ABCC1 p.Glu1157Leu

[switch to full view]
Comments [show]
Publications
PMID: 16861249 [PubMed] Ren XQ et al: "A functional role of intracellular loops of human multidrug resistance protein 1."
No. Sentence Comment
44 The strategies employed for site-directed mutagenesis of E507L/G511P and E1157L/G1161P in MRP1 cDNA were previously described (10).
X
ABCC1 p.Glu1157Leu 16861249:44:73
status: NEW
Login to comment

46 We also used a pair of forward and reverse primers to generate E1157L/ G1161P mutations.
X
ABCC1 p.Glu1157Leu 16861249:46:63
status: NEW
Login to comment

47 The primers were: Forward: 50 TTGC- TGCCGGTCAGCGTCATTCGA30 , and reverse: 50 GGTC- AAGTTGAAATGGGAATA30 (The underlining indicates mismatched bases encoding the E1157L and G1161P mutations, respectively).
X
ABCC1 p.Glu1157Leu 16861249:47:160
status: NEW
Login to comment

110 ATP-dependent LTC4 transport by reconstituted E507L G511P/WT MRP1 or WT/E1157L G1161P MRP1 was considerably decreased and GSH-dependent photolabeling of azido AG-A of these MRP1 mutants was abrogated.
X
ABCC1 p.Glu1157Leu 16861249:110:72
status: NEW
Login to comment

PMID: 17494643 [PubMed] Letourneau IJ et al: "Mutational analysis of a highly conserved proline residue in MRP1, MRP2, and MRP3 reveals a partially conserved function."
No. Sentence Comment
221 Thus, the Glu1157Leu/ Gly1161Pro mutant displayed both decreased vanadate-induced 8N3ADP trapping as well as decreased 8N3ATP photolabeling at both NBDs (Ren et al., 2006).
X
ABCC1 p.Glu1157Leu 17494643:221:10
status: NEW
Login to comment

223 Unfortunately, the Glu1157Leu/Gly1161Pro mutant was not tested with other substrates, so it is not known whether the decreased transport activity of this mutant was substrate-selective.
X
ABCC1 p.Glu1157Leu 17494643:223:19
status: NEW
Login to comment

PMID: 19015228 [PubMed] Conseil G et al: "Multiple roles of charged amino acids in cytoplasmic loop 7 for expression and function of the multidrug and organic anion transporter MRP1 (ABCC1)."
No. Sentence Comment
264 Ren et al. (2006) have recently confirmed the importance of CL7 in MRP1 function by substituting the highly conserved Glu1157 and Gly1161 with Leu and Pro, respectively.
X
ABCC1 p.Glu1157Leu 19015228:264:118
status: NEW
Login to comment

265 They found that the double-mutant E1157L/G1161P no longer transported LTC4 and could not be labeled with the photoaffinity ligand azidoAgosterol A.
X
ABCC1 p.Glu1157Leu 19015228:265:34
status: NEW
Login to comment

267 Thus, for reasons that are presently unclear, the interactions of the double E1157L/G1161P mutant with nucleotide differ substantially from those of the CL7 mutants we have described here and elsewhere (Conseil et al., 2006).
X
ABCC1 p.Glu1157Leu 19015228:267:77
status: NEW
Login to comment

PMID: 21143116 [PubMed] He SM et al: "Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1)."
No. Sentence Comment
807 The double-mutant Glu1157Leu/Gly1161Pro showed no activity for LTC4 and was not labeled by the photoaffinity ligand azidoAgosterol A [365].
X
ABCC1 p.Glu1157Leu 21143116:807:20
status: NEW
Login to comment