ABCMdb

ABCC1 p.Gly511Pro

None has been submitted yet.

Publications

PMID: 16861249 [PubMed] Ren XQ et al: "A functional role of intracellular loops of human multidrug resistance protein 1."

No. Sentence Comment

44 The strategies employed for site-directed mutagenesis of E507L/G511P and E1157L/G1161P in MRP1 cDNA were previously described (10). Login to comment
45 The primers used to generate E507L/G511P mutations were forward and reverse primers: 50 CTCAATCCGATCAAAGTGCTAAAG30 and 50 AATTAAGTTCATCAGCTTGATCCG30 (The underlining indicates mismatched bases the encoding E507L and G511P mutations, respectively). Login to comment
99 Mutation of E507L/G511P in ICL5 of MRP1 almost completely inhibited the labeling of 8-azido-a-[32 P]ATP in NBD2 but not adjacent NBD1. Login to comment
110 ATP-dependent LTC4 transport by reconstituted E507L G511P/WT MRP1 or WT/E1157L G1161P MRP1 was considerably decreased and GSH-dependent photolabeling of azido AG-A of these MRP1 mutants was abrogated. Login to comment

PMID: 19015228 [PubMed] Conseil G et al: "Multiple roles of charged amino acids in cytoplasmic loop 7 for expression and function of the multidrug and organic anion transporter MRP1 (ABCC1)."

No. Sentence Comment

268 Ren et al. (2006) also created the analogous double mutant (E507L/G511P) in CL5, the cytoplasmic loop that connects TM10 to TM11, and is predicted to be in contact with NBD2 (DeGorter et al., 2008). Login to comment

PMID: 21177244 [PubMed] Iram SH et al: "Expression and function of human MRP1 (ABCC1) is dependent on amino acids in cytoplasmic loop 5 and its interface with nucleotide binding domain 2."

No. Sentence Comment

270 Relevant to our findings described here are the properties of a double MRP1 mutant containing a Leu substitution of Glu507 and a Pro substitution of Gly511 (E507L/ G511P) after expression in insect cells (reported by Ren et al. (49)). Login to comment