ABCG5 p.Cys287Arg
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 15816807
[PubMed]
Miwa K et al: "ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects."
No.
Sentence
Comment
3
We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)].
X
ABCG5 p.Cys287Arg 15816807:3:40
status: VERIFIED14 Nucleotide Annealing Position Mutation change* Forward primer (5 → 3 ) Reverse primer (5 → 3 ) temperature (◦ C) Enzyme Size (bp) ABCG5 Exon 7 C287R 859T → C TCACACACTAACTACCTTCTGTTGTC ATGATGGGGAATGTGAAAGAAA 54 BstUI 191 Exon 13 Q604E 1810C → G ATCTAGATTCACAATGAACTTTCTA GTCCCTGCAAGTTGTAAGAG 53 XhoI 193 ABCG8 Exon 2 C54Y 161G → A GGAGGTCAGAGACCTCAAgT GCCCACCCTTTTATTTCCAC 56 RsaI 107 Exon 8 T400K 1199C → A ACACCTGTGTGGAAAGGTAAGGT GCGGGTTCAGTAATAAAATGACAG 57 MseI 216 Exon 9 M429V 1285A → G ATGCTGTTGCCTCAGCATCT AAGCTGTGTTCCTCTGAGCT 56 Tsp45I 306 Exon 13 A632V 1895C → T ATGTCTGTGTCTCCAGATCCTCAGgG TACAGGACCATGAAGCCACCGCTGAcGCC 63 HaeIII 105 sterols to cholesterol are known to be positively related to cholesterol absorption and negatively to cholesterol synthesis [1-4].
X
ABCG5 p.Cys287Arg 15816807:14:164
status: VERIFIED47 Genotype and allele frequencies A novel mutation of C287R and five SNPs (single nucleotide polymorphisms) (including a novel one ABCG8 M429V) were genotyped in our subjects.
X
ABCG5 p.Cys287Arg 15816807:47:52
status: VERIFIED48 Frequency distributions for the genotypes in exon 7 (C287R) and exon 13 (Q604E) of ABCG5, and in exon 2 (C54Y), exon 8 (T400K), exon 9 (M429V) and exon 13 (A632V) of ABCG8 are shown in Table 3.
X
ABCG5 p.Cys287Arg 15816807:48:53
status: VERIFIED51 Parameters Value Age (years) 62.4 +- 12.1 Gender (men/women) 48/52 BMI (kg/m2 ) 23.0 +- 3.5 Total cholesterol (mg/dl) 261 +- 48 Triacylglycerol (mg/dl) 135 +- 69 HDL-C (mg/dl) 56 +- 16 LDL-C (mg/dl) 179 +- 48 Sitosterol (µg/ml) 2.63 +- 1.0 Lathosterol (µg/ml) 3.00 +- 1.3 Table 3 Genotype distribution and allele frequencies of the polymorphisms in the ABCG5/ABCG8 gene Gene Mutation Nucleotide change Polymorphism Allele frequency ABCG5 Exon 7 C287R 859T → C T 0.99 C 0.01 Exon 13 Q604E 1810C → G C 0.89 G 0.11 ABCG8 Exon 2 C54Y 161G → A G 0.82 A 0.18 Exon 8 T400K 1199C → A C 0.88 A 0.12 Exon 9 M429V 1285A → G A 0.96 G 0.04 Exon 13 A632V 1895C → T C 0.995 T 0.005 found and the A632V variant was rare in our Japanese subjects.
X
ABCG5 p.Cys287Arg 15816807:51:455
status: VERIFIEDX
ABCG5 p.Cys287Arg 15816807:51:461
status: NEW53 Of the six mutation/ polymorphisms, one novel mutation (C287R) and one reported variant (A632V) were excluded from the study because of their rarity (allele frequency 0.01).
X
ABCG5 p.Cys287Arg 15816807:53:56
status: VERIFIED63 In the two rare cases with the C287R mutation, their serum sitosterol and sitosterol/cholesterol levels were not significantly elevated (2.6 µg/ml and 3.1 µg/ml, and 0.97 µg/mg and 1.48 µg/mg respectively).
X
ABCG5 p.Cys287Arg 15816807:63:31
status: VERIFIED70 DISCUSSION The main findings of the present study performed in Japanese hypercholesterolaemic subjects are as follows: (i) two novel mutants or polymorphisms, C287R in ABCG5 and M429V in ABCG8, have been identified, and (ii) the M429V polymorphism is positively associated with serum sitosterol and sitosterol/cholesterol levels, whereas the other three polymorphisms are not associated with serum non-cholesterol levels.
X
ABCG5 p.Cys287Arg 15816807:70:159
status: VERIFIED