ABCMdb

ABCC1 p.Thr73Ile

None has been submitted yet.

Publications

PMID: 15598215 [PubMed] Wang H et al: "Linkage disequilibrium and haplotype architecture for two ABC transporter genes (ABCC1 and ABCG2) in Chinese population: implications for pharmacogenomic association studies."

No. Sentence Comment

57 SNP Nucleotide sequence Minor allele dbSNP ID effect position (major/minor) frequency (%) ABCC1 1 5`FR/-1862 gacccG/Aggcca 44.4 2 5`FR/-1830 atcctA/Gtctac 1.9 3 5`FR/-1680 gaggaG/Aaaaag 1.9 4 5`FR/-471 cggatA/Gctgtc 7.4 5 E2/218 caaaaC/Tcaaaa 3.7 Thr73Ile 6 I2/-26 gttgtG/Aggggg 1.9 rs8187842 7 I3/-66 ctgggT/Cgacaa 37.0 rs4148337 8 I7/+54 ccactC/Actgtg 9.3 rs903880 9 I7/+64 ggcctC/Gaatcc 48.1 rs246232 10 E8/816 cagccG/Agtgaa 1.9 wobble 11 E8/825 aaggtT/Cgtgta 38.9 rs246221 wobble 12 E9/1062 gtgaaT/Cgacac 35.2 rs35587 wobble 13 I9/+8 aggggA/Gcgctg 37.0 rs35588 14 I12/-37 cactcA/Ggggca 20.4 rs35604 15 E13/1684 tggccT/Ctgtgc 20.4 rs35605 wobble 16 I13/+105 ccggtC/Tgggct 20.4 rs35606 17 I14/+105 ccagcC/Tgcttg 1.9 18 I15/+627 gctgtA/Gtttta 25.8 rs35628 19 I15/+669 aatctG/Ttagaa 7.4* rs4148353 20 I15/-967 ctttcT/Ggctgt 37.0 rs152029 21 E16/2007 atcccC/Tgaagg 3.7 rs2301666 wobble 22 E17/2168 tctccG/Aagaaa 5.6 rs4148356 Arg723Gln 23 I18/-30 gcactG/Cacgtg 16.7 rs2074087 24 I22/+62 aattaT/Ctccct 27.8 rs3887893 25 I22/-43 gtcagC/Ttccct 3.7 26 E27/3915 gaggaC/Tctgga 1.9 wobble 27 E28/4002 aagtcG/Atccct 11.1 rs2239330 wobble 28 I28/-35 tcagcA/Gtgaca 27.8 rs212087 29 I30/+30 gcacaG/Atggcc 29.6 rs212088 30 3`UTR/+801 accccC/Gactcc 33.3 rs129081 noncoding 31 3`UTR/+866 tactgT/Atccca 14.8 rs212090 noncoding 32 3`FR/+1513 gttctT/Ctaagg 27.8 ABCG2 1 5`UTR/-407 cgcagC/Tgcctc 1.9 2 5`UTR/-376 ggggaG/Acgctc 1.9 3 E2/34 tcccaG/Atgtca 20.4 rs2231137 Val12Met 4 I2/+36 ttttaA/Gtttac 25.9 rs4148152 5 I3/+10 gtataA/Ggagag 20.4 rs2231138 6 E5/421 acttaC/Agttct 22.2 rs2231142 Gln141Lys 7 E7/805 acgggC/Tctgct 3.7 Pro269Ser 8 I9/-126 agccaT/Gtgagt 7.4 9 I11/+20 gttctA/Gggaac 31.5 rs2231153 10 I12/+49 cctatG/Tggtga 16.7 rs2231156 11 I13/+40 tgtttT/Ctttcc 24.1 rs2231157 12 I13/-21 tgactC/Tttagt 29.6 rs2231162 13 I14/-46 ttcttG/Aaaatt 48.1 rs2725267 SNPs in specific regions, i.e. 5`flanking region (5`FR), 5`untranslated region (5`UTR), intron (I), exon (E), 3`UTR, and 3`FR, are presented as region/+(-): for 5`FR and 5`UTR, n nucleotides upstream (-) from the translation initiation site; for 3`UTR and 3`FR, n nt downstream (+) from the third base of stop codon; for coding regions, n corresponds to positions of their cDNA with the first base of start codon set to 1; and for introns, n nt upstream (-) from 3` site or downstream (+) from 5` site of introns. Login to comment

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

830 A thorough investigation on the functional significance of 10 non-synonymous SNP, leading to amino acid changes C43S, T73I, S92F, T117; R230Q, R633Q, R723Q, A989T, C1047S. Login to comment
852 Table 5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to Le Saux et al., 2000; Ito et al., 2001; Moriya et al., 2002; Conrad et al., 2002; Oselin et al., 2003b; Wang et al., 2004) Position/ Nucleotide Aminoacid or effect Orientals Caucasians Function 128G>C C43S 0.01 - elevateda 218C>T T73I 0.00-0.04 - 257C>T S92F 0.00 0.00 decreaseda 350C>T T117M - 0.02 (decreased)a 689G>A R230N 0.00 0.00 (decreased)a 816G>A synonymous - 0.04 825T>C synonymous - 0.30 1057G>A V353M 0.00 0.005 elevateda 1299G>T R433S - 0.01 elevated Vmax of doxorubicin, decreased transport of LTC4 a,b 1684T>C synonymous - 0.80 1898G>A R633Q - 0.01 (decreased)a 2012G>T G671V - 0.03 doxorubicine-induced cardiomyopathyc 2168G>A R723Q 0.01-0.07 - decreaseda 2965G>A A989T 0.00 0.005 (decreased)a 3140G>C C1047S 0.00 0.00 3173G>A R1058Q 0.01 - 4002G>A synonymous - 0.28 4535C>T S1512L - 0.03 decreaseda a Letourneau et al. (2005). Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

71 Letourneau et al. (2005) studied the influence of 10 non-synonymous variations (Thr73Ile, Ser92Phe, Thr117Met, Arg230Gln, Arg633Gln, Arg723Gln, Ala989Thr, Cys1047Ser, Arg1056Gln, and Ser1512Leu) on MRP1 expression using membrane vesicles isolated from transfected cells and assesed transport activity for 3 known MRP1 substrates (LTC4, estradiol-17-β-glucuronide, and methotrexate). Login to comment
81 MRP1 (ABCC1) NH2 NBD NBD in out Membrane Cys43Ser Ser92Phe Thr117Met Arg230Gln Val353Met Arg633Gln Gly671Val Arg723Gln Arg433Ser Ala989Thr Cys1047Ser Val1146Ile Arg1058Gln Thr1401Met Ser1512Leu Thr73Ile COOH NBD NBD COOH NBD COOH NBD NBD Table1MRP1(ABCC1)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 128G>CCys43SerExon2--1[1]-Decreaseinvincristineresistance[2]rs41395947 Disruptedplasmamembranetraffickingin transfectedcells[2] 218C>TThr73IleExon2--1[1]3.7Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] rs41494447 257C>TSer92PheExon30a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 350C>TThr117MetExon3-100[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] 689G>AArg230GlnExon70a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 1057G>AVal353MetExon90a 0.5a 0a -- 1299G>TArg433SerExon10-1.4[6]--Changesintransportandresistance[7] 1898G>AArg633GlnExon13-[8]--Noinfluenceonexpressionandtransportin membranevesicles[4] 2012G>TGly671ValExon16-2.8[6]--Noinfluenceonexpressionandtransportin membranevesicles[6] Associatedwithanthracycline-induced cardiotoxicity[9] 2168G>AArg723GlnExon17--7.3[1]5.6Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4]noinfluenceonmRNA expressioninenterocytes(n=1)[10] rs4148356 2965G>AAla989ThrExon220a 0.5a 0a -Noinfluenceonexpressionandtransportin membranevesicles(non-significantreduction inE17βGtransport)[4] 323 3140G>CCys1047SerExon234.5a 0a 0a -Noinfluenceonexpressionandtransportin membranevesicles[4] rs13337489 3173G>AArg1058GlnExon23--1[1]-Noinfluenceonexpressionandtransportin membranevesicles[4] rs41410450 3436G>AVal1146IleExon24-----rs28706727 4102C>TThr1401MetExon29-----rs8057331 4535C>TSer1512LeuExon31-[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

134 A thorough investigation on the functional significance of ten nonsynonymous SNPs, leading to amino acid changes C43S, T73I, S92F, T117; R230Q, R633Q, R723Q, A989T, C1047S. Login to comment
155 ABCC2 (Multidrug Resistance-Associated Protein 2) Table 6.5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to (33, 77-80, 136)) Position Amino acid or effect Orientals Caucasians Function c.128G>C C43S 0.01 - Elevateda c. 218C>T T73I 0.00-0.04 - c. 257C>T S92F 0.00 0.00 Decreaseda c. 350C>T T117M - 0.02 (Decreased)a c. 689G>A R230N 0.00 0.00 (Decreased)a c. 816G>A Synonymous - 0.04 c. 825T>C Synonymous - 0.30 c. 1057G>A V353M 0.00 0.005 Elevateda c. 1299G>T R433S - 0.01 Elevated vmax of doxorubicin, decreased transport of LTC4 a,b c. 1684T>C Synonymous - 0.80 c. 1898G>A R633Q - 0.01 (Decreased)a c. 2012G>T G671V - 0.03 Doxorubicine-induced cardiomyopathyc c. 2168G>A R723Q 0.01-0.07 - Decreaseda c. 2965G>A A989T 0.00 0.005 (Decreased)a c. 3140G>C C1047S 0.00 0.00 c. 3173G>A R1058Q 0.01 - c. 4002G>A Synonymous - 0.28 c. 4535C>T S1512L - 0.03 Decreaseda References: a [81], b [77], c [84] an inducible expression of ABCC2, which contributes also to the phenomenon of drug resistance. Login to comment

PMID: 19950006 [PubMed] Sissung TM et al: "Pharmacogenetics of membrane transporters: an update on current approaches."

No. Sentence Comment

67 Those studied include C43S, T73I, S92F, T117M, R230Q, V353M, R433S, R633Q, G671V, R723Q, A989T, C1047S, R1058Q, A1337T, and S1512L. Login to comment

PMID: 11266082 [PubMed] Ito S et al: "Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects."

No. Sentence Comment

32 Four of the 16 mutations were associated with an amino acid substitution; G to C transversion at position 128 (G128C, Cys to Ser at codon 43) in exon 2, C to T at 218 (C218T, Thr to Ile at 73) in exon 2, G to A at 2168 (G2168A, Arg to Gln at 723) in exon 17 and G to A at 3173 (G3173A, Arg to Gln at 1058) in exon 23 (position numbering from Grant et al., 1997) (Fig. 2). Login to comment
63 In the MRP1 gene, we identi®ed four missense mutations, G128C (Cys43Ser), C218T (Thr73Ile), G2168A (Arg723Gln) and G3173A (Arg1058Gln). Login to comment
67 Frequencies of mutations in the MRP1 gene in a Japanese population (n 48) Primer pair Location Nucleic acid Nucleotide sequence Amino acid Genotype Allele frequency substitutiona substitution Wild-type Mutation w/w w/m m/m w m MR12/1 Exon 2 G128C gccttGttttt gccttCttttt Cys43Ser 47 1 0 0.990 0.010 MR12/1 Exon 2 C218T caaaaCcaaaa caaaaTcaaaa Thr73Ile 47 1 0 0.990 0.010 MR18/1 Exon 8 T825C aaggtTgtgta aaggtCgtgta Val275Val 18 24 6 0.625 0.375 MR19/1 Exon 9 T1062C gtgaaTgacac gtgaaCgacac Asn354Asn 17 28 3 0.646 0.354 MR113/1 Exon 13 T1684C tggccTtgtgc tggccCtgtgc Leu562Leu 31 15 2 0.802 0.198 MR116/1 Exon 16 C2007T atcccCgaagg atcccTgaagg Pro669Pro 40 8 0 0.917 0.083 MR117/1 Exon 17 G2168A tctccGagaaa tctccAagaaa Arg723Gln 41 7 0 0.927 0.073 MR120/1 Exon 20 C2665T gcggtCcaggg gcggtTcaggg Pro889Pro 47 1 0 0.990 0.010 MR120/1 Exon 20 T2694C gagaaTggcat gagaaCggcat Asn898Asn 47 1 0 0.990 0.010 MR123/1 Exon 23 G3173A cctgcGgtcac cctgcAgtcac Arg1058Gln 47 1 0 0.990 0.010 MR128/1 Exon 28 G4002A aagtcGtccct aagtcAtccct Ser1334Ser 36 9 3 0.844 0.156 MR131/1 Exon 31 C4524T gagtaCggcgc gagtaTggcgc Tyr1508Tyr 47 1 0 0.990 0.010 MR19/1 Intron 9 A12188G aggggAcgctg aggggGcgctg ± 17 28 3 0.646 0.354 MR112/1 Intron 11 C1474À48T atgggCtgatc atgggTtgatc ± 44 3 1 0.948 0.052 MR119/1 Intron 18 C2461À30G gcactCacgtg gcactGacgtg ± 27 14 7 0.708 0.292 MR119/1 Intron 18 T2461À38C acacaTgtgca acacaCgtgca ± 41 7 0 0.927 0.073 The positions of the identi®ed polymorphisms correspond to positions of the MRP1 gene (Grant et al., 1997; EMBL/GenBank accession no. Login to comment

PMID: 16006996 [PubMed] Conseil G et al: "Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters."

No. Sentence Comment

148 Fig. 3 Exon 1 2 3 MSDMSD NBD1 MSD NBD2 C4535T(S1512L) G3173A (R1058Q) G3140C (C1047S) G2965A (A989T) G2168A (R723Q) G2012T(G671V) G1898A (R633Q) G1299T(R433S) G1057A (V353M) G689A (R230Q) C350T(T117M) C257T(S92F) C218T(T73I) C128C (C43S) (TM1-5) (TM6-11) (TM12-17) 4 5 6 7 8 9101112 1314 151617 1819 20 21 22 23 242526272829 30 31 Location of non-synonymous SNPs in the coding regions of the genes in the MRP1/ABCC1 gene. Login to comment

PMID: 16041243 [PubMed] Letourneau IJ et al: "Functional characterization of non-synonymous single nucleotide polymorphisms in the gene encoding human multidrug resistance protein 1 (MRP1/ABCC1)."

No. Sentence Comment

3 Variants 218C > T (Thr73Ile), 257C > T (Ser92Phe), 350C > T (Thr117Met), 689G > A (Arg230Gln), 1898G > A (Arg633Gln), 2168G > A (Arg723Gln), 2965G > A (Ala989Thr), 3140G > C (Cys1047Ser), 3173G > A (Arg1058Gln) and 4535C > T (Ser1512Leu) were recreated using site-directed mutagenesis and transfected into human embryonic kidney cells. Login to comment
28 Of these mutations, the Fig. 1 128G >C (C43S) 128G >T(T73I) 689G >A (R230Q)1057G >A (V353M) 1299G >T(R433S) 1898G >A (R633Q) 2012G >T(G671V) 2168G >A (R723Q) 3173G >A (R1058Q) 4535C >T(S1512L) 3140G >C (C1047S) 2965G >A (A989T) 350C >T(T117M) 257C >T(S92F) 313029282726252423222120181716151413121110987654321 19 MSD1 MSD1 MSD2 MSD3 MSD2 NBD1 MSD3 NBD2 TM 1 2 3 4 5 6 7 8 Val353Met Ala989Thr Cys1047Ser Arg1058Gln NBD2NBD1 Ser1512Leu Arg633Gln Arg433Ser Arg723Gln Thr73lle Thr117Met Arg230Gln Cys43Ser Ser92Phe Gly671Val 9 10 11 12 13 14 15 16 17 (a) (b) Location of reported non-synonymous single nucleotide polymorphisms (SNPs) in MRP1/ABCC1. Login to comment
45 The template for creating the Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln mutants was prepared by subcloning a 865-bp XbaI/BamHI fragment encoding amino acids 1-840 of MRP1 from pcDNA3.1(-)MRP1k into pGEM-3z (Promega, Madison, Wisconsin, USA) [18,21]. Login to comment
46 The template for generating Table 1 Frequencies of non-synonymous single nucleotide polymorphisms in MRP1/ABCC1 Variant Amino acid substitution Allelic frequency Population References 128G > C Cys43Ser 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 218C > T Thr73Ile 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 3.7% (2/54) Chinese [37] 257C > T Ser92Phe 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 350C > T Thr117Met 1.6% (1/64) Caucasian [28] 689G > A Arg230Gln 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1057G > A Val353Met 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1299G > T Arg433Ser 1.4% (1/72) Caucasian [20] 0% (0/110) Caucasian [19] 1898G > A Arg633Gln 0.8% (2/234) Caucasian [29] 2012G > T Gly671Val 2.8% (2/72) Caucasian [20] 2.6% (6/234) Caucasian [29] 2168G > A Arg723Gln 3.8% (1/26) Japanese [16] 1% (1/96) Japanese [30] 7.3% (7/96) Japanese [17] 5.6% (3/54) Chinese [37] 2965G > A Ala989Thr 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3140G > C Cys1047Ser 0% (0/220) Caucasian www.pharmGKB.org 4.5% (9/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3173G > A Arg1058Gln 0% (0./26) Japanese [16] 1% (1/96) Japanese [17] 4535C > T Ser1512Leu 3.1% (2/24) Caucasian [28] Characterization of MRP1/ABCC1 variants in vitro Le´tourneau et al. 649 the Arg633Gln and Arg723Gln mutants was created by subcloning a HindIII fragment (1329 bp) encoding amino acids 517-959 into pGEM-3z [20]. Login to comment
50 Mutagenesis was performed according to the manufacturer`s instructions with the following sense primers (substituted nucleotides for amino acid mutation are underlined, introduced or disrupted restriction sites are italicized and other silent substitutions are in lower case letters) as follows: Thr73Ile (50 -G ATG ACA CCT CTC AAC AAA ATC AAAACTGCCTTGGG-30 ); Ser92Phe (50 -GG GCA GAC CTG TTC TAC TTT TTC TGG GAA AG-30 ) (EarI); Thr117Met (50 -CTC TTG GGC ATC ACC ATG CTG CTT GCT ACC-30 ); Arg230Gln (50 -GG TTG ATT GTA CAG GGC TAC CGC C-30 ) (BsrGI); Arg633Gln (50 -GAC AGC ATC GAG CGA CAG CCT GTG AAA GAC GGC GG-30 ) (Eam1105I); Arg723Gln (50 -CAG AAT GAC TCT CTC CAA GAA AAt ATC CTT TTT GGA TGT CAG C-30 ) (PleI); Ala989Thr (50 -C ATG TGT AAC CAC GTG TCC ACG CTG GCT TCC-30 ) (PmlI); Cys1047Ser (50 - GCT TCC CGC TCT CTG CAT GTG GAC CTG C-30 ) (PmlI); Arg1058Gln (50 -CTG CTG CAC AGC ATC CTC CAG TCA CCC ATG AGC-30 ) (BstEII); and Ser1512Leu (50 -CAG GAG TAC GGA GCC CCA TTG GAC CTt CTG CAG CAG-30 ) (NarI). Login to comment
51 Following mutagenesis, the desired fragment was subcloned back into pcDNA3.1(-) MRP1k as a XbaI/BamHI fragment (865 bp) for the Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln mutants; a Bsu36I/Esp3I fragment (721 bp) for the Arg633Gln and Arg723Gln mutants; a Esp3I/EcoRI fragment (1313 bp) for the Ala989Thr, Cys1047Ser, Arg1058Gln mutants; and a EcoRI/KpnI fragment (778 bp) for the Ser1512Leu mutant. Login to comment
83 Expression levels of MRP1 mutants To investigate the effect of the amino acid substitutions resulting from the non-synonymous SNPs on MRP1 protein expression and function, MRP1 expression vectors containing the mutations responsible for the substitutions (Thr73Ile, Ser92Phe, Thr117Met, Arg230Gln, Arg633Gln, Arg723Gln, Thr989Ala, Cys1047Ser, Arg1058Gln, Ser1512Leu) were generated by site-directed mutagenesis and transfected into HEK293T cells. Login to comment
87 The mutants were considered in four groups based on their location in the transporter: (a) MSD1/CL3 mutants Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln; (b) NBD1 mutants Arg633Gln and Arg723Gln; (c) MSD3 mutants Ala989Thr, Cys1047Ser and Arg1058Gln; and (d) COOH-terminus mutant Ser1512Leu. Login to comment
158 This observation may be construed as being Table 2 Conservation of the amino acids substituted by non-synonymous SNP of human MRP1/ABCC1a Protein Speciesb C43S T73I S92F T117Mc R230Q V353M R433S R633Qc G671V R723Q A989T C1047S R1058Q S1512L MRP1 Human C T S T R V R R G R A C R S Monkey C T S M R V R R G Q A C R S Dog C T S M R V R R G R A R R S Cow C A S M Q V R R G R A R R S Rat C A S M Q V R W G R A R R S Mouse C T S M H V R R G R A R R S MRP2 Human L A V T K A K R G K A I R E Monkey L A V T K A K R G K A I R E Dog L A V T K A K R G K A I Q Q Rat L A A T K V K R G K A A R E Mouse L A A T K V K V G K A T R E Rabbit L A V T K V K R G K A I R E MRP3 Human C L S M Y I R K G Q A V R A Rat C L S M L L R K G Q A L R V MRP4 Human - - - - I F K R G R Y T K Y MRP5 Human - - - - V T R S G R T R R S MRP6 Human P A A M R I R S G V A L R A CFTR Human - - - - R Y K A G K L I Q Q SUR1 Human V L L A T V Q R G E L R L E SUR2 Human V L H T Q V Q R G E I N L P Pgp Human - - - - - E K S G A G R R Q YCF1 Saccharomyces cervisiae A I L V T V K L G K S Y R G Mrp1 Caenorhabditis elegans T L D F L I R T G R G L R K Mrp2 Caenorhabditis elegans T F D I L I K T G R G I R K AtMRP2 Arabidopsis thaliana Q L R W L M S P G R R K R E AtMRP1 Arabidopsis thaliana H T A V L M S P G R R K R E a Aligned using Clustal W (http://pbil.univ-lyon1.fr/). Login to comment

PMID: 16684361 [PubMed] Wang Z et al: "Nucleotide sequence analyses of the MRP1 gene in four populations suggest negative selection on its coding region."

No. Sentence Comment

120 B A C SNPe1* SNPe2 SNPe3 SNPe4 SNPe5 SNPe6* SNPe7 SNPe8 SNPe9* SNPe10 SNPe11 SNPe12* SNPe13* SNPe14 SNPe15 SNPe16* SNPe17 SNPe18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 mRNA of ABCC1 CH ML IN CAU SNPe1* E2/218 C>T T73I 0.65 benign - 1.39 2.86 0 0 SNPe2 E6/651 G>A - - - 0 0 2.86 0 SNPe3 E8/816 G>A - - - 2.78 0 0 0 Oselin et al. Login to comment

PMID: 17329911 [PubMed] Fukushima-Uesaka H et al: "Genetic variations and haplotype structures of the ABC transporter gene ABCC1 in a Japanese population."

No. Sentence Comment

69 We also detected three known nonsynonymous variations, 218CÀT (Thr73Ile), 2168GÀA (Arg723Gln), and 3173GÀA (Arg1058Gln) at frequencies of 0.007, 0.065 and 0.003, respectively. These frequencies were similar to those found in the earlier reports for Japanese11) and Chinese.21) One of the variations, Arg723Gln, leads to reduced transport activities for LTC4, estradiol 17b-glucuronide and methotrexate.12) We did not detect three previously reported variations: 2012GÀT (Gly671Val; found with approximately 0.03 frequency in Caucasians), 3140GÀC (Cys1047Ser; 0.05 in African-Americans), and 4535CÀT (Ser1512Leu; 0.03 in Caucasians).8,9,12) These SNPs might be ethnic- specic. Login to comment
109 In Block 1 (Table 3), 4 haplotype groups (*1 to *4) were inferred, and the *2 to *4 groups were represented by the nonsynonymous variations, 218CÀT (Thr73Ile) (*2), 726GÀT (Trp242Cys) (*3), and 1199TÀC (Ile400Thr) (*4). Login to comment
113 In addition to these 8 htSNPs, 3 nonsynonymous variations, 218CÀT (Thr73Ile), 726GÀT (Trp242Cys), and 1199TÀC (Ile400Thr) may be included in the htSNPs in order to detect *2 to *4 haplotypes because they might have the functional signicance. Login to comment

PMID: 18220559 [PubMed] Yu XQ et al: "Multidrug resistance associated proteins as determining factors of pharmacokinetics and pharmacodynamics of drugs."

No. Sentence Comment

405 Important Single Nucleotide Polymorphisms (SNPs) of MRP Genes MRP Chromosomal location Amino acid variation Nucleotide variation Location References Cys43Ser Thr73Ile G128C C218T Exon2 Exon2 [239] Arg433Ser G1299T Exon10 [258] Gly671Val G2012T Exon16 [259] Arg723Gln G2168A Exon17 [239] MRP1 16p13.11-p13.12 Arg1058Gln G3173A Exon23 [239] C-24T Promoter [100, 239] Val417Ile G1249A Exon10 [100, 238, 239] Gly676Arg G2026C Exon16 [237] Try709Arg T2125C Exon17 [236] Arg768Trp Ser789Phe C2302T C2366T Exon18 Exon18 [100, 238, 239] I1173F R1150H A3517T G3449A Exon25 Exon25 [240] Ile1324Ile C3972T Exon28 [100, 239] MRP2 10q23-24 Ala1450Thr G4348A Exon31 [100, 238, 239] (Table 2) contd…. Login to comment

PMID: 19214144 [PubMed] Yin JY et al: "Characterization and analyses of multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphisms in Chinese population."

No. Sentence Comment

5 Results The allelic frequencies of Cys43Ser (128G > C), Thr73Ile (218C > T), Arg723Gln (2168G > A), and Arg1058Gln (3173G > A) in mainland Chinese were 0.5, 1.4, 5.8, and 0.5%, respectively. Login to comment
8 In contrast, the Thr73Ile mutation reduced resistance to methotrexate and etoposide, whereas the Arg1058Gln mutation increased the response of two anthracycline drugs and etoposide in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells. Login to comment
23 The four most common nonsynonymous SNPs in the Asian population are Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations [15,17]. Login to comment
24 While Cys43Ser (128G > C) is located in the first transmembrane (TM), Thr73Ile (218C > T), Arg723Gln (2168G > A) and Arg1058Gln (3173G > A) are located in the first intracellular loop, the first NBD, and the seventh intracellular loop, respectively (Fig. 1a). Login to comment
35 Fig. 1 COOH L0 NBD1 NBD2 NH2 KCFQNTVLVWVPCFYLWACFPFYF TM1(a) CL1 Thr73Ile …AWIQNDSLRENILFGC… NBD1 Arg723Gln * * * * …DLLHSILRSPMSFF… CL7 Arg1058Gln PFYFLYLSRHDRGYIQMTPLNKTK Cys43Ser Cys43Ser Thr73Ile Arg723Gln Arg1058Gln 1 Human Monkey Bovine Dog Mouse Rat Chicken 2 3 4 5 6 7 (b) Location and conservation of the amino acid residues with polymorphisms in multidrug-resistance-associated protein 1 (MRP1/ABCC1). Login to comment
51 Site-directed mutagenesis For site mutagenesis, cassettes containing various domains of MRP1/ABCC1 cDNA were first released from the full-length cDNA by double digestion (Not I/BamH I for Cys43Ser and Thr73Ile mutation; EcoN I/BsmB I for Arg723Gln mutation; and BsmB I/EcoR I for Arg1058Gln mutation), cloned into pGEM-T Easy (Promega), followed by site-directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, USA) with the following primers (the substituted nucleotides are italicized): 50 -TCGTGTGGGTGCCTTGTTTTTACCTCTGGGC-30 (Cys43Ser); 50 -GATGACACCTCTCAACAAAACCAAA ACTGCCTTGGGATTTT-30 (Thr73lle); 50 -GGATTC AGAATGATTCTCTCCAAGAAAACATCCTTTTTGGA TG-30 (Arg723Gln); 50 -GCACAGCATCCTGCGGTCAC CCATGAGCT-30 (Arg1058Gln). Login to comment
62 The real-time PCR was carried Table 1 Primers and PCR condition for determining polymorphisms Polymorphisms Oligonucleotide primers Annealing temperature (1C) Restriction enzyme Cys43Ser (128G > C) F: GGTCCTCGTGTGGGTGCCAT 57.5 Nla III R: TAGAAGAAGGAACTTAGGGTCAACT Thr73Ile (218C > T) F: TCAGATGACACCTCTCAACAGAA 56.7 Hinf I R: CCAGTTTTCACCTCCCACATTAT Arg723Gln (2168G > A) F: GCCTGGATTCAGAATGATTCTCTTC 52.0 Taq I R: TACTGACCTTCTCGCCAATCTCTGT Arg1058Gln (3173G > A) F: TCTGCATTGTGGAGTTTT 53.0 Pst I R: GACGAAGAAGTAGATGAGGC F, forward; R, reverse. Login to comment
96 Genotyping for the Thr73Ile mutation identified 202 CC homozygotes and six CT heterozygotes. Login to comment
97 The frequencies of T and C alleles of the SNP for the Thr73Ile mutation were 1.4 and 98.6%, respectively. Login to comment
101 The genotyping and allelic frequencies of SNPs for Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations are shown in Table 2. Login to comment
102 The distribution of these SNPs in different populations and their comparison are summarized in Table 3. mRNA and protein expression levels of MRP1/ABCC1 mutants To determine whether these SNPs affect MRP1/ABCC1 expression, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations were recreated in MRP1/ABCC1 cDNA by site-directed mutagenesis and transiently transfected into HEK293 and CHO-K1 cells. Login to comment
107 Subcellular localization of wild-type and mutant MRP1/ABCC1 To further determine whether Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations influence the trafficking of MRP1/ABCC1 to the cell surface, we detected the subcellular localization of wild-type and mutant MRP1/ABCC1 in transiently transfected HEK293 and CHO-K1 cells through the process of immunostaining. Login to comment
108 As shown in Fig. 3, strong plasma membrane staining was observed with all cells that are transfected with either wild-type or mutant MRP1/ABCC1, but not in the Table 3 Comparison of distributive frequencies of MRP1/ABCC1 Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln polymorphisms in different ethnic populations Allelic frequency (n) SNPs (nucleic acid substitution) m w Population References NCBI SNP ID Cys43Ser (128G > C) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41395947 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study Thr73Ile (218C > T) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41494447 0 (0/26) 1 (26/26) Japanese [14] 0.037 (2/54) 0.963 (52/54) Chinese [17] 0.014 (1/72) 0.986 (71/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0(0/72) 1 (72/72) Caucasian [15] 0.014 (6/416) 0.986 (410/416) Chinese This study Arg723Gln (2168G > A) 0.073 (7/96) 0.927 (89/96) Japanese [16] rs4148356 0.038 (1/26) 0.962 (25/26) Japanese [14] 0.056(3/54) 0.944 (51/54) Chinese [17] 0 (0/72) 1 (72/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0 (0/72) 1 (72/72) Caucasian [15] 0.058 (24/416) 0.942 (392/416) Chinese* This study Arg1058Gln (3173G > A) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41410450 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study m, mutant; MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism; w, wild-type. Login to comment
112 HEK293 and CHO-K1 cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 followed by preparation of RNAs for quantitative real-time reverse-transcribed PCR analysis of MRP1/ABCC1 R. level (relative level) (a), or preparation of cell lysates for western blot analysis of MRP1/ABCC1 protein level (b). Login to comment
117 HEK293 (a) and CHO-K1 (b) cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1, followed by fixation and immunostaining of MRP1/ABCC1 using MRPr1 antibody and fluorescein isothiocyanate-conjugated secondary antibody. Login to comment
126 HEK293 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment
136 CHO-K1 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment
140 In HEK293 cells, the Thr73Ile mutation was also found to cause less resistance to vincristine and methotrexate (Tables 4 and 5 and Fig. 4). Login to comment
142 Discussion In this study, we identified the allelic frequencies of Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln in a mainland Chinese population. Login to comment
148 In the 208 Chinese volunteers enrolled in this study, few had Cys43Ser, Thr73Ile, and Arg1058Gln polymorphisms. Login to comment
154 However, the frequencies of the Arg723Gln A allele and the Thr73Ile Tallele in the Chinese population were higher than the Caucasians (P < 0.05) of whom these alleles have not been found. Login to comment
177 The selective effect on drug resistance also exists for the Thr73Ile mutation in the first cytoplasmic loop. Login to comment
181 For example, the Thr73Ile mutation decreased vinblastine resistance in CHO-K1 cells, but not in HEK293 cells. Login to comment
184 It is possible that HEK293 cells are able to suppress the Thr73Ile mutation-induced changes in both MRP1/ ABCC1 structure and activity. Login to comment

PMID: 21143116 [PubMed] He SM et al: "Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1)."

No. Sentence Comment

816 There are at least 15 naturally occurring mutations identified in MRP1/ABCC1, including Cys43Ser in TM1, Thr73Ile in CL1, Ser92Phe in TM2, Arg230Asn in L0, Val353Met at TM6/TM7 interface, Arg433Ser in TM8, Gly671Val in TM11, Arg723Gln located between the Walker A and Walker B motifs of NBD1, Ala861Thr at NBD1/TM12 interface, Ala989Thr in TM12, Cys1047Ser in TM13, Arg1058Gln in CL7, Val1146Ile in CL7, Thr1337Ala between the Walker A and Walker B motifs of NBD2, and Thr1401Met, and many of them have been found to affect its transport activity [171, 362, 363, 366, 367, 377-384]. Login to comment
820 When Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln were separately transfected in CHO-K1 or HEK293 cells, the cells displayed altered resistance profiles to a panel of anticancer drugs compared to the wild-type [366]. Login to comment
825 In HEK293 cells, the Thr73Ile mutation displayed a lower resistance to vincristine and MTX [366]. Login to comment
828 For example, the frequencies of the Arg723Gln A allele and the Thr73Ile T allele in Chinese population were higher than the Caucasians [366]. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

PMID: 22565165 [PubMed] Grover S et al: "Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs."

No. Sentence Comment

87 - 330-21247T > C Intron 1 0.005 6 rs4148731 chr7:87239329 c.-330 - 8935C > T Intron 1 0.000 7 rs9282564 chr7:87229440 c.61A > G Exon 3 (Asn21Asp) 0.000 8 rs9282565 chr7:87214875 c.239C > A Exon 5 (Ala80Glu) 0.000 9 rs28381826 chr7:87214531 c.286 + 297G > A Intron 5 0.000 10 rs1989830 chr7:87205663 c.287 - 6124C > T Intron 5 0.135 11 rs2520464 chr7:87201086 c.287 - 1547A > G Intron 5 0.409 12 rs2235023 chr7:87190452 c.827+ 127G > A Intron 9 0.000 13 rs10276036 chr7:87180198 c.1000 - 44C > T Intron 10 0.401 14 rs2229109 chr7:87179809 c.1199G > A Exon 12 (Ser400Asn) 0.000 15 rs1128503 chr7:87179601 c.1236T > C Exon 13 (Gly412Gly) 0.390 16 rs2235036 chr7:87175271 c.1795G > A Exon 16 (Ala599Thr) 0.000 17 rs2235039 chr7:87165854 c.2401G > A Exon 21 (Val801Met) 0.000 18 rs2235040 chr7:87165750 c.2481 + 24G > A Intron 21 0.155 19 rs2032581 chr7:87160810 c.2485A > G Exon 22 (Ile829Val) 0.000 20 rs2032582 chr7:87160618 c.2677T/A > G Exon 22 (Ser/Thr893Ala) 0.318 21 rs7779562 chr7:87144816 c.3085 -72G > C Intron 25 0.043 22 rs2707944 chr7:87144641 c.3188C > G Exon 26 (Ala1063Gly) 0.000 23 rs2229107 chr7:87138659 c.3421A > T Exon 27 (Thr1141Ser) 0.000 24 rs1045642 chr7:87138645 c.3435T > C Exon 27 (Ile1145Ile) m Expression and activity [28] m mRNA expression [29] Altered substrate specificity [30] 0.375 25 rs2235048 chr7:87138511 c.3489 + 80C > T Intron 27 0.381 26 rs17064 chr7:87133470 c.3932A > T 30 UTR 0.000 ABCC1 1 rs504348 chr16:16043174 rs50438C > G Near gene region k Promoter activity [31] 0.135 2 rs215106 chr16:16047542 c.48 + 3886A > G Intron 1 0.210 3 rs215049 chr16:16070768 c.48 + 27112G > C Intron 1 0.245 4 rs246220 chr16:16082128 c.49 - 19545C > G Intron 1 0.118 5 rs119774 chr16:16086833 c.49 - 14840G > A Intron 1 0.089 6 rs246217 chr16:16090354 c.49 - 11319C > A Intron 1 0.118 7 rs2014800 chr16:16099966 c.49 - 1707C > T Intron 1 0.398 8 rs41494447 chr16:16101842 c.218C > T Exon 2 (Thr73Ile) 0.000 9 rs4781712 chr16:16103232 c.226 - 401A > G Intron 2 0.355 10 rs246240 chr16:16119024 c.616 -7942A > G Intron 5 0.114 11 rs924135 chr16:16123459 c.616 - 3507A > T Intron 5 0.412 12 rs903880 chr16:16130514 c.809 + 54C > A Intron 7 0.147 13 rs8187852 chr16:16139709 c.1057G > A Exon 9 (Met353Val) 0.000 14 rs35587 chr16:16139714 c.1062T > C Exon 9 (Asn354Asn) 0.182 15 rs35592 chr16:16141823 c.1219 - 176T > C Intron 9 0.172 16 rs60782127 chr16:16142079 c.1299G > T Exon 10 (Arg433Ser) k Transport of leukotriene C4 and estrone sulfate [32] 0.008 17 rs3765129 chr16:16149901 c.1474 - 48C > T Intron 11 0.032 18 rs35597 chr16:16158034 c.1678 - 3979G > A Intron 12 0.320 19 rs35621 chr16:16168608 c.1913 - 1575C > T Intron 14 0.103 20 rs45511401 chr16:16173232 c.2012G > T Exon 16 (Gly671Val) 0.024 21 rs4148356 chr16:16177275 c.2168G > A Exon 17 (Arg723Gln) 0.000 22 rs3851713 chr16:16184873 c.2644 + 428A > T Intron 19 0.340 23 rs2239995 chr16:16192565 c.2645 - 3919G > A Intron 19 0.324 24 rs11864374 chr16:16201885 c.2871 + 1155G > A Intron 21 0.338 25 rs35529209 chr16:16205325 c.2965G > A Exon 22 (Thr989Ala) k Transport of estradiol 17b-glucuronide [32] 0.000 26 rs3887893 chr16:16205501 c.3079 + 62G > A Intron 22 0.448 27 rs13337489 chr16:16208683 c.3140G > C Exon 23 (Ser1047Cys) 0.000 28 rs2299670 chr16:16220858 c.3819 + 1090A > G Intron 26 0.399 29 rs8057331 chr16:16230411 c.4202C > T Exon 29 (Thr1401Met) 0.000 30 rs212090 chr16:16236004 c.5462T > A 30 UTR 0.357 31 rs212093 chr16:16237754 rs212093G > A Near gene region 0.429 32 rs4148382 chr16:16238494 rs4148382G > A Near gene region 0.034 ABCC2 1 g.-1774G > delG chr10:101535688 g.-1774G > delG Near gene region k Promoter activity [33] 0.000 2 rs1885301 chr10:101541053 c.-1549G > A Near gene region k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k Clearance of irinotecan (ABCC2*2 containing the G allele) [34] 0.379 450 Pharmacogenetics and Genomics 2012, Vol 22 No 6 Table 2 (continued) N dbSNP ida Positionb Allelesc Gene location (effect) Function MAF 3 rs2804402 chr10:101541583 c. Login to comment

PMID: 24670052 [PubMed] Kunicka T et al: "Importance of ABCC1 for cancer therapy and prognosis."

No. Sentence Comment

134 Letourneau et al. (2005) studied the influence of 10 DOI: 10.3109/03602532.2014.901348 ABCC1 and cancer therapy and prognosis non-synonymous SNPs - Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Arg723Gln (G2168A, rs4148356), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450) and Ser1512Leu (C4535T, rs369410659) - on ABCC1 expression using membrane vesicles isolated from transfected cells and assessed transport activity for three known ABCC1 substrates. Login to comment
159 NCBI ID Reference Amino acid exchange Nucleotide exchange Location Function MAFa rs41395947 Cys43Ser G128C Exon 2 Non-synonymous Unknown rs41494447 Thr73Ile C218T Exon 2 Non-synonymous T &#bc; 0.003 rs8187844 Ser92Phe C257T Exon 3 Non-synonymous T &#bc; 0.004 rs8187848 Arg230Gln G689A Exon 7 Non-synonymous A &#bc; 0.009 rs2230669 Pro272Pro G816A Exon 8 Synonymous A &#bc; 0.037 rs246221 Val275Val T825C Exon 8 Synonymous C &#bc; 0.301 rs35592 non-coding T-176C Intron 9 Non-coding C &#bc; 0.257 rs60782127 Arg433Ser G1299T Exon 10 Non-synonymous T &#bc; 0.004 rs35605 Leu562Leu T1684C Exon 13 Synonymous T &#bc; 0.173 rs112282109 Arg633Gln G1898A Exon 14 Non-synonymous A &#bc; 0.004 rs45511401 Gly671Val G2012T Exon 16 Non-synonymous T &#bc; 0.050 rs4148356 Arg723Gln G2168A Exon17 Non-synonymous A &#bc; 0.027 rs35529209 Ala989Thr G2965A Exon 22 Non-synonymous Unknown rs13337489 Cys1047Ser G3140C Exon 23 Non-synonymous C &#bc; 0.000 rs41410450 Arg1058Gln G3173A Exon 23 Non-synonymous Unknown rs2238476 non-coding G-1960A Intron 23 Non-coding T &#bc; 0.062 rs2230671 Ser1334Ser G4002A Exon 28 Synonymous T &#bc; 0.208 rs28364006 Thr1337Ala A4009G Exon 28 Non-synonymous Unknown rs369410659 Ser1512Leu C4535T Exon 31 Non-synonymous Unknown a Minor allele frequencies for Caucasinans in dbSNP based on HapMap-CEU population or 1000 genomes. Login to comment

PMID: 25078270 [PubMed] Kunicka T et al: "Non-coding polymorphisms in nucleotide binding domain 1 in ABCC1 gene associate with transcript level and survival of patients with breast cancer."

No. Sentence Comment

215 Ten other non-synonymous SNPs leading to amino acid substitutions (Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450), and Ser1512Leu (C4535T, rs369410659)) followed earlier had no effect on ABCC1 expression either, indicating that single amino acid substitutions may not necessarily influence the activity of the final protein [44]. Login to comment