90 None 8 38 M F508del/2 9 224 0.85 20 ND None 9 65 M F508del/2 21 224 0.88 60 99 None 10 52 F F508del/2 20 226 0.37 5 91 Pa 11 72 F G542X/2 15 226 0.37 40 68 None 12 67 F IVS8-5T/2 26 226 0.82 40 97 None 13 51 F W1282X/2 17 228 0.12 29 27 Pa 14 59 M R117H-7T/2 31 229 0.88 49 89 None 15 56 F F508del/2 17 230 0.41 40 75 None 16 49 F F508del/2 21 232 0.58 45 67 None 17 46 F 2183AA.G/2 23 233 0.26 45 132 None 18 19 F IVS8-5T/2 19 234 0.45 5 82 None 19 70 M IVS8-5T/2 20 238 0.34 50 64 None 20 22 F F508del/2 25 241 0.86 20 82 Sa 21 77 M IVS8-5T/2 26 242 1.00 65 86 None 22 73 M F508del/2 21 245 0.91 25 70 Pa Definition of abbreviations: Cl2 5 chloride; F 5 female; M 5 male; ND 5 not determined; NPD index 5 nasal potential difference index 5 e(response to øCl2 and iso/response to amil); a cut off . Login to comment

PMID: 20494257 [PubMed] Dungan JS et al: "Carrier screening for cystic fibrosis."

No. Sentence Comment

150 The Society of Obstetricians and Gynaecologists of Canada has stated routine CF carrier screening ''cannot be recommended at this time.``22 Two mutations were subsequently deleted from the original 2001 recommendation as a result of further epidemiologic data.13 The I148T mutation was subsequently found not to be disease causing (it was originally considered so because of the erroneous perception of its frequent appearance with 3199del6, a rare, but confirmed CF mutation). Login to comment

PMID: 20638569 [PubMed] Goetzinger KR et al: "An update on cystic fibrosis screening."

No. Sentence Comment

47 Based on this review, 2 mutations (1078delT and I148T) were removed from the standard screening panel, narrowing it to include only 23 mutations. Login to comment

PMID: 20657600 [PubMed] Giuliani R et al: "Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols."

No. Sentence Comment

58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

PMID: 20691141 [PubMed] Tomaiuolo AC et al: "Clinical hallmarks and genetic polymorphisms in the CFTR gene contribute to the disclosure of the A1006E mutation."

No. Sentence Comment

14 Moreover, molecular diagnosis of CF, particularly for non-classical CF or CFTR-related diseases, involves rare mutations and requires extensive gene sequencing, a time consuming and costly approach.2 In order to overcome this problem, many attempts have been ORIGINAL RESEARCH made to use linkage analysis of polymorphic loci to known mutations because intragenic marker haplotype analysis has been shown to facilitate mutation screening.3 In fact, it is well known that F508del mutation is in linkage disequilibrium with the polymorphic tract 9T4 and the I148T sequence variation is frequently associated with the 3199del6 mutation.5,6 The poly T tract, a string of thymidine bases located in intron 8 of the CFTR gene, may be associated with non-classical CF or CFTR-related disorders depending on its size.7 The 5T variant decreases the efficiency of intron 8 splicing when the associated TG sequence is 12 or 13 repeats in length, while 11 repeats seems to be irrelevant.8,9 5T-TG analysis is routinely performed in our lab and we have investigated many patients, including some cases of Congenital Bilateral Absence of Vas Deferent (CBAVD). Login to comment

PMID: 20717170 [PubMed] Rene C et al: "p.Ser1235Arg should no longer be considered as a cystic fibrosis mutation: results from a large collaborative study."

No. Sentence Comment

169 8 Rohlfs EM, Zhou Z, Sugarman EA et al: The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis. Login to comment
175 11 Claustres M, Altieri JP, Guittard C, Templin C, Chevalier-Porst F, Des Georges M: Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

PMID: 20935229 [PubMed] Rubenstein RC et al: "Regulation of endogenous ENaC functional expression by CFTR and DeltaF508-CFTR in airway epithelial cells."

No. Sentence Comment

305 Coexpression of CFTRs with appropriate intracellular trafficking [wt (67) and I148T (60)] decrease ENaC functional, surface, and/or whole oocyte expression compared with oocytes expressing ENaC alone in the absence of specific treatments to activate CFTR (i.e., without forskolin/IBMX stimulation). Login to comment

PMID: 20977904 [PubMed] Schneider A et al: "Combined bicarbonate conductance-impairing variants in CFTR and SPINK1 variants are associated with chronic pancreatitis in patients without cystic fibrosis."

No. Sentence Comment

123 Total CFTR Sequencing Results of Healthy Controls CFTR mutations SPINK1 mutations 1 -/- N34S/- 2 1584GtoA/-a N34S/- 3 F508del/-a -/- 4 F508del/-a -/- 5 G576AϩR668C/- -/- 6 IVS8 T5-TG12/-a -/- 7 IVS8 T5/TG12/- -/- 8 R75Q/-a -/- 9 R75Q/-a -/- 10 R75Q/-a -/- 11 R75Q/-a -/- 12 R75Q/-a -/- 13 R75Q/-a -/- 14 R75Q/-a -/- 15 R75Q/-a -/- 16 R75Q/-a -/- 17 9CtoT/- -/- 18 C76W/-a -/- 19 T1086A/- -/- 20 R668C/- -/- 21 N1432K/- -/- 22 I148T/- -/- 23 2657ϩ22GtoA/- -/- 24-95 -/- -/- NOTE. Login to comment
92 Two peculiar mutations that occurred in both populations, c.1584GtoA (1716GtoA legacy name) and p.R75Q, have been generally regarded as benign sequence variations28 (www.genet.sickkids. on.ca) but repeatedly show association to CF-related diseases, pancreatitis,29-31 and some patients with atypical CF.32 Two individual nonsynonymous sequence changes, p.R668C and p.I148T, were identified with CFTR full sequencing in one control each but without additional mutations found in cis (p.D443Y ϩ p.G576A and c.3067del6 [ie, 3199del6], respectively). Login to comment
136 CFTR Mutation Class Types and Corresponding Disease Severity CFTR mutation Exon CF mutation class Disease association % Carriers, case (n) % Carriers, controls (n) p.R75Q 3 "CP" 16.2 (80) 5.3 (525) c.1584GtoA (p.E528E) 10 "CP" 8.7 (80) 3.3 (150) p.F508del 10 II CF severe 8.7 (80) 2.3 (525) p.R560T 11 II CF severe 3.4 (29) 0 (95) IVS8 T5/TG12or13 i8 V CF mild 5.0 (80) 2.7 (150) p.F508C 10 CF mild 1.2 (80) 0 (150) p.I807M 13 CF mild 3.4 (29) 0 (95) p.D443YϩG576AϩR668Ca 9;12;13 CF mild 3.4 (29) 0 (95) p.G576AϩR668Ca 12;13 CF mild 0 (29) 1 (95) p.M952T 15 CF mild 3.4 (29) 0 (95) p.R668C 13 Other 0 (29) 1 (95) c.3139ϩ42AtoT i17a Other 3.4 (29) 0 (95) p.N1432K 24 Other 0 (29) 1 (95) c.-9CtoT 1 Other 0 (29) 1 (95) p.C76W 3 Other 0 (80) 0.7 (150) p.I148T 4 Other 0 (29) 1 (95) c.2657ϩ22GtoA i14b Other 0 (29) 1 (95) p.T1086A 17b Other 0 (29) 1 (95) NOTE. Login to comment

PMID: 21474639 [PubMed] Rohlfs EM et al: "Cystic fibrosis carrier testing in an ethnically diverse US population."

No. Sentence Comment

116 For example, although p.I148T was initially identified in Ͼ0.1% of affected patients, it was subsequently reclassified as a benign allele after a frequency higher than expected was observed in the carrier-screening population (29, 30). Login to comment
118 When the observed Caucasian carrier frequency was corrected with the detection rate of 91.56% [Table 1, Cystic Fibrosis Foundation data excluding p.I148T, in (10)], the carrier frequency in Caucasians increased from 1 in 28 to 1 in 25. Login to comment

PMID: 21499205 [PubMed] Lucidi V et al: "The etiology of acute recurrent pancreatitis in children: a challenge for pediatricians."

No. Sentence Comment

46 Genetic Findings Observed in Our Study Population and Related Clinical Features CFTR PRSS1 SPINK1 Clinical CharacteristicsMutations IVS8 F508del/UN 9T/9T S181G/- NEG No respiratory symptoms 3849+10KbC9T/UN 7T/7T NEG NEG No respiratory symptoms UN/UN 7T/7T NEG N34S/- UN/UN 5T/7T NEG NEG No respiratory symptoms 1899-136T/C/UN 5T/7T NEG NEG No respiratory symptoms F508del/UN 5T/9T NEG NEG No respiratory symptoms D1152H/D1152H NEG NEG No respiratory symptoms R75Q/UN 5T/7T NEG NEG No respiratory symptoms L997F/UN 7T/9T NEG NEG No respiratory symptoms UN/UN 7T/7T NEG N34S/- W1282X/I148T 7T/9T NEG NEG No respiratory symptoms NEG N34S/- R75Q/F1052V NEG NEG No respiratory symptoms F508del/D1152H NEG NEG Bronchiectasis-CF 406-6T/C/E528E 7T/7T NEG NEG No respiratory symptoms F508del/UN 7T/9T Mild respiratory symptomsYCF L967S/L997F NEG NEG No respiratory symptoms E528E/UN 5T/7T Crohn disease, food allergy 1716 G/A/UN 7T/7T NEG NEG No respiratory symptoms 1898+1G9A/UN 7T/7T No respiratory symptoms R31C/UN No respiratory symptoms R75Q/UN 7T/7T NEG NEG No respiratory symptoms N29T;V212I; D217Y NEG F508del/UN 7T/9T NEG NEG Pancreas divisum S1235R/UN 7T/9T NEG NEG Duodenal stenosis Entries in bold font undelines the detection of mutations or polymorphisms in the studied genes. Login to comment

PMID: 21538969 [PubMed] Ren CL et al: "Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome."

No. Sentence Comment

60 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment
61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment

PMID: 9895335 [PubMed] Cremonesi L et al: "Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis."

No. Sentence Comment

31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism. Login to comment

PMID: 9921909 [PubMed] Bombieri C et al: "Complete mutational screening of the CFTR gene in 120 patients with pulmonary disease."

No. Sentence Comment

61 Of these 22 mutations, 14 (R75Q, P111L, R117H, I148T, Y301C, ∆F508, E585X, V754M, L997F, R1066C, M1137V, 3667ins4, D1270N, 4382delA) are listed by the Cystic Fibrosis Genetic Analysis Consortium (CFGAC) as CF mutations (CFGAC website), even if their role in CF disease remains to be proven, as is the case for R75Q, P111L, V754M, L997F, and D1270N. Login to comment
88 of cases CFTR gene PolyTb status tested mutationa DBE 23 1 G576A-R668C/L997F 7/9 1 ∆F508/L997F 9/9 1 ∆F508/- 7/9 1 R1066C/- 5/7 1 3667ins4/- 5/7 1 R75Q/- 7/7 1 M1137V/- 7/7 1 -/- 5/5 3 -/- 5/7 10 -/- 7/7 2 -/- 7/9 CB 27 1 P111L/- 7/7 1 R117H/- 7/7 1 E585X/- 7/7 1 P1072L/- 7/7 1 -/- 5/7 15 -/- 7/7 6 -/- 7/9 1 -/- 9/9 E 25 1 R668C/- 7/7 6 -/- 5/7 16 -/- 7/7 6 -/- 7/9 S 8 1 E826K/- 7/7 1 ∆F508/- 7/9 1 4382delA/- 7/7 1 L997F/- 7/9 1 V754M/- 7/9 3 -/- 7/7 LC 26 1 I148T/- 5/7 1 D1270N-R74W 5/7 1 D651N/- 7/7 1 Y301C/- 7/7 1 -/- 5/7 16 -/- 7/7 5 -/- 7/9 TB 4 1 -/- 5/7 1 -/- 7/7 2 -/- 7/9 Pneumonia 5 4 -/- 7/7 1 -/- 5/7 Pnx 2 2 -/- 7/7 Controls 68 1 L997F/- 7/9 1 R31C/- 7/7 1 I506V/- 5/7 1 -/- 5/7 1 -/- 5/9 23 -/- 7/7 4 -/- 7/9 1 -/- 9/9 2 ? Login to comment

PMID: 9922375 [PubMed] Sheppard DN et al: "Structure and function of the CFTR chloride channel."

No. Sentence Comment

176 Furthermore, the mutations I148T and G178R could not be locked open by the nonhydrolyzable ATP analog 5؅- adenylylimidodiphosphate (AMP-PNP) (112), the mutation Information about the CFTR pore has also emerged from studies using Cl0 channel inhibitors. Login to comment

PMID: 15241793 [PubMed] Steiner B et al: "The role of common single-nucleotide polymorphisms on exon 9 and exon 12 skipping in nonmutated CFTR alleles."

No. Sentence Comment

88 RESULTS Characterization of the CFTR Gene Mutations Mutations (c.575T4C (p.I148T), c.2890G4A (p.V920M), c.3586G4C (p.D1152H), and c.3837T4G (p.S1235R)) were found in 4 out of 66 healthy individuals (6%), a nonsignificant increase compared to the 4% carrier frequency reported in the literature for the Swiss population [Hergersberg et al., 1997]. Login to comment

PMID: 15287992 [PubMed] Claustres M et al: "Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations?"

No. Sentence Comment

1 Mireille Claustres*1, Jean-Pierre Altiéri1, Caroline Guittard1, Carine Templin1, Françoise Chevalier-Porst2 and Marie Des Georges1 Address: 1Laboratoire de Génétique Moléculaire, Institut Universitaire de Recherche Clinique et Centre Hospitalier Universitaire, 641 avenue du Doyen Gaston Giraud, 34093 Montpellier, France and 2Laboratoire de Biochimie pédiatrique, Centre Hospitalier Universitaire Paul-Brousse, 69000 Lyon, France Email: Mireille Claustres* - Mireille.Claustres@igh.cnrs.fr; Jean-Pierre Altiéri - Jean-Pierre.Altieri@igh.cnrs.fr; Caroline Guittard - Caroline.Guittard@igh.cnrs.fr; Carine Templin - Carine.Templin@igh.cnrs.fr; Françoise Chevalier-Porst - francoise.chevalier-porst@chu-lyon.fr; Marie Des Georges - Marie.Desgeorges@igh.cnrs.fr * Corresponding author Abstract Background: To contribute further to the classification of three CFTR amino acid changes (p.I148T, p.R74W and p.D1270N) either as CF or CBAVD-causing mutations or as neutral variations. Login to comment
3 Results: Four CF patients (out of 1238) originally identified as carrying the p.I148T mutation in trans with a CF mutation had a second mutation (c.3199del6 or a novel mutation c.3395insA) on the p.I148T allele. Login to comment
4 We demonstrate here that the deletion c.3199del6 can also be associated with CF without p.I148T. Login to comment
6 Conclusion: These findings question p.I148T or p.R74W-p.D1270N as causing by themselves CF or CBAVD and emphazises the necessity to perform a complete scanning of CFTR genes and to assign the parental alleles when novel missense mutations are identified. Login to comment
18 In North American populations, missense mutations p.I148T and p.D1270N were found >100 times and >200 times, respectively, more frequently in carrier screening than in CF patients [8,9]. Login to comment
20 Similarly, p.I148T has been shown to be associated with a CF phenotype only as a complex allele, i.e. when associated with mutation c.3199del6 on the same gene [8]. Login to comment
21 A completely asymptomatic male individual who is a compound heterozygote for p.D1270N and p.I148T has been recently identified [9]. Login to comment
22 These findings provided evidence that these missense changes may not be the true mutations and prompted us to reanalyze all the patients in our CF or CBAVD cohort who had been originally diagnosed as compound heterozygotes for either p.I148T or [p.R74W;p.D1270N] and another mutation on the other allele. Login to comment
23 The result of full scanning of CFTR sequences showed that a second mutation (c.3199del6 or the novel mutation c.3395insA) was associated in cis with p.I148T in all individuals with a CF phenotype, and that a third missense mutation (p.V201M) was associated in cis with complex allele [p.D1270N;p.R74W] in patients with a CBAVD phenotype in this series. Login to comment
24 Methods CFTR scanning for individuals with p.I148T or [p.D1270N;p.R74W] From 1990 to 2003, we have analysed for CFTR mutations genomic DNA from 437 families with CF and 170 with isolated azoospermia caused by CBAVD, using a combination of mutation screening for known and scanning for unknown mutations. Login to comment
29 In this study, we analyzed by DGGE the entire coding and flanking regions of the CFTR gene of individuals who had been previously found to carry p.I148T or the complex allele [p.R74W;p.D1270N] and assayed their relatives for the additional sequence changes identified. Login to comment
32 In addition, we also reanalyzed two additional CF patients previously found to carry p.I148T in the Lyon genetic center. Login to comment
37 Results A CF mutation (c.3199del6 or c.3395insA) is associated in cis with p.I148T in CF patients Two out of 437 CF patients analyzed in Montpellier and two out of 801 CF patients analyzed in Lyon were found to carry p.I148T, which was initially thought to be one of the two mutations responsible for CF in these patients. Login to comment
39 Mutation c.3199del6 can also occur alone as a CF-causing allele Mutation c.3199del6 was found to be carried without p.I148T in a young CF male with 394delTT on the other allele, diagnosed at the age of 7 years on the basis of typical pulmonary disease, pancreatic insufficiency, poor growth and positive sweat test [12]. Login to comment
46 The familial segregation analysis of polymorphisms covering the CFTR gene showed that p.I148T, when present in individuals with a CF phenotype, occurred on a unique haplotype carrying IVS8-9T whatever the mutation in cis, c.3395insA or c.3199del6 (table 1). Login to comment
47 By contrast, c.3199del6 without p.I148T occurred on a different haplotype carrying IVS8-7T. Mutations p.I148T, c.3199del6 and c.3395insA were not found on 600 chromosomes from our general population. Login to comment
52 This woman, who was carrying p.P67L on one CFTR gene and [p.R74W-p.D1270N] on the other (table 1), was completely asymptomatic at age 45 years Table 1: CFTR haplotypes associated with mutations found in CF patients carrying p.I148T in cis with c.3395insA or c.3199del6 and in one CF patient carrying c.3199del6 alone Indiv No. Login to comment
56 Discussion p.I148T is a low penetrance CF mutation or a neutral polymorphism Since its initial description in a CF Canadian patient with pancreatic insufficiency [16], the mutation p.I148T, which changes a conserved amino acid and occurs in the first cytoplasmic loop of the CFTR protein, has been considered as a severe CF allele in many countries. Login to comment
57 It was thought to be the second most common CF mutation in the French Canadian population, accounting for 9.1% of the French Canadian chromosomes [17], whereas in France, p.I148T accounted for only 0.11 % of the CF alleles in a sample of 3,710 patients affected with the disease [5]. Login to comment
58 p.I148T can now be detected by several commercially available kits developed for routine screening of CF carriers and for CF neonatal screening, and recently it has been included in the core panel of 25 CF mutations recommended by the American College of Medical Genetics (ACMG) [18]. Login to comment
60 However there are now several lines of evidence that question the role of p.I148T by itself in causing disease. Login to comment
61 First, compound heterozygosity for p.I148T and a severe CF mutation was recently identified in several healthy individuals [9,19]. Login to comment
62 When affected and unaffected individuals carrying apparently the same mutational genotype were re-analyzed for additional changes that could explain the different phenotypes, p.I148T was found to be associated in cis with another mutation, c.3199del6, in patients with a classic CF phenotype, whereas healthy adults who were compound heterozygous for p.I148T and a severe CF mutation or homozygous for p.I148T did not carry the deletion [8]. Login to comment
63 In a recent study, the p.I148T mutation has been further documented to be linked with the 3199del6 mutation in all 24 CF patients of French Canadian descent originally identified as compound heterozygous for the p.I148T mutation and a second severe CFTR mutation [20]. Login to comment
64 Second, p.I148T was found to be over 100 times more common in two independent U.S. carrier screening programmes than in CF patients: it accounted for 6.4 to 7.7% of chromosomes detected in the screened populations versus 0.06 to 0.068% of CF chromosomes in CF patients [8. Login to comment
66 This discrepancy suggests that p.I148T is either a poorly penetrant mutation or a neutral polymorphism. Login to comment
67 Third, when transiently expressed in epithelial cells, p.I148T mutant protein is normally processed and is able to mediate normal chloride transport with properties identical with those of wild-type cells [21]. Login to comment
68 As the mutant seems to suppress the ability of CFTR to support HCO3-transport, it has been hypothesized that p.I148T may contribute to disease through Cl- coupled HCO3- altered transport; however, the major CFTR functions are retained by the mutant [21]. Login to comment
69 Fourth, we show in this study for the first time that p.I148T can be associated with a frameshift mutation c.3395insA in exon 17b instead of in-frame deletion c.3199del6 in exon 17a. Login to comment
73 Fifth, in contrast with other studies that stated that only the complex allele [p.I148T;9T;c.3199del6] appeared to be associated with a classic CF phenotype [8], we demonstrate that c.3199del6 is associated with a CF phenotype even if the deletion occurs on a chromosome that does not carry p.I148T, which adds further value to the consideration that p.I148T is not a true mutation but simply a polymorphism. Login to comment
75 Our data fully support the recent recommendation that p.I148T should not be included in the mutation panel selected for prenatal screening strategy [22]. Login to comment
84 Recent large scale screening for CF carrier showed that p.D1270N was present 205 times more commonly in the screened population than in the CF patients (frequency of 14% versus 0.068%); in addition, a completely asymptomatic adult compound heterozygote for p.D1270N and p.I148T has been identified [9]. Login to comment
87 Conclusions This report further corroborates the recent hypothesis [9] that p.I148T and p.R74W-p.D1270N may not be true CF/ CBAVD mutations. Login to comment
88 If these observations are further confirmed by a large multicentric study, they will have important implications for genetic counseling of patients and couples found to carry p.I148T or [p.R74W;p.D1270N]. Login to comment

PMID: 15300780 [PubMed] Wong LJ et al: "Detection of CFTR mutations using temporal temperature gradient gel electrophoresis."

No. Sentence Comment

96 Detection of known mutations and polymorphisms by TTGE Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles detected 1 c.386G.A p.G85E 3 Heterozygote Mutation 2 2 c.575T.C p.I148T 4 Heterozygote Mutation 2 3 c.406-1G.A Splice Int 4 Heterozygote Mutation 9 4 c.71111G.T Splice Int 5 Heterozygote Mutation 1 5 c.1059_1069del 3bp p.F311del 7 Heterozygote Mutation 2 6 c.1132C.T p.R334W 7 Heterozygote Mutation 2 7 c.1652_1655del 3bp p.F508del 10 Heterozygote Mutation 94 8 Homozygote Mutation 12 c.1540A/G p.M470V 10 Heterozygote Polymorphism 15 9 Homozygote Polymorphism 4 c.1756G.T p.G542X 11 Heterozygote Mutation 13 10 c.1784G.A p.G551D 11 Heterozygote Mutation 1 11 c.1778G.A p.S549N 11 Heterozygote Mutation 4 12 c.1789C.T p.R553X 11 Homozygote Mutation 2 13 c.1807G.A p.A559T 11 Heterozygote Mutation 2 14 c.189811G.A Splice Int 12 Heterozygote Mutation 1 15 c.1949del84bp Frameshift 13 Heterozygote Mutation 3 16 c.278915G.A Splice Int 14b Heterozygote Mutation 2 17 c.312011G.A Splice Int 16 Heterozygote Mutation 9 18 c.3171delC Frameshift 17a Heterozygote Mutation 1 19 c.3398G.A p.W1089X 17b Heterozygote Mutation 1 20 c.3425G.A p.W1098X 17b Heterozygote Mutation 1 21 c.3616C.T p.R1162X 19 Heterozygote Mutation 2 22 c.3791delC Frameshift 19 Heterozygote Mutation 1 23 c.3821delT Frameshift 19 Heterozygote Mutation 1 24 c.3876delA Frameshift 20 Heterozygote Mutation 4 25 c.3905insT Frameshift 20 Heterozygote Mutation 1 26 c.4041C.G p.N1303K 21 Heterozygote Mutation 2 Total 194 The translation starts at c.133 of CFTR CDNA sequence in GenBank Acc. Login to comment

PMID: 16128988 [PubMed] Larriba S et al: "Molecular evaluation of CFTR sequence variants in male infertility of testicular origin."

No. Sentence Comment

51 CFTR analysis We identified 14 different, potential disease-causing CFTR sequence variants, 11 of them are translated into missense amino acid changes (p.R75Q, p.P111L, p.R117H, p.I148T, p.R334W, p.M348K, p.G576A, p.R668C, p.D1270N, p.S1235R and p.S1426F), one deletion (p.F508del) and two alleles affecting exon splicing [IVS8-6(5T), c.1716G>A] in 30 of 83 infertile patients (Table 1) giving a frequency of 36.1%. Login to comment
53 Thirteen CFTR gene sequence variants [p.R75Q, p.I148T, p.T351S, p.F508del, p.G576A, p.R668C, p.E725K, p.V754M, p.D836Y, p.L997F, p.S1235R, IVS8-6(5T) and c.1716G>A] were determined in 11 F1 and 15 F2 individuals (Table 1) giving a frequency of 29.9%. Login to comment
54 One individual presented both p.R75Q and p.I148T. Login to comment
72 Description of genetic abnormalities and other risk factors of infertile and fertile CFTR carrier individuals No. Phenotype CFTR genotype Associated factors Testicular histologya b c Infertile individuals 1 NOb (SO) p.R75Q No Severe hypospermatogenesis 2 NOb (SO) p.R75Q No nd 3 NOb (A) p.P111L AZFb,c del Sertoli cell only 4 NOb (A) p.R117H AZFc del Severe hypospermatogenesis 5 NOb (SO) p.I148T No Severe hypospermatogenesis 6 NOb (A) p.R334W No Primary spermatocyte arrest 7 NOb (SO) p.M348K UV grade III Primary spermatocyte arrest 8 NOb (A) p.F508del No Sertoli cell only 9 NOb (A) p.F508del No Primary spermatocyte arrest 10 NOb (A) p.G576A, p.R668C No Severe hypospermatogenesis, Leydig cell hyperplasia 11 NOb (SO) p.G576A, p.R668C No Primary spermatocyte arrest (unilateral) 12 NOb (SO) p.G576A, p.R668C No Severe hypospermatogenesis 13 NOb (A) p.R668C UC Sertoli cell-only (incomplete) 14 NOb (SO) p.D1270N No nd 15 NOb (SO) p.S1235R No Severe hypospermatogenesis 16 NOb (SO) p.S1426F* UC Sertoli cell only 17 NOb (A) (T)5-(TG)12 No Severe hypospermatogenesis, Sertoli cell only (80%) 18 NOb (A) (T)5-(TG)12 No Sertoli cell only 19 NOb (SO) (T)5-(TG)11 UV grade III Bilateral moderate hypospermatogenesis 20 NOb (SO) (T)5-(TG)11 UV grade II Severe hypospermatogenesis 21 NOb (A) (T)5-(TG)11 No nd 22 NOb (SO) c.1716 G>A Dysplasia SV Severe hypospermatogenesis, Sertoli cell only (95%) 23 NOb (A) c.1716 G>A No nd 24 NOb (A) c.1716 G>A No Primary spermatocyte arrest (bilateral) 25 NOb (SO) c.1716 G>A No Sertoli cell only (95%) 26 NOb (SO) c.1716 G>A No Severe hypospermatogenesis 27 NOb (SO) c.1716 G>A UV grade III Severe hypospermatogenesis 28 NOb (SO) c.1716 G>A No nd 29 NOb (SO) c.1716 G>A No nd 30 NOb (SO) c.1716 G>A AZFc del Severe hypospermatogenesis Fertile individuals 1 F1 p.R75Q No nd 2 F1 p.F508del No nd 3 F1 p.F508del No nd 4 F1 p.G576A, p.R668C/ c.1716 G>A No nd 5 F1 p.D836Y No nd 6 F1 p.S1235R/c.1716 G>A No nd 7 F1 c.1716 G>A No nd 8 F1 c.1716 G>A No nd 9 F1 c.1716 G>A No nd 10 F1 c.1716 G>A No nd 11 F1 c.1716 G>A No nd 12 F2 p.R75Q No nd the expected CF carrier frequency in the local population (Van der Ven et al., 1996; Larriba et al., 2001; Dohle et al., 2002) or with the general population (Jakubiczka et al., 1999; Pallares-Ruiz et al., 1999; Ravnik-Glavac et al., 2001) and not normospermic fertile individuals, the latter considered as adequate controls. Login to comment
77 Most of the changes identified, except p.F508del, p.R117H, p.I148T and p.R334W, are known to behave as benign mutations being present in milder phenotypes of CFTR-related pathologies (http:// www.genet.sickkids.on.ca) and/or because of the results of the performance of functional studies. Login to comment
85 Continued No. Phenotype CFTR genotype Associated factors Testicular histologya b c 13 F2 p.I148T p.R75Q No nd 14 F2 p.T351S No nd 15 F2 p.F508del No nd 16 F2 p.E725K No nd 17 F2 p.V754M No nd 18 F2 p.L997F No nd 19 F2 (T)5-(TG)12 No nd 20 F2 (T)5-(TG)12 No nd 21 F2 (T)5-(TG)11 No nd 22 F2 (T)5-(TG)11 No nd 23 F2 c.1716 G>A No nd 24 F2 c.1716 G>A No nd 25 F2 c.1716 G>A No nd 26 F2 c.1716 G>A No nd Phenotype: NOb (SO), non-obstructive severe oligozoospermia; NOb (A), non-obstructive azoospermia; F1, optimal fertility; F2, suboptimal fertility. Login to comment

PMID: 17331079 [PubMed] Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."

No. Sentence Comment

67 Seven other complex alleles were observed: [c.296 + 3insT; p.V754M], [p.F508del; p.I1027T], [p.S549R; -102T > A], [p.G576A; p.R668C], [p.R1070W; p.R668C], [p.D1270N; p.R74W] and [p.T1299I; p.I148T]. Login to comment

PMID: 19883345 [PubMed] Christie LM et al: "Outcomes of a cystic fibrosis carrier testing clinic for couples."

No. Sentence Comment

72 This provides each individual with information on their carrier status, and accurate residual risks of 1 CFTR mutations tested for in individuals whose partner was a carrier of p.F508del* p.F508del p.F316leufsX p.I507del p.R347P p.G542X p.S1251N p.G551D p.E60X p.N1303K p.W1282X c.1585-1G>A p.D1152H p.R553X c.2988+1G>A c.489+G>T c.2657+5G>A p.R117H c.1766+1G>A p.R1162X c.579+1G>A c.3717+10kbC>T p.G85E p.R334W p.K684fs p.A455E p.I148T p.K684fs p.R560T p.T1176fs CFTR = gene encoding cystic fibrosis transmembrane conductance regulator. Login to comment

PMID: 20607857 [PubMed] Bareil C et al: "UMD-CFTR: a database dedicated to CF and CFTR-related disorders."

No. Sentence Comment

15 Several sequence changes initially reported as causing disease have subsequently been reported to be neutral sequence variants (a typical illustration is the variant p.Ile148Thr) [Claustres et al., 2004; Rohlfs et al., 2004] or mutations with reduced penetrance (only some patients will develop CF or CFTR-related disorder; example: p.Arg117His) [Kiesewetter et al., 1993; Rosenstein and Cutting, 1998; Thauvin-Robinet et al., 2009] or mutations with variable expressivity (some patients develop mild rather than severe symptoms; examples include p.Leu206Trp [Desgeorges et al., 1995; Rozen et al., 1995] or p.Asp1152His [Burgel et al., 2010; Mussaffi et al., 2006]). Login to comment

PMID: 21036675 [PubMed] Lay-Son G et al: "Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations."

No. Sentence Comment

50 Seven mutations had not been previously reported in the Chilean population (p.1078delT, pG85E, c.3120+1 GNA, c.711+1 GNT, p.R117H, p.A455E, and p.I148T). Login to comment
81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition. Login to comment

PMID: 21474640 [PubMed] Schrijver I et al: "Mutation distribution in expanded screening for cystic fibrosis: making up the balance in a context of ethnic diversity."

No. Sentence Comment

20 The decision in 2004 to reduce the original panel of 25 mutations to 23 (13) was based on a lower actual frequency of 1 mutation (c.948delT; legacy name, c.1078delT in exon 7) and the lack of pathogenicity of another (p.I148T). Login to comment

PMID: 21547743 [PubMed] Sosnay PR et al: "Evaluation of the disease liability of CFTR variants."

No. Sentence Comment

77 For example, the variant p.Ile148Thr was initially felt to be disease causing, but further examination found that the mutation occurred at a higher rate in healthy individuals undergoing carrier screening than in CF patients (26). Login to comment
78 Subsequent studies revealed that most CF patients with p.Ile148Thr also carry the two amino acid deletion c.3067_3072del (27). Login to comment
79 The latter mutation in isolation causes CF whereas p.Ile148Thr in isolation does not. Login to comment
140 The bioinformatic tools PolyPhen and SIFT have been employed to evaluate amino acid changes in CFTR, but made significant errors incorrectly identifying "known" neutral polymorphisms p.Phe508Cys and p.Ile148Thr as likely to be deleterious (58, 59). Login to comment

PMID: 22658665 [PubMed] Ooi CY et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis."

No. Sentence Comment

855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

PMID: 22892530 [PubMed] Sobczynska-Tomaszewska A et al: "Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy."

No. Sentence Comment

57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland. Login to comment
117 For example, the I148T variant no longer has the qualification of a pathogenic mutation but is still included in the commercial kits (eg, InnoLipa, Innogenetics).33 Prudence is therefore always essential in molecular genetics. Login to comment
116 For example, the I148T variant no longer has the qualification of a pathogenic mutation but is still included in the commercial kits (eg, InnoLipa, Innogenetics).33 Prudence is therefore always essential in molecular genetics. Login to comment

PMID: 22302635 [PubMed] Cornel MC et al: "Improving test properties for neonatal cystic fibrosis screening in the Netherlands before the nationwide start by May 1st 2011."

No. Sentence Comment

71 Mutation I148T, which is still part of this test, was ignored since this mutation is not considered disease-causing anymore. Login to comment
72 Mutation I148T, which is still part of this test, was ignored since this mutation is not considered disease-causing anymore. Login to comment

PMID: 22191729 [PubMed] Lobna HL et al: "Analysis of cystic fibrosis transmembrane regulator and azoospermia factor polymorphisms in infertile men in relation to other abnormalities."

No. Sentence Comment

35 Table 1 Summary of reported compound genetic abnormalities in CFTR patients References CFTR Karyotype Y-del SA Exam FSH Testis histology Current study (2011) )/), 5T/5T 46,XY AZFa+b Azoo Bil Vas NA NA Current study (2011) )/), 6T/6T 46,XY AZFa+b Azoo Bil Vas NA NA Current study (2011) )/), 5T/5T 46,XY AZFa+b+c Azoo Bil Vas NA NA Karpman et al. (2007) W1282X/), WT/WT 46,XY AZFb+c Azoo Bil Vas 4 Late, incomplete maturation Karpman et al. (2007) I148T/), WT/WT 46,XY AZFb+c OAT Bil Vas 19 NA Schulz et al. (2006) F508/), WT/WT 45,XY, der(14;22) None OAT Bil Vas NA NA Dohle et al. (2002) F508/), 7T/9T 46,XY AZFc OAT Hpogonadism 7.3 NA Dohle et al. (2002) R117/H/) 47,XXY None Azoo Hpogonadism 11 NA Meng et al. (2001) F508/), 7T/9T 46,XY AZFb Azoo CBAVD NA Sertoli cell only Black et al. (2000) )/), 5T/9T 46,XY, inv(6)(p12q21) None Azoo CBAVD 8.8 Late, incomplete maturation Azoo, azoospermia; Bill Vas, bilateral vas deferens present; CBAVD, congenital bilateral absence of the vas deferens; CFTR, cystic fibrosis transmembrane receptor; FSH, follicle stimulating hormone, NA, not available; OAT, oligoasthenoteratozoospermia; SA, semen analysis; WT, wild type; AZF, Azoospermia factor. Login to comment

PMID: 22094894 [PubMed] Sultan M et al: "Genetic prevalence and characteristics in children with recurrent pancreatitis."

No. Sentence Comment

78 Six patients were heterozygous for the CFTR mutation (F508del, R297W, D1152H, R297Q, and I148T). Login to comment
92 This patient was diagnosed as having RAP and was found to have a combined mutation in PRSS1 (p.R116C) and CFTR genes (I148T variant on exon 4). Login to comment
93 Hereditary pancreatitis has been described in carriers of the p.R116C mutation, and I148T variant was originally reported to be a disease-causing mutation (10). Login to comment
137 Other mutations (R297Q, D1152H, R297Q, and I148T) may be present in CF and CFTR-related disorders such as pancreatitis and obstructive azoospermia (25). Login to comment

PMID: 22427236 [PubMed] Rosendahl J et al: "CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?"

No. Sentence Comment

4 Results Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. Login to comment
72 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment
80 We excluded CFTR variants p.R75Q, p.I148T, the poly-T tract and p.E528E, PRSS1 variant p.S124F, SPINK1 variants c.1-52G>T and p.P55S, and CTRC variants p.R37Q, p.K151N and p.K172E from all calculations, because of missing functional data or a missing genetic association. Login to comment
94 Notably, p.I148T was never found in cis with c.3199del6, and p.S1235R was always associated with p.G628 (wild-type). Login to comment
111 Except one (p.R117H (7T/7T)/p. S1235), these compound heterozygotes were excluded in the overall computations, because CFTR variant p.R75Q, p.I148T, 5T or p.E528E was present in at least one allele. Login to comment
116 In addition, 24/660 (3.6%) patients and 2/1700 (0.1%) controls were trans-heterozygotes in that CFTR variants p.R75Q, p.I148T, 5T and p.E528E were essential for trans-heterozygous status (p<0.0001, OR 30.8, 95% CI 7.3 to 131). Login to comment
142 *Variants p.R75Q, p.I148T and p.E528E were excluded from calculations because of their similar frequencies in patients and controls. Login to comment
153 *Compound heterozygotes in that variants p.R75Q, p.I148T, 5T-allele, and p.E528E were essential for compound heterozygous status were excluded from calculations. Login to comment
166 (1-215G>A; 194+2T>C) p.E528E 1/660 (0.2%) 0/1758 NS e c.1-53C>T p.R75Q 1/660 (0.2%) 0/1758 NS e p.N34S (hom) p.R75Q (hom) 1/660 (0.2%) 0/1758 NS e p.N34S (hom) 5T/7T 1/660 (0.2%) 0/1758 NS e p.N34S (hom) p.E528E 2/660 (0.3%) 0/1758 NS e Continued Rosendahl J, Landt O, Bernadova J, et al. Gut (2012). Login to comment
167 doi:10.1136/gutjnl-2011-300645 of 11 Pancreas Table 5 Continued PRSS1 SPINK1 CTRC CFTR Patients Controls p Value OR (95% CI) p.N34S (het) p.R75Q 4/660 (0.6%) 1/1758 (0.06%) 0.03* 10.7 (1.2 to 96.1) p.N34S (het) p.I148T 1/660 (0.2%) 0/1758 NS e p.N34S (het) 5T/7T 5/660 (0.8%) 0/1758 0.002 29.5 (1.6 to 534.8) p.R65Q p.R75Q 1/660 (0.2%) 0/1758 NS e p.R67C p.E528E 1/660 (0.2%) 0/1758 NS e p.G217S p.E528E 0/546 1/1700 (0.06%) NS e To obtain stringent results, the total number of patients (n¼660) was used for calculations of p values, although some of the patients were not completely analysed. Login to comment
174 In the lower section, trans-heterozygotes with non-CF-causing variants, p.R75Q, p.I148T, 5T-allele and p.E528E, are displayed, which were excluded from calculations because their over-representation is due to accumulation of the concomitant variant (eg, p.N34S) in patients (see Results section) or the CFTR variant displayed similar frequencies in patients and controls (p.R75Q, p.I148T, 5T-allel, and p.E528E). Login to comment
179 CFTR variants, p.R75Q, p.I148T and p.E528E, were excluded from computations as explained before. Login to comment
183 yCompound and trans-heterozygous carriers with p.R75Q, p.I148T, 5T-allele and p.E528E were excluded as explained before. Login to comment
192 In contrast with other authors, we excluded CFTR variants p. R75Q, p.I148T, 5T and p.E528E from our calculations, because they were distributed similarly in patients and controls.30 31 Thereby, overall, CFTR variants displayed a 2.7-fold risk increase for CP development. Login to comment
69 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment
77 We excluded CFTR variants p.R75Q, p.I148T, the poly-T tract and p.E528E, PRSS1 variant p.S124F, SPINK1 variants c.1-52G>T and p.P55S, and CTRC variants p.R37Q, p.K151N and p.K172E from all calculations, because of missing functional data or a missing genetic association. Login to comment
91 Notably, p.I148T was never found in cis with c.3199del6, and p.S1235R was always associated with p.G628 (wild-type). Login to comment
107 Except one (p.R117H (7T/7T)/p. S1235), these compound heterozygotes were excluded in the overall computations, because CFTR variant p.R75Q, p.I148T, 5T or p.E528E was present in at least one allele. Login to comment
112 In addition, 24/660 (3.6%) patients and 2/1700 (0.1%) controls were trans-heterozygotes in that CFTR variants p.R75Q, p.I148T, 5T and p.E528E were essential for trans-heterozygous status (p<0.0001, OR 30.8, 95% CI 7.3 to 131). Login to comment
137 *Variants p.R75Q, p.I148T and p.E528E were excluded from calculations because of their similar frequencies in patients and controls. Login to comment
147 *Compound heterozygotes in that variants p.R75Q, p.I148T, 5T-allele, and p.E528E were essential for compound heterozygous status were excluded from calculations. Login to comment
159 (1-215G>A; 194+2T>C) p.E528E 1/660 (0.2%) 0/1758 NS e c.1-53C>T p.R75Q 1/660 (0.2%) 0/1758 NS e p.N34S (hom) p.R75Q (hom) 1/660 (0.2%) 0/1758 NS e p.N34S (hom) 5T/7T 1/660 (0.2%) 0/1758 NS e p.N34S (hom) p.E528E 2/660 (0.3%) 0/1758 NS e Continued Table 5 Continued PRSS1 SPINK1 CTRC CFTR Patients Controls p Value OR (95% CI) p.N34S (het) p.R75Q 4/660 (0.6%) 1/1758 (0.06%) 0.03* 10.7 (1.2 to 96.1) p.N34S (het) p.I148T 1/660 (0.2%) 0/1758 NS e p.N34S (het) 5T/7T 5/660 (0.8%) 0/1758 0.002 29.5 (1.6 to 534.8) p.R65Q p.R75Q 1/660 (0.2%) 0/1758 NS e p.R67C p.E528E 1/660 (0.2%) 0/1758 NS e p.G217S p.E528E 0/546 1/1700 (0.06%) NS e To obtain stringent results, the total number of patients (n&#bc;660) was used for calculations of p values, although some of the patients were not completely analysed. Login to comment
171 CFTR variants, p.R75Q, p.I148T and p.E528E, were excluded from computations as explained before. Login to comment
175 yCompound and trans-heterozygous carriers with p.R75Q, p.I148T, 5T-allele and p.E528E were excluded as explained before. Login to comment

PMID: 18992954 [PubMed] Henckaerts L et al: "Cystic fibrosis transmembrane conductance regulator gene polymorphisms in patients with primary sclerosing cholangitis."

No. Sentence Comment

91 There was Table 4 Summary of the 37 CFTR variants studied in the exploratory phase INNO-LiPA CFTR 19 INNO-LiPA CFTR17+Tn Update F508del 621+1GfiT G542X 3849+10kbCfiT N1303K 2183AAfiG W1282X 394delTT G551D 2789+5GfiA 1717-1GfiA R1162X R553X 3659delC CFTRdele2,3(21kb) R117H I507del R334W 711+1GfiT R347P 3272-26AfiG G85E 3905insT 1078delT R560T A455E 1898+1GfiA 2143delT S1251N E60X I148T 2184delA 3199del6 711+5GfiA 3120+1GfiA Tn Q552X Fig. 1. Login to comment

PMID: 18687795 [PubMed] Audrezet MP et al: "Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene."

No. Sentence Comment

171 Results of CFTR Analysis by HRM on 136 Samples of Patients with Idiopathic Chronic Pancreatitis (ICP) Exon Number of positive samples Mutations identified Variants identified New positive controls 1 14 14 125GϾC 2 1 1 R31C 3 9 1 G85E 7 R75Q 1 R74W 4 4 1 R117G 1 I148T R117G 1 R117H 1 A120T 5 1 1 L188P L188P 6a 5 1 V201M 1 A221A A221A 3 875ϩ40 AϾG 6b 27 1 M284T 26 1001ϩ11CϾT M284T 7 1 1 L320V L320V 8 0 0 9 1 1 D443Y 10 16 8 F508del 8 E528E 11 1 1 G542X 12 6 4 G576A 1 Y577Y L568F 1 L568F 13 7 1 S737F 4 R668C S737F 1 V754M L644L 1 L644L 14a 53 52 T854T T854TϩI853I 1 T854TϩI853I 14b 0 0 15 3 1 L967S T908S 1 T908S 1 S945L 16 0 0 17a 10 7 L997F 1 3271ϩ18CϾT 3271 ϩ 3AϾG 1 3271 ϩ 3 AϾG 1 Y1014C 17b 3 1 L1096L L1096L 1 H1054DϩG1069R 1 3272-33AϾG H1054DϩG1069R 3272-33AϾG 18 2 1 D1152H E1124del 1 E1124del 19 5 5 S1235R poly 20 7 1 W1282X 5 P1290P 1 D1270N 21 2 1 N1303K 1 T1299T 22 0 0 23 1 0 4374ϩ13 AϾG 24 43 40 Q1463Q 2 Y1424Y 1 Q1463QϩY1024Y ing domain of a gene brings an excellent sensitivity for heterozygote detection that is very close to 100%. Login to comment

PMID: 17662673 [PubMed] Alibakhshi R et al: "Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations."

No. Sentence Comment

93 In the five patients with a broad spectrum of respiratory diseases or undefined pancreatic disease and borderline (40-60 mmol/l) sweat chloride values, the heterozygous state for 1 mutation was found, i.e. the c.3499+37GNA, c.2789+5GNA, c.406-8TNC, c.3850-24GNA, and the p.I148T polymorphism. Login to comment
92 In the five patients with a broad spectrum of respiratory diseases or undefined pancreatic disease and borderline (40-60 mmol/l) sweat chloride values, the heterozygous state for 1 mutation was found, i.e. the c.3499+37GNA, c.2789+5GNA, c.406-8TNC, c.3850-24GNA, and the p.I148T polymorphism. Login to comment

PMID: 16423550 [PubMed] Ramirez AM et al: "Mutational spectrum of cystic fibrosis patients from Cordoba province and its zone of influence: implications of molecular diagnosis in Argentina."

No. Sentence Comment

74 The mutation c.3199_3204delATAGTG has been found in the same allele that the p.I148T, a complex allele previously described. Login to comment
75 More recently, it has been proposed that the p.I148T is a benign polymorphism. Login to comment
85 Haplotype (n D 20) No. of chromosomes (n D 64)a Mutations associated (No. of chromosomes) 23-31 14 p.F508del 17-31 7 p.F508del 17-7 7 p.R1066C (3), p.W277R, c.2789 + 5G > A, c.3120 + 1G > A, c.3849 + 10KbC > T 16-7 6 c.3272-26A > G (2), p.G27R, c.622-2A > G, unknown (2) 16-32 5 p.S589I (2), unknown (3) 16-30 3 IVS8-5T (2), unknown 23-33 2 p.G542X, p.R1283M 23-32 2 p.G542X 23-30 2 p.F508del, p.N1303K 24-31 2 p.N1303K 16-24 2 p.G85E 16-31 3 c.1898 + 1G > A, p.W1089X, unknown 16-46 2 c.1811 + 1.6KbA > G 16-25 1 c.711 + 1G > T 16-33 1 Unknown 16-44 1 c.1898 + 1G > A 16-45 1 p.Y913C 16-47 1 c.4005 + 1G > A 17-30 1 Unknown 23-7 1 [c.3199_3204delATAGTG; p.I148T] Table 2 Frequency of the mutations in the 78 CF Argentinean patients of Córdoba region a IdentiWed novel mutations. Login to comment
86 Mutation Exon/Intron CF alleles % p.F508del Exon 10 94 60.26 p.N1303K Exon 21 8 5.13 p.G542X Exon 11 7 4.49 p.R334W Exon 7 3 1.93 p.R1066C Exon 17b 3 1.93 c.2789 + 5G > A Intron 14b 3 1.93 p.G85E Exon 3 2 1.28 c.3659del C Exon 19 2 1.28 c.1811 + 1.6kbA > G Intron 11 2 1.28 c.1898 + 1G > A Intron 12 2 1.28 c.3272-26A > G Intron 17a 2 1.28 p.S589I Exon 12 2 1.28 p.R553X Exon 11 2 1.28 IVS8-5T Intron 8 2 1.28 c.3849 + 10kb C > T Intron 19 1 0.64 c.621 + 1G > T Intron 4 1 0.64 p.R1162X Exon 19 1 0.64 c.711 + 1G > T Intron 5 1 0.64 c.3120 + 1G > A Intron 16 1 0.64 p.Y913C Exon 15 1 0.64 c.4005 + 1G > A Intron 20 1 0.64 p.W1089X Exon 17b 1 0.64 p.R1283M Exon 20 1 0.64 [p.I148T;c.3199_3204del ATAGTG] Exon 4, Exon 17a 1 0.64 p.G27Ra Exon 2 1 0.64 p.W277Ra Exon 6b 1 0.64 c.622-2A > Ga Intron4 1 0.64 Unknown allele - 9 5.77 Wrst year of life he required several internments, for hydroelectric desequilibrium and persistent pulmonary infections causing failure to thrive. Login to comment

PMID: 16436646 [PubMed] Heaney DL et al: "Detection of an apparent homozygous 3120G>A cystic fibrosis mutation on a routine carrier screen."

No. Sentence Comment

66 Similar to I148T influencing 3199del6 in cis18,19 or R117H being influenced by the 5T variant,20 there could be an additional mutation on the same chromosome causing different phenotypes for those who have the same apparent genotype. Login to comment

PMID: 16436643 [PubMed] Elahi E et al: "A haplotype framework for cystic fibrosis mutations in Iran."

No. Sentence Comment

105 Six were exonic polymorphisms that were either silent for an amino acid change or demonstrated to have little or no effect on protein function (p.E92E, p.I148T, p.M470V, p.E1194A, p.P1290P, and p.Q1463Q). Login to comment
109 A third variant (p.I148T) was confirmed as a neutral polymorphism by a recent report.34 However, p.M470V may not be strictly neutral.21,35 It was found that the M470 protein matured more slowly and had increased intrinsic chloride channel activity compared with the V470 protein.35 In addition, the V470 allele was shown to reduce CFTR protein activity when present in combination with H1352.21 M470V may also affect exon 9 skipping during splicing processes.35,36 Its incidence in non-cystic fibrosis CFTR-related diseases also suggests that M470V has a role in those diseases.36,37 M470V in phase with the T5 allele of the polymorphic Tn locus was suggested to be a disease-causing allele in a Korean cystic fibrosis patient.38 The extent to which this allele may have contributed to the disease Table 1. Login to comment
128 Putative Polymorphism in the CFTR Gene of Iranian CF Patients Genomic position* Polymorphism designation Location in gene Effect on protein Minor allele frequency DB-SNP number 42296936 c.185ϩ45AϾG Intron 1 1% 42325703 c.297-75CϾA Intron 2 6% 42347645 c.408AϾG Exon 4 E92E 1% 42347812 c.575TϾC Exon 4 I148T 2% 42352195 c.875ϩ40AϾG Intron 6a 2% 42353259 c.876-33delTTGA Intron 6a 45% rs4148700 42353428 c.1001ϩ11CϾT Intron 6b 30% rs1800503 42376147 c.1525-61AϾG Intron 9 35% 42376223 c.1540AϾG Exon 10 M470V 45% rs213950 42376407 c.1716ϩ8AϾG Intron 10 1% 42423325 c.3041-92GϾA Intron 15 15% 42423346 c.3041-71GϾC Intron 15 1% 42423539 c.3271ϩ42AϾT Intron 16b 1% 42427170 c.3272-93TϾC Intron 16b 3% 42444201 c.3601-65CϾA Intron 18 14% rs213989 42444378 c.3713AϾC Exon 19 E1194A 1% 42459334 c.4002AϾG Exon 20 P1290P 3% rs1800130 42459458 c.4005ϩ121delTT Intron 20 2% 42469386 c.4006-200GϾA Intron 20 16% rs214164 42469496 c.4006-90delC Intron 20 2% 42483798 c.4521GϾA Exon 24 Q1463Q 19% rs1800136 *Genomic reference sequence NT_007933. Login to comment

PMID: 16051530 [PubMed] Kinnunen S et al: "Spectrum of mutations in CFTR in Finland: 18 years follow-up study and identification of two novel mutations."

No. Sentence Comment

36 The InnoLipa assay recognizes 36 mutations: E60X (c.178G>T, p.Glu60X), G85E (c.254G>A, p.Gly85- Glu), 394delTT, R117H (c.350G>A, p.Arg117His), I148T (c.443T>C, p.Ile148Thr), 621+1G>T (c.489+1G>T), 711+1G>T (c.579+1G>T), 711+5G>A (c.579+5G>A), 1078delT (c.948delT, p.Phe316fs), R334W (c.1000C>T, p.Arg334Trp), R347P (c.1040G>C, p.Arg347Pro), A455E (c.1364C>A, p.Ala455Glu), I507del (c.1519_1521delATC, p.Ile507del), F508del, 1717À1G>A (c.1585À1G>A), G542X, G551D (c.1652G >A, p.Gly551Asp), Q552X (c.1654C > T, p.Gln552X), R553X (c.1657C > T, p.Arg553X), R560T (1679G>vC, p.Arg560Thr), 1898+ 1G > A (c.1766 + 1G > A), 2143delT (c.2012delT, p.Leu671fs), 2183AA > G (c.2051_2052delAAinsG, p.Lys684fs), 2184delA (c.2052delA, p.Lys684fs), 2789+ 5G>A (c.2657+5G>A), 3120+1G>A (c.2988+1G>A), 3199del6 (c.3067_3072del, p.Ile1023_Val1024del), 3272À 26A > G (c.3140 À26A > G), R1162X (c.3484C > T, p.Arg1162X), 3849+10kbCYT, 3659delC (c.3528delC, p.Lys1177fs), S1251N (c.3752G > A, p.Ser1251Asn), 3905insT (c.3773dupT, p.Leu1258fs), W1282X (c.3846G> A, p.Trp1282X), N1303K (c.3909C>G, p.Asn1303Lys), CFTRdele2,3(21kb) and Tn-polymorphism on intron 8. Login to comment
37 The InnoLipa assay recognizes 36 mutations: E60X (c.178G>T, p.Glu60X), G85E (c.254G>A, p.Gly85Glu), 394delTT, R117H (c.350G>A, p.Arg117His), I148T (c.443T>C, p.Ile148Thr), 621+1G>T (c.489+1G>T), 711+1G>T (c.579+1G>T), 711+5G>A (c.579+5G>A), 1078delT (c.948delT, p.Phe316fs), R334W (c.1000C>T, p.Arg334Trp), R347P (c.1040G>C, p.Arg347Pro), A455E (c.1364C>A, p.Ala455Glu), I507del (c.1519_1521delATC, p.Ile507del), F508del, 1717 1G>A (c.1585 1G>A), G542X, G551D (c.1652G >A, p.Gly551Asp), Q552X (c.1654C > T, p.Gln552X), R553X (c.1657C > T, p.Arg553X), R560T (1679G>vC, p.Arg560Thr), 1898+ 1G > A (c.1766 + 1G > A), 2143delT (c.2012delT, p.Leu671fs), 2183AA > G (c.2051_2052delAAinsG, p.Lys684fs), 2184delA (c.2052delA, p.Lys684fs), 2789+ 5G>A (c.2657+5G>A), 3120+1G>A (c.2988+1G>A), 3199del6 (c.3067_3072del, p.Ile1023_Val1024del), 3272 26A > G (c.3140 26A > G), R1162X (c.3484C > T, p.Arg1162X), 3849+10kbCYT, 3659delC (c.3528delC, p.Lys1177fs), S1251N (c.3752G > A, p.Ser1251Asn), 3905insT (c.3773dupT, p.Leu1258fs), W1282X (c.3846G> A, p.Trp1282X), N1303K (c.3909C>G, p.Asn1303Lys), CFTRdele2,3(21kb) and Tn-polymorphism on intron 8. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

PMID: 15858154 [PubMed] Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."

No. Sentence Comment

164 This is lower than the ϳ65% relative mutation frequency in Caucasian individuals.11 In addition, the mutations that were identified in this control group were largely rare, and only 13/61 (including I148T) different mutations are included in the 25 mutation screening panel recommended by ACMG/ACOG. Login to comment
173 Of the 22 mutations present at a relative frequency of 1% or more, only eight are currently included in the standard 25 mutation panel recommended (I148T, R334W, ⌬F508, G542X, R553X, 1717-1GϾA, 3120 ϩ 1GϾA, and 3849 ϩ 10kbCϾT), although a recent ACMG revision will remove variant I148T.13 The California Department of Health Services is also tracking Hispanic mutations.15 However, these may duplicate some of those described in the other reports and therefore are not included in this analysis. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
199 The pooled data set demonstrates that the most frequently seen mutations are: ⌬F508, G542X, 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, ⌬I507, S549N, I148T, N1303K, 935delA, and 3849 ϩ 10kbCϾT. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment
202 which occur with a relative frequency above 1% in the pooled data set, only six (⌬F508, G542X, ⌬I507, I148T, N1303K, and 3849 ϩ 10kbCϾT) were included in the ACMG/ACOG 25-mutation screening panel12 and in the recent revision exclusion of I148T has been recommended.13 The most frequently seen mutations in the U.S. and Mexican studies combined (n ϭ 462 identified mutations) include the 10 most frequent mutations observed in the Mexican study.36 They also include all but one mutation (R334W) occurring with a relative frequency above 1% in the five combined studies performed in the U.S. In that group, only ⌬I507, N1303K and I148T were present at a relative frequency below 1%. Login to comment

PMID: 15681482 [PubMed] Chou LS et al: "Complete gene scanning by temperature gradient capillary electrophoresis using the cystic fibrosis transmembrane conductance regulator gene as a model."

No. Sentence Comment

75 Mutation Samples with Known Genotypes Scanned by TGCE* Exon Mutation† Amplicon size (bp) Location of mutation from 5Ј end (bp) Base change Detection‡ 3 G85E 234 124 G to A 1/1 3 394delTT 234 132 del TT 1/1 4 R117H 270 83 G to T 2/2 4 I148T 270 176 T to C 3/3 Intron 4 621 ϩ 1 G/T 270 233 G to T 1/1 5 663delT/663delT 186 75 del T 0/1 Intron 5 711 ϩ 1 G/T 186 124 G to T 1/1 7 R334W 345 208 C to T 1/1 7 R347P 345 248 G to C 1/1 9 A455E 263 155 C to A 2/2 10 I506V 292 168 A to G 1/1 10 ⌬I507 292 171 del ATC 2/2 10 ⌬F508 292 174 del TTT 2/2 10 ⌬F508/⌬F508 292 174 del TTT 0/1 10 F508C 292 175 T to G 1/1 10 V520F 292 210 G to T 1/1 Intron 10 1717-1 G/A 175 50 G to A 1/1 11 G542X 175 90 G to T 2/2 11 G542X/G542X 175 90 G to T 0/1 11 G551D 175 118 G to A 3/3 11 R553X 175 123 C to T 3/3 11 R560T 175 145 G to C 2/2 13 2184delA 834 356 del A 1/1 Intron 14b 2789 ϩ 5G/A 192 102 G to A 1/1 Intron 16 3120 ϩ 1G/A 216 111 G to A 1/1 19 R1162X 322 68 C to T 1/1 19 3659delC 322 111 del C 1/1 20 W1282X 206 154 G to A 1/1 21 N1303K 250 175 C to G 2/2 Total exon/intron Overall accuracy 17 93% *Samples were compared with their respective wild-type control (confirmed by sequencing). Login to comment
113 In this 270-bp fragment, heterozygous R117H (G/T) is located 83 bp from the 5Ј end, heterozygous I148T (T/C) is located in the middle of the fragment, and heterozygous 621 ϩ 1 (G/T) is located at the end of the fragment (37 bp from the 3Ј end) (Figure 4, A to D; Table 1). Login to comment
114 Heterozygous 621 ϩ 1 (G/T) had the least distinct split-peak pattern when compared to heterozygous R117H and I148T (Figure 4; B to D). Login to comment
146 A: Wild-type; B: R117H heterozygous (exon 4); C: I148T heterozygous (exon 4); D: 621 ϩ 1 G/T heterozygous sample 1 (intron 4); E: 621 ϩ 1 G/T heterozygous sample 2 (intron 4, from Coriell Repository); F: 621 ϩ 1 G/T heterozygous sample 3 (intron 4, from Coriell Repository). Login to comment
179 Discussion More than 1000 mutations have been reported since the CFTR gene was cloned and characterized in 1989.23,25 Of these mutations, ⌬F508 (a 3-base deletion) is the most frequent mutation and results in a defective cAMP-regulated chloride transport in epithelial cells.26 Other mutations in the CFTR gene such as G542X, G551D, and N1303K occur in greater than 1% in the CF population and are associated with severe pancreatic insufficiency.23,27 Recently, carriers of the I148T mutation have received more attention because I148T has been found in association with the 3199del6 mutation, which may be necessary for the classic CF phenotype.28 Because of the complexity of both the mutations and the phenotypes, a high-throughput mutation scanning method to screen the entire coding region of the CFTR gene may provide valuable clinical information regarding CF genotypes and respective phenotypes. Login to comment

PMID: 16156102 [PubMed] Dunbar SA et al: "Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array."

No. Sentence Comment

94 Methods The methods described below include: (1) design of oligonucleotide capture probes, (2) design of PCR amplification primers and multiplexed PCR reactions, (3) preparation of the probe-conjugated microsphere sets, (4) verification 150 Dunbar and Jacobson xMAPTM Table 2 Oligonucleotide Capture Probesa Target Microsphere Probe sequence Modificationb Sequence 5' → 3' set Standard mutation panel 1c I507 & F508 5'-AmMC12 AACACCAAAGATGATATTTT 006 2B DI507 5'-AmMC12 ACACCAAAGATATTTTCTT 008 3B DF508 5'-AmMC12 AAACACCAATGATATTTTC 015 4B W1282 5'-AmMC12 CAACAGTGGAGGAAAGCC 012 5B W1282X 5'-AmMC12 CAACAGTGAAGGAAAGCC 020 6 1717-1G 5'-AmMC12 TTGGTAATAGGACATCTCCA 017 7 1717-1GÆA 5'-AmMC12 TTGGTAATAAGACATCTCCA 019 8B G542 5'-AmMC12 TATAGTTCTTGGAGAAGGTGGA 026 9B G542X 5'-AmMC12 TATAGTTCTTTGAGAAGGTGGA 028 10C G551 & R553 5'-AmMC12 AGTGGAGGTCAACGAGCAA 038 11B G551D 5'-AmMC12 GTGGAGATCAACGAGCAA 030 12C R553X 5'-AmMC12 GTGGAGGTCAATGAGCAA 032 13 R560 5'-AmMC12 CTTTAGCAAGGTGAATAACT 035 14 R560T 5'-AmMC12 CTTTAGCAACGTGAATAACT 039 15 R117 5'-AmMC12 AGGAGGAACGCTCTATCGCG 042 16 R117H 5'-AmMC12 AGGAGGAACACTCTATCGCG 025 17B I148 5'-AmMC12 CTTCATCACATTGGAATGCAGA 034 18B I148T 5'-AmMC12 CTTCATCACACTGGAATGCAGA 045 19C 621+1G 5'-AmMC12 TTTATAAGAAGGTAATACTTCCT 046 20E 621+1G→T 5'-AmMC12 ATTTATAAGAAGTTAATACTTCCTT 048 21 N1303 5'-AmMC12 GGGATCCAAGTTTTTTCTAA 051 22 N1303K 5'-AmMC12 GGGATCCAACTTTTTTCTAA 052 23B 1078T 5'-AmMC12 CACCACAAAGAACCCTGA 054 24C 1078delT 5'-AmMC12 ACACCACAAGAACCCTGA 061 25 R334 5'-AmMC12 ATATTTTCCGGAGGATGATT 063 26 R334W 5'-AmMC12 ATATTTTCCAGAGGATGATT 064 27B R347 5'-AmMC12 ACCGCCATGCGCAGAACAA 067 28B R347P 5'-AmMC12 ACCGCCATGGGCAGAACAA 053 29C 711+1G 5'-AmMC12 ATTTGATGAAGTATGTACCTAT 059 30C 711+1G→T 5'-AmMC12 ATTTGATGAATTATGTACCTAT 071 31 G85 5'-AmMC12 TGTTCTATGGAATCTTTTTA 066 32B G85E 5'-AmMC12 ATGTTCTATGAAATCTTTTTA 073 33 3849+10kbC 5'-AmMC12 GTCTTACTCGCCATTTTAAT 077 34 3849+10kbC→T 5'-AmMC12 GTCTTACTCACCATTTTAAT 075 35 A455 5'-AmMC12 CCAGCAACCGCCAACAACTG 011 36D A455E 5'-AmMC12 TCCAGCAACCTCCAACAACTG 036 37 R1162 5'-AmMC12 TAAAGACTCGGCTCACAGAT 060 38 R1162X 5'-AmMC12 TAAAGACTCAGCTCACAGAT 068 39B 3659C 5'-AmMC12 TTGACTTGGTAGGTTTAC 022 40C 3659delC 5'-AmMC12 TTGACTTGTAGGTTTACC 079 41B 2789+5G 5'-AmMC12 TGGAAAGTGAGTATTCCATGTC 074 42D 2789+5G→A 5'-AmMC12 TTGGAAAGTGAATATTCCATGTC 014 43E 2184A 5'-AmMC12 GAAACAAAAAAACAATC 007 44E 2184delA 5'-AmMC12 AGAAACAAAAAACAATC 018 45B 1898+1G 5'-AmMC12 TATTTGAAAGGTATGTTCTTTG 013 (Continued) of microsphere coupling, (5) direct hybridization of biotinylated PCR amplification products to the multiplexed probe-coupled microsphere sets, and (6) results and data analysis. Login to comment
106 Table 3 Reverse Complementary Oligonucleotide Targetsa Target Target sequence Modification Sequence 5' → 3' Standard mutation panel C1b I507 & F508 5'-Biotin AAAATATCATCTTTGGTGTT C2 ΔI507 5'-Biotin AAAGAAAATATCTTTGGTGT C3 ΔF508 5'-Biotin AGAAAATATCATTGGTGTTT C4 W1282 5'-Biotin GGCTTTCCTCCACTGTTGC C5 W1282X 5'-Biotin GGCTTTCCTTCACTGTTGC C6 1717-1G 5'-Biotin TGGAGATGTCCTATTACCAA C7 1717-1G→A 5'-Biotin TGGAGATGTCTTATTACCAA C8 G542 5'-Biotin CCACCTTCTCCAAGAACTAT C9 G542X 5'-Biotin CCACCTTCTCAAAGAACTAT C10 G551 & R553 5'-Biotin CTTGCTCGTTGACCTCCACT C11 G551D 5'-Biotin CTTGCTCGTTGATCTCCACT C12 R553X 5'-Biotin CTTGCTCATTGACCTCCACT C13 R560 5'-Biotin AGTTATTCACCTTGATAAAG C14 R560T 5'-Biotin AGTTATTCACGTTGCTAAAG C15 R117 5'-Biotin CGCGATAGAGCGTTCCTCCT C16 R117H 5'-Biotin CGCGATAGAGTGTTCCTCCT C17 I148 5'-Biotin CTGCATTCCAATGTGATGAA C18 I148T 5'-Biotin CTGCATTCCAGTGTGATGAA C19 621+1G 5'-Biotin GGAAGTATTACCTTCTTATA C20 621+1G→T 5'-Biotin GGAAGTATTAACTTCTTATA C21 N1303 5'-Biotin TTAGAAAAAACTTGGATCCC C22 N1303K 5'-Biotin TTAGAAAAAAGTTGGATCCC C23 1078T 5'-Biotin CTCAGGGTTCTTTGTGGTGT C24 1078delT 5'-Biotin TCTCAGGGTTCTTGTGGTGT C25 R334 5'-Biotin AATCATCCTCCGGAAAATAT C26 R334W 5'-Biotin AATCATCCTCTGGAAAATAT C27 R347 5'-Biotin ATTGTTCTGCGCATGGCGGT C28 R347P 5'-Biotin ATTGTTCTGCCCATGGCGGT C29 711+1G 5'-Biotin TAGGTACATACTTCATCAAA C30 711+1G→T 5'-Biotin TAGGTACATAATTCATCAAA C31 G85 5'-Biotin TAAAAAGATTCCATAGAACA C32 G85E 5'-Biotin TAAAAAGATTTCATAGAACA C33 3849+10kbC 5'-Biotin ATTAAAATGGCGAGTAAGAC C34 3849+10kbC→T 5'-Biotin ATTAAAATGGTGAGTAAGAC C35 A455 5'-Biotin CAGTTGTTGGCGGTTGCTGG C36 A455E 5'-Biotin CAGTTGTTGGAGGTTGCTGG C37 R1162 5'-Biotin ATCTGTGAGCCGAGTCTTTA C38 R1162X 5'-Biotin ATCTGTGAGCTGAGTCTTTA (Continued) Rapid CF Screening by xMAPTM 153 Table 3 (Continued) Target Target sequence Modification Sequence 5' → 3' C39 3659C 5'-Biotin GGTAAACCTACCAAGTCAAC C40 3659delC 5'-Biotin AGGTAAACCTACAAGTCAAC C41 2789+5G 5'-Biotin ACATGGAATACTCACTTTCC C42 2789+5G→A 5'-Biotin ACATGGAATATTCACTTTCC C43 2184A 5'-Biotin AAGATTGTTTTTTTGTTTCT C44 2184delA 5'-Biotin AAGATTGTTTTTTGTTTCTG C45 1898+1G 5'-Biotin AAAGAACATACCTTTCAAAT C46 1898+1G→A 5'-Biotin AAAGAACATATCTTTCAAAT C47 3120+1G 5'-Biotin TTTTTACATACCTGGATGAA C48 3120+1G→A 5'-Biotin TTTTTACATATCTGGATGAA Reflex panel CR2 I506V 5'-Biotin GAAAATGTCATCTTTGGTGT CR3 I507V 5'-Biotin GAAAATATCGTCTTTGGTGT CR4 F508C 5'-Biotin AAAATATCATCTGTGGTGTT CR5 5T 5'-Biotin TCCCTGTTAAAAACACACAC CR6 7T 5'-Biotin CCCTGTTAAAAAAACACACA CR7 9T 5'-Biotin CCTGTTAAAAAAAAACACAC a The position and sequence of the mutation or variation is indicated in bold type. b Target C1 (I507 & F508) is also used in the reflex panel. Login to comment
114 Using a small target DNA (approx 100-300 bp) minimizes the potential for steric hindrance to affect the xMAPTM Table 4 PCR Amplification Primers Size CFTR target Mutation(s) Primer 5' Modification Sequence 5' → 3' (bp) Exon 10 ΔI507, ΔF508, BE10U 5'-Biotin TTCTGTTCTCAGTTTTCCTGG 107 I506V, I507V, E10D None TTGGCATGCTTTGATGACG F508C Exon 20 W1282X E20U None TTGAGACTACTGAACACTGAAGG 126 BE20D 5'-Biotin TTCTGGCTAAGTCCTTTTGC Intron 10 1717-1G→A E11U None TCAGATTGAGCATACTAAAAGTGAC 89 BE11D2 5'-Biotin GAACTATATTGTCTTTCTCTGCAAAC Exon 11 G542X, G551D, E11U2 None AAGTTTGCAGAGAAAGACAATATAG 135 R553X, R560T BE11D 5'-Biotin GAATGACATTTACAGCAAATGC Exon 4 R117H E4U None TTTGTAGGAAGTCACCAAAGC 145 BE4D2 5'-Biotin GAGCAGTGTCCTCACAATAAAGAG Exon 4/intron 4 I148T, E4U2 None CTTCTCTTTATTGTGAGGACACTGC 169 621+1G→T BE4D 5'-Biotin ATGACATTAAAACATGTACGATACAG Exon 21 N1303K BE21U 5'-Biotin TGCTATAGAAAGTATTTATTTTTTCTGG 106 E21D None AGCCTTACCTCATCTGCAAC Exon 7 1078delT, BE7U 5'-Biotin GAACAGAACTGAAACTGACTCG 199 R334W, R347P E7D3 None CAGGGAAATTGCCGAGTG Intron 5 711+1G→T I5U None CAACTTGTTAGTCTCCTTTCC 99 BI5D2 5'-Biotin AGTTGTATAATTTATAACAATAGTGC Exon 3 G85E E3U None CTGGCTTCAAAGAAAAATCC 117 BE3D2 5'-Biotin TGAATGTACAAATGAGATCCTTACC Chromosome 7 3849+10kbC→T BC7U 5'-Biotin GACTTGTCATCTTGATTTCTGG 148 C7D None TTTGGTGCTAGCTGTAATTGC Exon 9 A455E BE9U 5'-Biotin TCACTTCTTGGTACTCCTGTCC 105 E9D None CAAAAGAACTACCTTGCCTGC Exon 19-I R1162X BE19U 5'-Biotin ATTGTGAAATTGTCTGCCATTC 167 E19Da None CAATAATCATAACTTTCGAGAGTTG Exon 19-II 3659delC BE19U2 5'-Biotin TTTAAGTTCATTGACATGCCAAC 91 E19Da None CAATAATCATAACTTTCGAGAGTTG Intron 14B 2789+5G→A I14BU None GTGTCTTGTTCCATTCCAGG 147 BI14BD 5'-Biotin TGGATTACAATACATACAAACATAGTGG Exon 13 2184delA E13U None AGATGCTCCTGTCTCCTGG 126 BE13D 5'-Biotin TGCACAATGGAAAATTTTCGTATAG Intron 12 1898+1G→A I12U None TTAGACTCTCCTTTTGGATACC 110 BI12D 5'-Biotin GTCTTTCTTTTATTTTAGCATGAGC Intron 16 3120+1G→A I16U None ATGACCTTCTGCCTCTTACC 118 BI16D 5'-Biotin ATGAAAACAAAATCACATTTGC Intron 8 5T/7T/9T I8U None TAATGGATCATGGGCCATGTGC 212 BI8D 5'-Biotin ACTGAAGAAGAGGCTGTCATCACC CFTR, cystic fibrosis transmembrane conductance regulator gene. Login to comment
118 Table 5 Genomic DNA Samples CFTR genotype Sourcea Normal/normal Sigma, D6537 ΔF508/normal Patient sample ΔF508/ΔF508 Coriell Cell Repositories, NA04540 ΔI507/normal Coriell Cell Repositories, NA11277 W1282/normal Coriell Cell Repositories, NA11723 1717-1G→A/normal Coriell Cell Repositories, NA12444 G542X/G542X Coriell Cell Repositories, NA11496B G542X/normal Coriell Cell Repositories, NA11497B ΔF508/G551D Coriell Cell Repositories, NA11274 ΔF508/R553X Coriell Cell Repositories, NA07469 G551D/R553X Coriell Cell Repositories, NA11761 ΔF508/R560T Coriell Cell Repositories, NA11284 ΔF508/R117H Coriell Cell Repositories, NA13591 I148T/normal Patient sample ΔF508/621+1G→T Coriell Cell Repositories, NA11281 N1303K/G1349D Coriell Cell Repositories, NA11472A ΔF508/1078delT Patient sample R334W/? Login to comment

PMID: 15269305 [PubMed] Pont-Kingdon G et al: "Long-range (17.7 kb) allele-specific polymerase chain reaction method for direct haplotyping of R117H and IVS-8 mutations of the cystic fibrosis transmembrane regulator gene."

No. Sentence Comment

110 Mutations at these positions (621 ϩ 1G Ͼ T, 711 ϩ 1G Ͼ T, R347P, I148T, R334W, and 1078delT) could be detected and associated with one of the haplotypes. Login to comment

PMID: 15181620 [PubMed] Maisonneuve P et al: "Pancreatitis in hispanic patients with cystic fibrosis carrying the R334W mutation."

No. Sentence Comment

26 Of Ͼ1000 identified mutations in the CFTR gene, only 25 proven disease-causing mutant alleles (⌬F508, G551D, G542X, R553X, W1282X, R347P, NI303K, R560T, ⌬I507, 1717-1GϾA, A455E, 3120ϩ1GϾA, 621ϩ1GϾT, R117H, 711ϩ1GϾT, R1162X, 3849ϩ10kbCϾT, 2789ϩ5GϾT, R334W, G85E, 1078delT, 1898ϩ1GϾT, 2184delA, 3659delC, and I148T) are recommended by the American College of Medical Genetics for routine diagnostic and carrier testing.16 Most of these are routinely recorded in the CFF registry, but rarer mutations can be recorded if identified by more comprehensive testing. Login to comment

PMID: 12079272 [PubMed] Naruse S et al: "Cystic fibrosis and related diseases of the pancreas."

No. Sentence Comment

62 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic ®brosis of the pancreas'. Login to comment
64 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuQciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 W 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic &#ae;brosis of the pancreas'. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment

PMID: 10862085 [PubMed] Ellis LA et al: "A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning."

No. Sentence Comment

97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment

PMID: 10571949 [PubMed] Lazaro C et al: "Missense mutations in the cystic fibrosis gene in adult patients with asthma."

No. Sentence Comment

84 Characteristics of Asthmatic Patients With CFTR Mutations CFTR Age IgE Skin Patients genotype1 M470V2 PolyT3 Sex Years BHR4 IU/ml5 test6 SB221 R74W,V8551 M/V 7/7 M 67 - 329 + SB36 R75Q / - M/V 7/7 F 61 + 59 + SB47 R75Q / - M/V 7/9 M 67 NA 42 NA SB131 R75Q / - M/V 7/7 F 69 + 41 - SB296 R75Q / - M/V 7/9 F 45 + 96 - SB251 I148T / - M/V 7/9 F 70 - 25 - SB212 A534Q / - M/M 7/7 F 46 + 69 + SB125 R668C,G576A N/V 7/7 M 62 + 21 - SB154 R668C,G576A M/V 7/7 M 65 + 93 + SB231 R668C,G576A M/V 7/7 F 45 + 158 + SB112 R668C / - M/V 7/7 M 64 + 1350 + SB304 R668C,T582R M/V 7/7 F 78 - 7 - SB56 T896I / - M/V 7/7 M 72 + 77 - SB117 L997F / - V/V 7/9 F 81 NA 6 NA SB143 L997F/L997F V/V 7/7 F 39 NA 129 NA SB173 L997F / - M/V 7/9 F 67 + 127 - SB148 M1028R / - M/V 7/7 F 48 + 23 - SB32 R1066C / - M/V 7/7 F 69 - 9 - SB69 T1142I / - M/M 7/9 M 65 - 158 + SB92 R116L / - M/V 7/7 M 78 NA 64 NA SB53 T1220I / - M/M 7/9 F 60 + 62 + SB40 ∆F508 / - M/M 79 F 62 + 34 + SB9 - / - M/M 5/9 F 61 - 169 - SB20 - / - M/V 5/5 F 57 - 245 + SB116 - / - V/V 5/7 F 33 NA 41 NA SB118 - / - M/V 5/9 M 83 + 63 - SB140 - / - V/V 5/7 F 72 NA 35 NA SB142 - / - M/V 5/7 F 59 + 108 + SB201 - / - M/V 5/7 M 27 - 297 + SB205 - / - M/V 5/7 F 56 - 20 - SB284 - / - M/V 5/7 F 71 - 40 NA SB316 - / - M/V 5/7 F 78 NA 20 - 1 The CFTR genotype was studied by DGGE/SSCP analysis of all CFTR exons and intronic flanking sequences. Login to comment
93 Characteristics of 15 Amino Acid Variants/Mutants in the CFTR Gene Detected in 21 Patients With Asthma Other Evolutive Conservative Other mutations Mutation1 Reference2 Exon Domain3 Patients4 phenotypes5 conservation6 change7 at same position R74W Claustres et al., 1993 3 IC1 1 CF-PS/CBAVD b, m, r, s NC - R75Q Zielenski et al., 1991 3 IC2 4 CF-PS/DB/CBAVD/ b, d, m, r, s, x NC R75X (CF) CF Parents R75L (CBAVD) I148T Bozon et al., 1994 4 IC2 1 CF-PS b, d, m, r, s, x NC I148N (CF) A534Q This report 11 NBF1 1 - b, m NC A534E (CF) G576A Fanen et al., 1992 12 NBF1 3 CF-PS/CBAVD b, m, r, s NC G576X (CF) T582R Casals et al., 1997 12 NBF1 1 CF-PS b, d, m, r, s, x NC T582I (CF) R668C Fanen et al., 1992 13 R 5 DB/CF-PS/CBAVD/ b, d, m, r, s, x NC - CF Parents V855I This report 14a IC6 1 - b, r, s C - T896I This report 15 EC4 1 - b, d, m, r, s NC - L997F Fanen et al., 1992 17a TM9 3 DB/CF-PS/CBAVD/ b, d, m, r, s, x C - non-CF M1028R This report 17a TM10 1 - d NC M1028I (CF) T2066C Fanen et al., 1992 17b IC8 1 DB/CF-PI b, d, m, r, s, x NC R1066S (CF) R1066L (CF) R1066H (CF/CBAVD) T1142I This report 18 TM12 1 - b, d, m, r, s, x NC - R1162L Fanen et al., 1992 19 IC9 1 non-CF b, d, m, r, s, x NC R1162X (CF) T1220I Ghanem et al., 1994 19 NBF2 1 DB/non-CF b, d NC - 1 Mutation name according to the Cystic Fibrosis Genetic Analysis Consortium. Login to comment

PMID: 9541118 [PubMed] De Braekeleer M et al: "Is meconium ileus genetically determined or associated with a more severe evolution of cystic fibrosis?"

No. Sentence Comment

16 Although the A455E mutation is Table 1 Distribution of meconium ileus among CFTR genotypes in Saguenay Lac-Saint-Jean No of CF Proportion No of CFpatients Proportion Proportion ofMI Genotypes patients (%) with meconium ileus (%) among genotypes AF508/AF508 52 39.4 5 26.3 9.6 AF508/621+G-*T 34 25.8 9 47.4 26.5 AF508/A455E 14 10.6 0 0.0 0.0 621+1G-*T/A455E 8 6.1 0 0.0 0.0 621+1G-*T/G85E 2 1.5 1 5.3 50.0 621+1G-*T/Y1092X 1 0.8 0 0.0 0.0 AF508/Y1092X 4 3.0 1 5.3 25.0 A455E/R117C 1 0.8 0 0.0 0.0 AF508/I148T 2 1.5 0 0.0 0.0 621+1G-*T/ 4 3.0 0 0.0 0.0 711 +1G-*T 621+1G-4T/S489X 1 0.8 0 0.0 0.0 AF508/Q890X 1 0.8 1 5.3 100.0 621+1G->T/ 6 4.5 2 10.5 33.3 621+1G-sT AF508/unknown 1 0.8 1 5.3 100.0 Unknown/unknown 1 0.8 0 0.0 0.0 Table 2 Main clinicalfindings in patients with meconium ileus With MI Without MI p value No of patients 18 18 Sex (M/IF) 6/12 6/12 No of patients alive 16 17 Mean age (SD) 16.75 (9.7) 16.70 (7.9) p=0.99 Mean birth weight (SD) 3.24 (0.40) 3.02 (0.47) p=O.18 Mean birth height (SD) 50.0 (2.27) 50.0 (2.58) p=0.86 Currentweightcentile (SD) 26.7 (24.5) 14.1 (18.0) p=0.06 Current height centile (SD) 29.9 (25.1) 20.6 (25.6) p=0.33 Sweat chloride concentration (mEq/l) 105.9 (6.5) 101.1 (9.8) p=O.12 Mean FVC (SD) 89.7 (24.4) 93.0 (17.0) p=0.75 Mean FEV (SD) 73.1 (23.9) 75.4 (18.7) p=0.81 Mean Shwachman score (SD) 82.8 (11.8) 79.2 (12.6) p=0.36 Colonisation with Pseudomonas aeruginosa 13 14 p=0.70 Staphyloccoccus aureus 16 17 p=0.55 Haemophilus influenzae 13 14 p=0.70 Pseudomonas maltophilia 4 6 p=0.46 Pseudomonas cepacia 0 1 Pancreatic insufficiency 18 18 DIOS 7 1 p=0.016 Rectal prolapse 1 2 p=0.55 Recurrent abdominal pain 6 1 p=0.035 Diabetes mellitus 5 0 p=0.016 Liver complications 3* 0 p=0.07 Nasal polyposis 6 6 p=1.00 DIOS=distal intestinal obstruction syndrome. Login to comment

PMID: 9550360 [PubMed] De Braekeleer M et al: "Complete identification of cystic fibrosis transmembrane conductance regulator mutations in the CF population of Saguenay Lac-Saint-Jean (Quebec, Canada)."

No. Sentence Comment

31 There were 11 patients with a AF508/AF508 genotype, two with AF508/621 +l G + T and one with AF508/A455E and N1303K/I148T genotype each. Login to comment

PMID: 9439669 [PubMed] Casals T et al: "High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes."

No. Sentence Comment

33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes. Login to comment

PMID: 9305991 [PubMed] Seibert FS et al: "Disease-associated mutations in cytoplasmic loops 1 and 2 of cystic fibrosis transmembrane conductance regulator impede processing or opening of the channel."

No. Sentence Comment

7 Thus, the N-terminal CLs appear not to contribute to the anion translocation pathway of CFTR; rather, mutations in CL1 can impede transition to the open state. Interestingly, the ability of the non-hydrolyzable ATP analogue adenylyl imidodiphosphate (AMP-PNP) to lock the channel into open bursts was abolished by the I148T and G178R amino acid substitutions. Login to comment
106 However, only the mutations I148T, I175V, G178R, E193K, and R297Q allowed wild-type-like maturation of the protein to the fully glycosylated 170 kDa species (band C). Login to comment
120 In accordance with reduced levels of processing, the H139R, G149R, D192G, and R258G mutations significantly decreased the anion translocation capability of CFTR, whereas the properly processed I148T, I175V, and R297Q variants allowed iodide movement comparable to that of wild type. Login to comment
147 This discrepancy may originate from the additional observation that G178R-CFTR (as well as I148T-CFTR) could not be locked open by the nonhydrolyzable ATP analogue AMP-PNP. Login to comment
149 Thus, the number of channels per patch may have been underestimated for I148T-CFTR- and G178R-CFTR-expressing cells, resulting in a systematic overestimation of the Po. Login to comment
190 I148T, I175V, and R297Q did not adversely affect the processing, gating, or conductance of CFTR. Login to comment
199 The entire CFTR gene was not sequenced in patients with mutations I148T, I175V, or R297Q when these mutations were published. Login to comment
208 (B) Mean single-channel current-voltage relationship of wild-type CFTR and I148T-CFTR as a representative CL 1 and 2 mutant. Login to comment
209 Each point represents the mean ( SE (where this is larger than the size of the symbol) of data from four (I148T) or five (WT) patches. Login to comment
217 Note that the I148T- and G178R-CFTR variants could not be locked open with AMP-PNP, so that for these mutants the number of channels in each patch may have been underestimated. Login to comment

PMID: 9222762 [PubMed] Jordanova A et al: "SSCP analysis: a blind sensitivity trial."

No. Sentence Comment

22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

PMID: 8844213 [PubMed] Morral N et al: "Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers."

No. Sentence Comment

108 (1992) (continued) TABLE2. CFTR Haplotypesfor Diallelic and MultiallelicDNA Markersfor 94 CF Mutations' (Continued) J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-2-1 17-7-17 Q30X 1 - b ChillBn et al. (1994b) (0.7%) 23-7-17 I148T 1 0.48 b Bozon et al. (1994) 17-7-17 AF508 1 - fb fp1-6-1-1 20-7-17 AF508 1 fph17-7-17 AF508 2(-) 1-8-2-1 15-7-17 L558S 1 (-) 2- - -2 16- - CFBOkbdel#l 3 b Morral et al. (1993b) (-1 - - fb- "Allele1 denotesthe absence of the restriction site, whereas allele 2 denotes its presence.Numbers for microsatellites GAIT, IVSSCA, RIS17BTA. Login to comment

PMID: 8829658 [PubMed] Cronin MT et al: "Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays."

No. Sentence Comment

238 Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design. Login to comment

PMID: 7472820 [PubMed] Wilschanski M et al: "Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations."

No. Sentence Comment

43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles. Login to comment

PMID: 7540587 [PubMed] Bienvenu T et al: "Three novel sequence variations in the 5' upstream region of the cystic fibrosis transmembrane conductance regulator (CFTR) gene: two polymorphisms and one putative molecular defect."

No. Sentence Comment

20 Materials and methods Patients Some 29 CF patients (19 AF508/X, 1 1717-1G->A/X, 1 GI061R/X, 1 R553X/X, 1 R334W/X and 6 X/X; X = unidentified mutation), 10 men with congenital bilateral absence of the vas deferens (3 AF508/X, 1 N1303K/X, 1 SI235R/X, 1Q1291R/X and4 X/X) and I6 subjects with chronic pulmonary disease suggestive of CF (1 AF508/X, 1 I148T/X and 14 X/X) were included in this study. Login to comment

PMID: 7516305 [PubMed] Audrezet MP et al: "Identification of three novel mutations (457 TAT-->G, D192G, Q685X) in the Slovenian CF patients."

No. Sentence Comment

51 Mutations identified in the population of Slovenia Number of chromosomes Mutations 661 83 AF508 4 G542X 5 R1162X 2 3905 ins T 2 I148T 1 Q552X 1 Q685X 1 S4X 1 457 TAT---~G 1 D192G 1 R1066H 19 Unidentified 121 Exons Frequencies References 10 68.60% Kerem et al. (1989) 11 3.30% Kerem et al. (1990) 19 4.10% Gasparini et al. (1991) 20 1.65% Personal Communication 4 1.65% Personal Communication 11 0.85% Devoto et al. (1991) 13 0.85% This study 1 0.85% Glavac et al. (1993) 4 0.85% This study and Glavac et al. (1993) 5 0.85% This study 17b 0.85% Ftrec et al. (1992) 15.70% by 11 mutations, occurring in 9 exons of the gene (1, 4, 5, 10, 11, 13, 17b, 19, and 20). Login to comment

PMID: 7521710 [PubMed] Ravnik-Glavac M et al: "Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene."

No. Sentence Comment

120 Exon 1: S4X (24), 186-13C-G (F£rec et al., pers. comm.); Exon 2: G27X (Shacldeton and Harris, pers. comm.), Q30X (Chilldn aal., pers. comm.), R31L (Zielenski et al., pers. comm.), Q39X (25); Exon 3: 300delA (Malone et al., pers. comm.), W57G (Ferrari et al., pers. comm.), W57X (26), E60X (Malone et al., pers. comm.), R74W (Claustres et al., pers. comm.), R75Q (27), G85E (28), 394delTT (Claustres et al., pers. comm.), L88X (Maceketal., pers. comm.), L88S (Malone et al., pers. comm.), 405 + 1G-A (Dork and Tummler, pers. comm.); Exon 4: E92K (Chillon et al., pers. comm.), E92X (D6rk a al., pers. comm.), P99L (Schwartz and Holmberg, pers. comm.), 441delA (Zielenski et al., pers. comm.), 444delA (29), 457TAT-C- (F£rec et al., pers. comm., (21), Dl 10H (14), Rl 17C (D6rk et al., pers. comm.), Rl 17H (14), A120T (Chillon et al., pers. comm.), 541delC (30), 556delA (28), I148T (Rininsland et al., pers. comm.), Q151X (Shacldeton et al., pers. comm.), 621 + 1C-T (28), 622-2A-C (31); Exon5:G178R (28), 681delC (Zielenski a al., pers. comm.), 711 + 1G-T (28); Exon 6a: H199Y (Dork and Tummler, pers. comm.), H199Q (Dean etal., pers. comm.), L206W (Claustres et al., pers. comm.), Q220X (Shacldeton and Harris, pers. comm., Schwartz and Holmberg, pers. comm.), 852del22 (32); Exon 6b: 977insA (33); Exon7:F311L(34). Login to comment

PMID: 7513293 [PubMed] Chillon M et al: "Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes."

No. Sentence Comment

41 A Exon 13 4 0.41 621-1 G--~T Intron 4 3 0.31 P205S Exon 6a 3 0.31 936 del TA Exon 6b 3 0.31 1949 del 84 Exon 13 3 0.31 K710X Exon 13 3 0.31 CF del #1 Exon 4-7/11-18 3 0.31 L206W Exon 6a 2 0.20 R347H Exon 7 2 0.20 Y1092X Exon 17b 2 0.20 Q1100P Exon 17b 2 0.20 Q30X Exon 2 1 0.10 E92K Exon 4 1 0.10 A120T Exon 4 1 0.10 I148T Exon 4 1 0.10 H199Y Exon 6a 1 0.10 1078 del T Exon 7 1 0.10 1717-1 G--+A Intron 10 1 0.10 T582R Exon 12 1 0.10 E585X Exon 12 1 0.10 1898+3 A~---G Intron 12 1 0.10 W1098X Exon 17b 1 0.10 R1158X Exon 19 1 0.10 3667 del 4 Exon 19 1 0.10 3860 ins 31 Exon 20 1 0.10 3905 ins T Exon 20 1 0.10 Unknown 212 21.81 The Basque subset The Basques have a different genetic background with respect to other ethnic groups (Pancorbo et al. 1989) as they are the only pre-Indoeuropean group in Spain. Login to comment

PMID: 7513292 [PubMed] Verlingue C et al: "Retrospective study of the cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Guthrie cards from a large cohort of neonatal screening for cystic fibrosis."

No. Sentence Comment

68 CFI'R mutations characterized by denaturing gradient gel electrophoresis and DNA sequencing from Guthrie cards of 98 children with cystic fibrosis 431 Number of Mutations Exons Fre- References chromo- quencies somes 129 AF508 10 65.8 Kerem et al. 1989 5 G551D 11 2.8 Cutting et al. 1990 3 2183 AA---~G 13 1.7 unpublished data 3 N1303K 21 1.7 Osborne et al. 1991 3 G542X 11 1.7 Kerem et ai.1990 2 E92K 4 1.1 Nunes et al. 1993 2 I148T 4 1.1 unpublished data 2 574 del A 4 1.1 Fanen et a1.1992 2 1078 del T 7 1.1 Claustres et a1.1992 2 E585X 12 1.1 Cremonesi et al. 1992 2 2789 + 5 G--->A intron 14b 1.1 unpublisheddata 2 3659 del C 19 l. Login to comment

PMID: 7691344 [PubMed] Claustres M et al: "Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France."

No. Sentence Comment

26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment

PMID: 7689896 [PubMed] Morral N et al: "Microsatellite haplotypes for cystic fibrosis: mutation frameworks and evolutionary tracers."

No. Sentence Comment

49 Mutations I148T A120T E92K 621+1G->T R334W 1078delT CFSOKBdeUM G551D G54 AJ507 lDuIKJt AF5O8 2X If*A Iv 1OA 28691m '10X }f)a\OA (G 3601-111G->C R1162X 3860)ns31 R1158X 3€€7deM I W1282X 141303K | | 1 2 3 Exons Markers 6 7 8 8 • b 10 11 12 13 14 15 • t> 16 17 18 19 20 21 22 23 24 IVS8CA IVS17BTA / IVS17BCA Figure 1. Login to comment
58 CF mutations identified in the Spanish population Mutation AF5O8 G542X N13O3K 36O1-111G-C R1162X 1609delCA 2869insG W1282X AI507 G551D 1949del84 CF50KBdel tt 1 K710X 621 + 1G-T R334W 1078delT E92K 3667deM R1158X A120T I148T 386Oins31 Unknown Total N 437 73 18 18 14 8 6 6 5 4 3 3 3 2 2 1 1 1 1 1 1 1 271 880 % 49.7 8.3 2.1 2.1 1.6 0.9 0.7 0.7 0.6 0.5 0.3 0.3 0.3 0.2 0.2 0. Login to comment
138 CFTR mjcrosatellhe haplotypes for 19 CF mutations Haplotypes 8CA 16 17 23 14 16 17 16 16 16 17 17 16 21 22 17BTA 7 7 7 31 31 31 44 43 46 45 46 - 31 30 17BCA 17 17 17 13 13 13 13 13 13 13 13 - 13 13 Mutation 1609delCA (0.9) AI507 (0.6) G551D (0.5) 3667del4 (0.1) W1282X (0.7) R1158X(0.1) I148T (0.1) 1949del84 (0.3) K710X (0.3) 1078ddT (0.1) R1162X (1.6) 2869insG (0.7) 3601-111G-C (2.1) E92K (0.1) 3860ins31 (0.1) R334W (0.2) CF50KBdel#l (0.3) Chromosomes CF Number 8 5 4 1 5 1 1 3 2 1 7 5 1 18 1 1 2 3 621 + 1G-T (0.2)1 A120T (0.1) 1 % Normal 14.5 2.9 0.6 - 10.0 1.1 1.9 - 3.0 - 0.2 - 0.4 - CF cystic fibrosis; ( ) frequency of mutation in the population. Login to comment
202 Mutations I148T, A120T, and 1078deIT were analysed by SSCP analysis. Login to comment

PMID: 1376016 [PubMed] Kristidis P et al: "Genetic determination of exocrine pancreatic function in cystic fibrosis."

No. Sentence Comment

10 This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as AF508, A1507, Q493X, G542X, R553X, W1282X, 621 + 1G-PT, 1717-1G--'A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T. Login to comment
58 Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both. Login to comment
66 As shown in table 3, meconium ileus Table 2 1181 Table 3 Frequency of 25 CF Mutations in Chromosomes of the Toronto Study Population Mutation AF508 ...... G551D...... G542X...... 621 +1G-'T N1303K..... W1282X..... R1 17H...... 1717-1G-~A R560T...... A1507 ...... R553X...... V52OF ...... R334W ..... A455E...... I148T ...... Q493X...... P574H...... R347P ...... SS6delA ..... 3659delC .... G480C...... 444delA ..... D110H...... G458V...... S549R ...... Y563N...... Login to comment

PMID: 10876009 [PubMed] Castaldo G et al: "Prenatal diagnosis of cystic fibrosis: a case of twin pregnancy diagnosis and a review of 5 years' experience."

No. Sentence Comment

80 of cases IVS8 17bCA 17bTA XV2c KM19 and (%) DF508/DF508 13 - - - - - b DF508/N1303K 4 - - - - - DF508/I148T 1 - - - - - DF508/W1282X 1 - - - - - DF508/R553X 1 - - - - - W1282X/N1303K 1 - - - - - N1303K/71111G . Login to comment
101 In the second case, the female had been identified as carrier a of DF508, being the sister of a DF508 carrier, and the partner had been sequentially characterized as carrying I148T, even if the family anamnesis was negative for cystic fibrosis. Login to comment
102 The fetus had only the I148T mutation. Login to comment

PMID: 11231624 [PubMed] Quinton PM et al: "The neglected ion: HCO3-."

No. Sentence Comment

70 However, mutations in CFTR that result in pancreatic insufficiency and more severe forms of the disease (bottom) do not support HC03 - transport but, surprisingly, may support normal Cl-transport (I148T). Login to comment

PMID: 11448786 [PubMed] Wine JJ et al: "Cystic fibrosis: the 'bicarbonate before chloride' hypothesis."

No. Sentence Comment

37 That is true even for subjects who are homozygous for mutations I148T [13] and G551D (R. Moss, personal communication). Login to comment
52 Ion transport (% WT) 42 41 69 75 >100 >100 98 + 103 100 + + 120 Pancreatic sufficient Pancreatic insufficient Bicarbonate Chloride - intermediate Chloride - high Unknown WT D648V R117H R1070Q H949Y G551S H620Q I148T A1067T G178R G970R S1255P G1244E G551D G1349D 0 0.5 1 1.5 2 2.5 Current Biology ࢞F508 Dispatch R absence of the vas deferens [16]. Login to comment
77 Published values were found for H949Y [22] and G551S [17] and I148T [13]. Login to comment

PMID: 15298139 [PubMed] Lewis MJ et al: "Cystic fibrosis."

No. Sentence Comment

95 ēa; ēa;Table 3ēa; ēa; Recommended Mutation Panel for Cystic Fibrosis Carrier Screening ࢞F508 ࢞I507 G542X G551D W1282X N1303K R553X 621+1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711+1G>T 1898+1G>A 2184delA 1078delT 3849+10kbC>T 2789+5G>A 3659delC I148T 3120+1G>A I506V* I507V* F508C* 5T/7T/9T* * Reflex tests. Login to comment

PMID: 17254580 [PubMed] Karpman E et al: "Compound genetic abnormalities in patients with cystic fibrosis transmembrane regulator gene mutation."

No. Sentence Comment

9 Result(s): Two patients (3.1%) out of 65 were identified in our database to have compound genetic abnormalities. One patient had a W1282X mutation while the other had an I148T mutation. Login to comment
71 This revealed that the patient was a heterozygous carrier of the I148T mutation for cystic fibrosis and had a wild-type poly T tract. Login to comment
100 Study Year CFTR,IVS8-T Kayotype Y-del SA Exam FSH Testis histology Current study 2006 W1282X/afa;,WT/WT 46,XY AZF baf9;c Azo Bil Vas 4 Late, incomplete maturation arrest Current study 2006 I148T/afa;, WT/WT 46, XY AZF baf9;c OAT Bil Vas 19 NA Shulz et al. (11) 2006 F508/afa; , WT/WT 45,XY, der(14;22) None OAT Bil Vas NA NA Dohle et al. (9) 2002 F508/afa;, 7T/9T 46,XY AZFc OAT Hypogonadism 7.3 NA Dohle et al. (9) 2002 R117H/afa; 47,XXY None Azo Hypogonadism 11 NA Meng et al. (10) 2001 F508/afa;, 7T/9T 46,XY AZFb Azo CBAVD NA Sertoli cell only Black et al. (8) 2000 afa;/afa;, 5T/9T 46,XY,inv (6)(p12q21) None Azo CBAVD 8.8 Late, incomplete maturation arrest Note: Azo afd; azoospermia; Bil Vas afd; bilateral vas deferens present; CBAVD afd; congenital bilateral absence of the vas deferens; CFTR afd; cystic fibrosis transmembrane receptor; FSH afd; follicle stimulating hormone; NA afd; not available; OAT afd; oligoasthenoteratozoospermia; SA afd; semen analysis; WT afd; wild type. Login to comment
104 1468.e Fertility and Sterility;de; cases had èc;F508 mutations, whereas these new patients were carriers of the W1282X and I148T mutations. Login to comment
106 Our second patient had an I148T mutation, which has a reported frequency of 0.09% in the cystic fibrosis population. Login to comment

PMID: 18206817 [PubMed] Teich N et al: "Hereditary chronic pancreatitis."

No. Sentence Comment

75 Some authors state that compound heterozygous CFTR carriers have a distinct elevated risk for the development of chronic pancreatitis, which is even higher when an additional SPINK1 mutation is present.51,54 However, the role of some CFTR mutations has to be reconsidered since Rohlfs et al demonstrated that the mutation I148T in exon 4, which was classified as a severe cystic-fibrosis-causing mutation, is not associated with cystic fibrosis. Login to comment
76 According to their data the complex allele 3199del6 and I148T seem to be the relevant factor.55 In summary, CFTR mutations alone are not sufficient for the pathogenesis of chronic pancreatitis in most patients, and further studies are needed to elucidate the role of CFTR in the pathogenesis of chronic pancreatitis. Login to comment

PMID: 23503723 [PubMed] Zhou L et al: "Symmetric snapback primers for scanning and genotyping of the cystic fibrosis transmembrane conductance regulator gene."

No. Sentence Comment

48 PRIMERS AND NOMENCLATURE Previously described CFTR primers (8) were modified with 5b18; tails to enable snapback genotyping of the 23 ACMG mutations (17), p.I148T, and 7 common benign variants. Login to comment

PMID: 23523379 [PubMed] Rechitsky S et al: "PGD for cystic fibrosis patients and couples at risk of an additional genetic disorder combined with 24-chromosome aneuploidy testing."

No. Sentence Comment

56 (CA)n EXON 4 (GATT)n Intron 4 Poly T tract Intron 10 R117H G--A R75XH C--T A120T G--A I148T T--C A349V C--T 1259 Ins A 621+1 G--T EXON 3 EXON 7 EXON 8 Delta I 507 EXON 10 Delta F 508 EXON 11 1717-1 G--A G542X G--T G550X G--T G551D G--A R553X C--T R560T G--C EXON 19 EXON 20 EXON 21 R1162X C--T W1282X G--A N1303K C--G IVS 1 Mutations in CFTR gene (PGD PERFORMED FOR 52 MUTATIONS) IVS 6 a IVS 8 (CA)n (CA)n IVS 17b (TA)n (CA)n D7S486 D7S522 D7S633 D7S677 D7S2847 D7S655 115,89 116.07 117.01 117.13 117.19 117.20 118.6 118.81 Mb IVS8-1 IVS8-2 Figure 1 Mutations (above) and linked markers (below) in CFTR that were used in multiplex PCR. Login to comment

PMID: 23974870 [PubMed] Sosnay PR et al: "Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene."

No. Sentence Comment

468 Rohlfs, E.M. et al. The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis. Login to comment

PMID: 24014130 [PubMed] Langfelder-Schwind E et al: "Molecular testing for cystic fibrosis carrier status practice guidelines: recommendations of the National Society of Genetic Counselors."

No. Sentence Comment

95 Evolution of Test Panels and Their Interpretation: The Example of I148T/3199del6 Large-scale population carrier screening is providing new information regarding the frequency of alleles in healthy and patient populations. Login to comment
96 A key example is the I148T/3199del6 mutation. Login to comment
97 Initially, I148T was included on the ACOG/ACMG standard mutation panel (ACOG and ACMG 2001). Login to comment
98 However, it was later learned that I148T only behaved as a deleterious mutation when in cis with 3199del6. Login to comment
99 Individuals with a known deleterious mutation in trans to an I148T mutation in the absence of a cis 3199del6 were asymptomatic (Monaghan et al. 2004). Login to comment
100 As a result, I148T was removed from the ACMG standard mutation panel (Rohlfs et al. 2002; Buller et al. 2004). Login to comment

PMID: 24225052 [PubMed] Parisi GF et al: "Phenotypic expression of the p.Leu1077Pro CFTR mutation in Sicilian cystic fibrosis patients."

No. Sentence Comment

132 Bozon D, Zielenski J, Rininsland F, Tsui LC: Identification of Four New Mutation in the Cystic Fibrosis Transmembrane Conductance Regulator Gene: I148T, L1077P, Y1092X, 2183AA ࢐ G. Login to comment

PMID: 24586523 [PubMed] Zietkiewicz E et al: "CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients."

No. Sentence Comment

68 Mutations detected in a patient Number of CF patients Alleles with no mutation identified Alleles with CF mutations detected using INNOLiPA tests Further molecular analysis CFTR_19 CFTR_17TnUpdatea both 503 (68.1%) 0 888 (60.2%) 118 (8.0%) Not necessary one 109 (14.8%) 109 98 (6.6%) 11 (0.7%) Yes none 126 (17.1%) 252 0 0 Yes Legend: a I148T included in CFTR-17TnUpdate was not counted as a mutation if not in cis with c.3067-72del6 (l.n. 3199del6); c.1210(-12)Tn site in intron 9 (l.n.IVS8-Tn) without data on the associated TG repeat was not counted as a mutation. Login to comment
101 The more recent estimates provide much lower values, ranging from 1:5000 [14], 1:6000 cited in WHO 2002 report [15] to 1:7500 for Southeastern Poland estimated for a 1-year period of Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 15 17 L967S 0.27 c.2900T.C 3032T.C 1 CFMDB; rs1800110 unknown 18 21 D1152H 0.50 c.3454G.C 3586G.C 1 CFMDB; rs75541969 F508del Sequence changes considered as lacking pathogenic effect 4 4 I148T 2.04 c.443T.U 575T.U 4 IL19e unknown 13 14 I752V 0.35 c.2254A.G 2386A.G 1 Novelf F508 15 17 S912L 2.12 c.2735C.T 2867C.T 1 CFMDBg ; rs121909034 F508 Legend: a IL19 i 17 - mutations included in the INNOLiPA tests (see below); CFMDB - non-INNOLiPA mutations present in the CTFR mutation database; novel - mutations first reported in this study; b in three chromosomes R668C with G576A in trans; c F508del, c.1585-1G.A, G542X, N1303K or c.579+3A.G; d F508del, G542X, R553X or N1303K; e not pathogenic if not in cis with c.3067-72del6 (l.n.3199del6); f not pathogenic - see explanation the text; g not pathogenic if not in cis with G1244V. Login to comment
102 a Mutations detected by two INNOLiPA_CFTR tests (legacy names): IL19 (INNOLiPA_CFTR19): F508del; G542X; N1303K; W1282X; G551D; 1717-1G.A; R553X; CFTRdele2,3(21kb); I507del; 711+1G.T; 3272-26A.G; 3905insT; R560T; 1898+1G.A; S1251N; I148T; 3199del6; 3120+1G.A; Q552X. Login to comment

PMID: 24631642 [PubMed] Fanen P et al: "Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies."

No. Sentence Comment

70 Group A Group B Group C Group D Classic-CF CF-causing mutations Non-classic CF CFTR-related disorder associated mutations No clinical consequence Unknown clinical relevance All mutations in Table 2 and 711 + 3A > G*, R117H-T5*, D1152H*, L206W*, TG13-T5* TG13-T5a , R117H-T5a , D1152Ha , L206Wa , L997F, M952I, D565Ga , TG11-T5b , R117H-T7b , D443Y-G576A-R668C, R74W-D1270N, R75Qb TG11-T5b , R117H-T7b , R75Qb , 875 + 40A/G, M470V, T854T, P1290P, I807M, I521F, R74W, F508C, I506V, I148T All mutations (mostly missense) not yet analyzed or undergoing functional analysis a Mutations that may belong either to Group A or to Group B. b Mutations that may belong either to Group B or to Group C. Login to comment
125 As of today, only a few of such mutants have been identified, namely p.Arg75Gln and p.Ile148Thr (Choi et al., 2001; Schneider et al., 2011). Login to comment
126 While p.Ile148Thr appears not to be deleterious (Claustres et al., 2004), p.Arg75Gln was found in some studies Fig. 3. Classification of CF mutations according to CFTR structure and function assessment. Login to comment

PMID: 25033378 [PubMed] LaRusch J et al: "Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis."

No. Sentence Comment

66 Other candidate CFTR variants, including I148T, M470V, T854T, Q1463Q and the ''5T`` allele, were either rare or were not associated with pancreatitis in our cohort (Table 1). Login to comment
71 I148T was seen in three cases and one control, so an effect could not be detected or excluded; the in cis deletion mutation 3199del6 was not detected in any I148T carriers. Login to comment
116 CFTR variant %Cases %Uctrls OR p-value %Cases w/N34S OR w/N34S p-value w/N34S F508C 0.5 0.3 1.58 0.21 0.0 0.00 0.67 R1162L 0.5 0.5 1.13 0.29 1.8 4.03 0.17 I1027T 0.5 0.3 1.99 0.17 0.0 0.00 0.70 R31C 0.3 0.7 0.42 0.088 0.0 0.00 0.52 I148T 0.3 0.4 0.75 0.27 0.0 0.00 0.63 R297Q 0.3 0.2 1.89 0.21 0.0 0.00 0.76 R74W 0.2 0.2 0.85 0.29 0.0 0.00 0.71 F1052V 0.1 0.2 0.63 0.27 0.0 0.00 0.76 I807M 0.1 0.1 1.26 0.30 0.0 0.00 0.83 R258G 0.1 0.1 1.26 0.30 0.0 0.00 0.83 G1069R 0.1 0.0 0.13 0.0 V201M 0.0 0.1 0.17 0.0 0.00 0.83 Of the 81 CFTR mutations tested in the cohort, 43 were observed at least once in cases or controls. Login to comment
224 I148T was seen in three cases and one control, so an effect could not be detected or excluded; the in cis deletion mutation 3199del6 was not detected in any I148T carriers. Login to comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment
270 3199del6 was genotyped via TaqMan on all samples that tested positive for I148T. Login to comment

PMID: 25304080 [PubMed] Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."

No. Sentence Comment

43 Nevertheless, mutation I148T, at first classified as a mutation, now is considered an 'innocent` polymorphism, able to be pathogenetic only if present in the same gene (on the same chromosome) with another polymorphism (3199del6). Login to comment
44 Hence it is necessary, in presence of polymorphism I148T, to detect the presence of polymorphism 3199del6. Login to comment
45 The polymorphism 3199del6 was not detected in all patients with the I148T variant. Login to comment
47 The molecular analysis of the CFTR gene revealed that the two Table 1 Number of subjects tested who were carriers of the cystic fibrosis transmembrane regulator gene Mutation Men Women Total G551D 1 2 3 R553X 0 1 1 F508del 35 32 67 N1303K 7 8 15 I148T 4 9 13 G542X 3 6 9 DI507 2 0 2 L1077P 0 2 2 D1152H 1 6 7 W1282X 2 0 2 2183 AA>G 3 0 3 1259insA 0 1 1 4016insT 1 0 1 I507del 1 0 1 2789+5G>A 1 0 1 4382delA 0 2 2 G1244E 1 0 1 621+3A>G 1 0 1 Total 63 69 132 Figure 1 76 patients with cystic fibrosis and positive sweat test, all have two genes mutated. Login to comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

PMID: 25963003 [PubMed] Ooi CY et al: "Inconclusive diagnosis of cystic fibrosis after newborn screening."

No. Sentence Comment

103 In combination with a disease-causing mutation, R117H-7T has been associated with diagnostic uncertainties in CF, TABLE 2 Genotypes of Subjects With CFSPID According to Initial Sweat Chloride Measurements Sweat Chloride ,30 mmol/L Sweat Chloride 30-59 mmol/L Allele 1 Allele 2 n Allele 1 Allele 2 n F508dela R117H (7T)b 9 F508dela R117Cd 2c F508dela 5Tb 2 F508dela L206Wd 2c F508dela D1152Hb 2 F508dela P67Ld 1c F508dela R117Hb 1 F508dela 5Tb 8 F508dela D1270Nb 1 F508dela R117H (7T)b 3 F508dela L997F 3 F508dela R117Hb 3 F508dela 1716G.A 1 F508dela S1455X 1c F508dela 621+3G.A 1 F508dela R170H 1 F508dela I1328T 1 F508dela I148T 1 F508dela L967S 1 F508dela L997F 1 F508dela M1137T 1 F508dela Q1476X 1 F508dela Y301C 1 F508dela S1235R 1 1717-1G.Aa D1152Hb 1 F508dela T1299I 1 2183AA.Ga 5Tb 1 2183AA.Ga R117Cd 1 2183AA.Ga S431G 1 2789+5G.Aa R117H (7T)b 1 3849+10kbC.Ta 3041-15T.G 1 3849+10kbC.Ta 3041-15T.G 1 621+1G.Ta R117H (7T)b 1 621+1G.Ta G1069Rb 1 711+1G.Ta D1152Hb 1 G542Xa L206Wd 1c G542Xa R117H (7T)b 1 G542Xa C1410T 1 G542Xa D1152Hb 1 G551Da 5Tb 1 G551Da D1152Hb 1 N1303Ka 5Tb 1 N1303Ka D1152Hb 1 R1162Xa R117H (7T)b 1c N1303Ka E527G 1 R553Xa 5Tb 1 R117H (5T)a 5Tb 1 R553Xa L997F 1 R117H (7T)b R117H (7T)b 1 R560Ta G576A 1 R117H (7T)b 3041_71G.C 1 W1282Xa 5Tb 2 R117Hb Q1476X 1 F508dela - 2 R117H (5T)a - 1 -, no mutation identified on the second allele. Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

87 [Gln359Lys; Thr360Lys] L558S c.1673 T4C p.Leu558Ser Y569D c.1705 T4G p.Tyr569Asp D579G c.1736 A4G p.Asp579Gly D614G c.1841 A4G p.Asp614Gly S977F c.2930C4T p.Ser977Phe F1052V c.3154 T4G p.Phe1052Val G1069R c.3205G4A p.Gly1069Arg R1070Q c.3209G4A p.Arg1070Gln D1152H c.3454G4C p.Asp1152His I1234V c.3700 A4G p.Ile1234Val 5T c.1210 - 12[5] Examples of common not CF-causing variantsc R31C c.91C4T p.Arg31Cys R74W c.220C4T p.Arg74Trp R75Q c.224G4A p.Arg75Gln I148T c.443 T4C p.Ile148Thr M470V c.1408 A4G p.Met470Val G576A c.1727G4C p.Gly576Ala R668C c.2002C4T p.Arg668Cys V754M c.2260G4A p.Val754Met L997F c.2991G4C p.Leu997Phe I1027T c.3080 T4C p.Ile1027Thr R1070W c.3208C4T p.Arg1070Trp R1162L c.3485G4T p.Arg1162Leu Table 1 (Continued) HGVS nomenclature Legacy name cDNA nucleotide name Protein name S1235R c.3705 T4G p.Ser1235Arg D1270N c.3808G4A p.Asp1270Asn 7T c.1210-12[7] Abbreviation: HGVS, Human Genome Variation Society. Login to comment
103 [220C4T;c.3208C4T;3808G4A] I148T is a neutral variant, but can be associated in cis with a severe CF variant c.3067_3072del (legacy 3199del6 or 3195del6) that, in isolation causes CF, whereas I148T in isolation does not.19,20 G576A is found in cis with R668C and R668C can be found alone or in cis with G576A. Login to comment
212 BMC Med Genet 2004; 5: 19. 20 Monaghan KG, Highsmith WE, Amos J et al: Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study. Login to comment

PMID: 26087176 [PubMed] Dupuis A et al: "Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene."

No. Sentence Comment

63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment