ABCG2 p.Phe431Leu

[switch to full view]
Comments [show]
Publications
PMID: 15618737 [PubMed] Itoda M et al: "Eight novel single nucleotide polymorphisms in ABCG2/BCRP in Japanese cancer patients administered irinotacan."
No. Sentence Comment
11 MPJ6äAG2017 and MPJ6äAG2020 resulted in amino acid alterations, F431L and F489L, respectively.
X
ABCG2 p.Phe431Leu 15618737:11:74
status: VERIFIED
Login to comment

98 Novel SNPs in the ABCG2 gene found in Japanese individuals SNP name AG2005 AG2007 AG2012 AG2015 AG2017 AG2019 AG2020 AG2023 Intron 2 Intron 3 Intron 6 Exon 9 Exon 11 Intron 11 Exon 12 Intron 13 Position (cDNA) IVS2-93a IVS3+71ä72 insTb IVS6-204 1098 1291 IVS11-135 1465 IVS13+65 Nucleotide TÀC -ÀT CÀT GÀA TÀC GÀA TÀC TÀG Amino acid E366E F431L F489L Frequency, z T:97.5 -:99.2 C:96.7 G:99.2 T:99.2 G:98.3 T:99.2 G:99.2 C:2.5 T:0.8 T:3.3 A:0.8 C:0.8 A:1.7 C:0.8 A:0.8 a Numbers following IVS (intervening sequence) represents number of the preceding exon. In the case of end of the intron, the SNP position is expressed by a minus sign and the bases upstream of the next exon.
X
ABCG2 p.Phe431Leu 15618737:98:419
status: VERIFIED
Login to comment

107 Of these SNPs, two SNPs, MPJ6äAG2017 and 020, that were each found in 1 subject, introduced nonsynonymous amino acid changes (F431L and F489L), respectively.
X
ABCG2 p.Phe431Leu 15618737:107:131
status: VERIFIED
Login to comment

119 (E) Homozygous wild-type and wild-typeW1291TÀC (F431L) (MPJ6äG2017).
X
ABCG2 p.Phe431Leu 15618737:119:53
status: VERIFIED
Login to comment

PMID: 15882131 [PubMed] Lepper ER et al: "Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2."
No. Sentence Comment
157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region.
X
ABCG2 p.Phe431Leu 15882131:157:895
status: NEW
Login to comment

PMID: 16160819 [PubMed] Ishikawa T et al: "Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design."
No. Sentence Comment
113 These contradictory expression and localization data for ABCG2 variants indicate that differences in transfection conditions (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably Table 2 Frequencies of ABCG2 alleles in different ethnic groups Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) V12M c.34G>A Japanese 29 9 1 19.0 Imai et al. (2002) Japanese 10 - - 15.0 Zamber et al. (2003) Japanese 220 61 8 17.5 Kobayashi et al. (2005) Chinese 10 - - 20.0 Zamber et al. (2003) Southeast Asians 10 - - 45.0 Zamber et al. (2003) Pacific Islanders 7 - - 64.0 Zamber et al. (2003) Swedish 60 2 0 1.7 B¨ackstr¨om et al. (2003) Dutch 100 11 1 6.5 Bosch et al. (2005) Caucasian 86 - - 2.0 Zamber et al. (2003) Caucasian 150 27 2 10.3 Mizuarai et al. (2004) Caucasian 150 11 0 3.7 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 10.0 Zamber et al. (2003) Middle Eastern 20 - - 5.0 Zamber et al. (2003) Africans North of Sahara 7 - - 14.0 Zamber et al. (2003) African American 150 17 1 6.3 Kobayashi et al. (2005) Mexicans 10 - - 10.0 Zamber et al. (2003) Hispanic Livers 5 - - 40.0 Zamber et al. (2003) Mexican Indians 5 - - 90.0 Zamber et al. (2003) Q126Stop c.376C>T Japanese 124 3 0 1.2 Imai et al. (2002) Japanese 60 2 0 1.7 Itoda et al. (2003) Japanese 220 4 0 0.9 Kobayashi et al. (2005) Caucasian 150 0 0 0.0 Mizuarai et al. (2004) Caucasian 150 0 0 0.0 Kobayashi et al. (2005) African American 150 0 0 0.0 Kobayashi et al. (2005) Q141K c.421C>A Japanese 124 48 9 26.6 Imai et al. (2002) Japanese 10 - - 35.0 Zamber et al. (2003) Japanese 220 90 27 32.7 Kobayashi et al. (2005) Chinese 95 43 11 34.2 de Jong et al. (2004) Chinese 10 - - 35.0 Zamber et al. (2003) Southeast Asians 10 - - 15.0 Zamber et al. (2003) Pacific Islanders 7 - - 14.0 Zamber et al. (2003) Swedish 60 10 1 10.0 B¨ackstr¨om et al. (2003) Dutch 100 20 2 12.0 Bosch et al. (2005) Caucasian 85 - - 14.0 Zamber et al. (2003) Caucasian 172 33 3 11.3 de Jong et al. (2004) Caucasian 150 22 2 8.7 Mizuarai et al. (2004) Caucasian 150 25 4 11.0 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 5.0 Zamber et al. (2003) Middle Eastern 20 - - 13.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African, Sub-Saharan 938 14 1 0.9 de Jong et al. (2004) African American 24 - - 0.0 Zamber et al. (2003) African American 150 5 1 2.3 Kobayashi et al. (2005) African American 94 8 1 5.3 de Jong et al. (2004) Mexicans 10 - - 5.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 10.0 Zamber et al. (2003) R160Q c.479G>A Dutch 100 1 0 0.5 Bosch et al. (2005) I206L c.616A>C Japanese 10 - - 0.0 Zamber et al. (2003) Chinese 10 - - 0.0 Zamber et al. (2003) Southeast Asians 10 - - 0.0 Zamber et al. (2003) Pacific Islanders 7 - - 0.0 Zamber et al. (2003) Caucasian 65 - - 0.0 Zamber et al. (2003) Table 2 Continued Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) Ashkenazi Jewish 10 - - 0.0 Zamber et al. (2003) Middle Eastern 20 - - 0.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African American 15 - - 0.0 Zamber et al. (2003) Mexicans 10 - - 0.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 0.0 Zamber et al. (2003) F431L c.1291T>C Japanese 60 1 0 0.8 Itoda et al. (2003) S441N c.1322G>A Japanese 100 1 0 0.5 Kobayashi et al. (2005) F489L c.1465T>C Japanese 60 1 0 0.8 Itoda et al. (2003) Japanese 100 1 0 0.5 Kobayashi et al. (2005) R575Stop c.1723C>T Dutch 100 1 0 0.5 Bosch et al. (2005) N590Y c.1768A>T Caucasian 65 - - 1.0 Zamber et al. (2003) Caucasian 150 1 0 0.3 Mizuarai et al. (2004) African Americans 15 - - 0.0 Zamber et al. (2003) D620N c.1858G>A Dutch 100 1 0 0.5 Bosch et al. (2005) affect the cellular processing and sorting of these proteins.
X
ABCG2 p.Phe431Leu 16160819:113:3419
status: NEW
Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."
No. Sentence Comment
210 In different ethnic groups, seven naturally-occurring non-synonymous SNPs have been reported: V12M, Q126Stop, Q141K, I206L, F431L, S441N, F489L, N590Y and D620N.
X
ABCG2 p.Phe431Leu 16259577:210:124
status: VERIFIED
Login to comment

213 Some of the above sequence variations showed an allele frequency of ~ 1% in distinct populations, Q126stop and F489L in the Japanese and N590Y in the Caucasian population [129-131,134,135], whereas most of the mutations were only detected in single individuals (e.g., I206L, F431L, S441N, D620N).
X
ABCG2 p.Phe431Leu 16259577:213:275
status: VERIFIED
Login to comment

225 Location Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % Exon 2 34 G A 12 Val 12 Met 546 94.4 5.6 259 82.4 17.6 181 93.7 6.3 Exon 4 376 C T 126 Gln 126 stop 300 100 0 404 98.9 1.1 150 100 0 Exon 5 421 C A 141 Gln 141 Lys 717 89.0 11.0 354 69.4 30.6 1213 98.6 1.4 Exon 5 479 G A 160 Arg 160 Gln 100 99.5 0.5 ND ND ND ND ND ND Exon 11 1291 T C 431 Phe 431 Leu ND ND ND 60 99.2 0.8 ND ND ND Exon 11 1322 G A 441 Ser 441 Asn ND ND ND 100 99.5 0.5 ND ND ND Exon 12 1465 T C 489 Phe 489 Leu ND ND ND 160 99.4 0.6 ND ND ND Exon 14 1723 C T 575 Arg 575 stop 100 99.5 0.5 ND ND ND ND ND ND Exon 15 1768 A T 590 Asn 590 Tyr 215 99.5 0.5 ND ND ND 15 100 0 Exon 16 1858 T A 620 Asp 620 Asp 100 99.5 0.5 ND ND ND ND ND ND Data are from [129-135,137].
X
ABCG2 p.Phe431Leu 16259577:225:459
status: VERIFIED
Login to comment

250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins.
X
ABCG2 p.Phe431Leu 16259577:250:79
status: VERIFIED
Login to comment

PMID: 16303243 [PubMed] Yanase K et al: "Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development."
No. Sentence Comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain.
X
ABCG2 p.Phe431Leu 16303243:92:710
status: NEW
Login to comment

PMID: 16337740 [PubMed] Cervenak J et al: "The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology."
No. Sentence Comment
109 To date, altogether eight non-synonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.114TOC, c.369COT, c.474COT, c.1098GOA, c.1425AOG) missense mutations, one nonsense (Q126X), and one frameshift (c.1515delC) mutations were identified in the coding region of ABCG2 in healthy individuals or in patients [43-46,49,63-65].
X
ABCG2 p.Phe431Leu 16337740:109:62
status: VERIFIED
Login to comment

112 Some of the above sequence variations showed an allele frequency of about 1% in distinct populations (Q126X, F489L in the Japanese and N590Y in the Caucasian population [45-47,49,64]), while most of the mutations were only detected in single individuals (missense mutations: I206L, F431L, S441N, D620N, and a frameshift mutation: c.1515delC [44-46,49]).
X
ABCG2 p.Phe431Leu 16337740:112:282
status: VERIFIED
Login to comment

PMID: 16402910 [PubMed] Krishnamurthy P et al: "Role of ABCG2/BCRP in biology and medicine."
No. Sentence Comment
301 Three of these resulted in the amino acid substitutions F431L, F489L, and S441N.
X
ABCG2 p.Phe431Leu 16402910:301:56
status: NEW
Login to comment

PMID: 16608919 [PubMed] Tamura A et al: "Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport."
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Phe431Leu 16608919:2:220
status: NEW
Login to comment

82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan).
X
ABCG2 p.Phe431Leu 16608919:82:1311
status: NEW
Login to comment

144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis.
X
ABCG2 p.Phe431Leu 16608919:144:196
status: NEW
Login to comment

166 The F431L variant as well as the acquired mutants R482G and R482T transported hematoporphyrin (Fig. 5, top), although they did not transport methotrexate (Fig. 5, bottom).
X
ABCG2 p.Phe431Leu 16608919:166:4
status: NEW
Login to comment

177 as the variants F208S, S248P, S441N, F431L, and F489L were expressed in Flp-In 293 cells.
X
ABCG2 p.Phe431Leu 16608919:177:37
status: NEW
Login to comment

182 The F431L variant that was active in porphyrin transport conferred Flp-In-293 cells resistance to light as did the ABCG2 WT (Fig. 6).
X
ABCG2 p.Phe431Leu 16608919:182:4
status: NEW
Login to comment

184 To gain more insight into the association of ABCG2 variants with cellular resistance to anticancer drugs, we incubated Flp-In-293 cells expressing ABCG2 WT, F431L, S441N, or F489L in the presence of SN-38, mitoxantrone, doxorubicin, or daunorubicin at different concentrations as described under Materials and Methods. Table 3 summarizes the drug resistance profile of those variants-expressing cells.
X
ABCG2 p.Phe431Leu 16608919:184:157
status: NEW
Login to comment

185 Both Flp-In-293/ABCG2 (WT) and Flp-In-293/ABCG2 (F431L) cells were resistant toward SN-38 and mitoxantrone, whereas the resistance ratio of Flp-In-293/ABCG2 (S441N) and Flp-In-293/ABCG2 (F489L) cells were much lower, being close to that of Flp-In-293/Mock cells.
X
ABCG2 p.Phe431Leu 16608919:185:49
status: NEW
Login to comment

186 None of the SNP variants of F431L, S441N, and F489L conferred Flp-In-293 cells resistance to doxorubicin or daunorubicin (Table 3), being different from the acquired mutants of R482G and R482T (Yoshikawa et al., 2004).
X
ABCG2 p.Phe431Leu 16608919:186:28
status: NEW
Login to comment

203 Photosensitivity of Flp-In-293 cells expressing ABCG2 WT, F431L, S441N, or F489L.
X
ABCG2 p.Phe431Leu 16608919:203:58
status: NEW
Login to comment

214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Phe431Leu 16608919:214:220
status: NEW
Login to comment

224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein.
X
ABCG2 p.Phe431Leu 16608919:224:731
status: NEW
Login to comment

227 TABLE 3 Drug resistance profiles of ABCG2 WT and variants The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, or daunorubicin at different concentrations (0-100 ␮M) as described under Materials and Methods.
X
ABCG2 p.Phe431Leu 16608919:227:161
status: NEW
Login to comment

233 Anticancer Drug IC50 and Drug Resistance Ratio Mock WT F431L S441N F489L nM (-fold) SN-38 0.9 Ϯ 0.1 (1.0) 42.1 Ϯ 3.1 (46.8)* 11.5 Ϯ 0.9 (12.7)* 0.7 Ϯ 0.1 (0.8) 3.1 Ϯ 0.3 (3.4) Mitoxantrone 5.2 Ϯ 0.3 (1.0) 99.8 Ϯ 4.5 (19.2)* 20.3 Ϯ 1.9 (4.4)* 4.6 Ϯ 0.5 (0.9) 11.5 Ϯ 0.4 (2.2) Doxorubicin 32.0 Ϯ 0.6 (1.0) 48.1 Ϯ 2.0 (1.5) 39.0 Ϯ 3.5 (1.2) 20.3 Ϯ 1.9 (0.6) 44.6 Ϯ 3.9 (1.4) Daunorubicin 9.5 Ϯ 1.2 (1.0) 17.8 Ϯ 3.9 (1.8) 14.1 Ϯ 0.5 (1.5) 12.1 Ϯ 0.2 (1.3) 16.3 Ϯ 0.9 (1.7) *P Ͻ 0.01.
X
ABCG2 p.Phe431Leu 16608919:233:55
status: NEW
Login to comment

246 The F431L variant lacks the activity of methotrexate transport; however, it seems to be normal in terms of hematoporphyrin transport (Fig. 5).
X
ABCG2 p.Phe431Leu 16608919:246:4
status: NEW
Login to comment

PMID: 16702730 [PubMed] Maekawa K et al: "Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population."
No. Sentence Comment
85 115Haplotype Structure in Human ABCG2 (from |1836 to |1175 bp upstream of the translational start site) of the basal promoter,30) and was suggested to in‰uence irinotecan pharmacokinetics.31) The frequencies of two well-known nonsynonymous SNPs, 34GÀA (Val12Met) and 421CÀA (Gln141Lys), were 0.192 and 0.319 in our study, which were comparable to those in Chinese (0.204 and 0.222–0.350, respectively).20,27) However, the frequencies were much higher than those in Caucasians (0.02–0.065 and 0.08–0.15), African-Americans (0–0.09 and 0–0.05), and a Swedish population (0.02 and 0.1).18,19,21,23,27) Of other relatively rare nonsynonymous SNPs, 376CÀT (Gln126X), 1291TÀC (Phe431Leu), 1322GÀA (Ser441Asn), 1465TÀC (Phe489Leu), and 1515delC (Phe506SerfsX4) were already detected in a Japanese population by Itoda et al.17) andWor Kobayashi et al.,23) but not found in other ethnic groups.
X
ABCG2 p.Phe431Leu 16702730:85:721
status: VERIFIED
Login to comment

141 The thick lines represent the combinations with frequencies over 10z, and the thin lines represent the combinations with frequencies of 1.0 to 9.9z. 118 Keiko MAEKAWA et al. haplotype harboring nonsynonymous SNPs, 1465TÀC (Phe489Leu) (*2), 1291TÀC (Phe431Leu) (*3), 1322GÀA (Ser441Asn)W1515delC (Phe506SerfsX) (*4), and 1723CÀT (Arg575X) (*5), respectively.
X
ABCG2 p.Phe431Leu 16702730:141:259
status: VERIFIED
Login to comment

158 The functional eŠects of the other ˆve nonsynonymous SNPs (Ser13Leu, Arg160Gln, Gly354Arg, Phe431Leu, and Phe489Leu) have not yet been characterized.
X
ABCG2 p.Phe431Leu 16702730:158:101
status: VERIFIED
Login to comment

PMID: 16877258 [PubMed] Wakabayashi K et al: "Human ABC transporter ABCG2 in xenobiotic protection and redox biology."
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells.
X
ABCG2 p.Phe431Leu 16877258:176:198
status: NEW
Login to comment

PMID: 17015488 [PubMed] Sarkadi B et al: "Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system."
No. Sentence Comment
997 In healthy individuals or patients, altogether eight nonsynonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.
X
ABCG2 p.Phe431Leu 17015488:997:88
status: VERIFIED
Login to comment

PMID: 17228519 [PubMed] Tamura A et al: "Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system."
No. Sentence Comment
48 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 3 Plasma Membrane inside outside S S S homodimer A B CH2N COOH V12M Q141K F208S S248P F431L S441N F489L R482G R482T Acquired mutation Figure 1.
X
ABCG2 p.Phe431Leu 17228519:48:204
status: VERIFIED
Login to comment

67 PCR primers and conditions for site-directed mutagenesis to create variants of ABCG2 Variant Forward/Reverse Primer sequence (5` →→ 3`) Primer length % GC Tm (ºC) (F/R) primers (bases) V12M F CGAAGTTTTTATCCCAATGTCACAAGGAAACAC 33 39 55 R GTGTTTCCTTGTGACATTGGGATAAAAACTTCG Q141K F CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT 35 42 55 R AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG F208S F TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA 35 45 55 R TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P F TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT 35 40 55 R AAACAACTTGAAGATGGGATATCGAGGCTGATGAA F431L F AGCTGGGGTTCTCCTCTTCCTGACGACC 28 60 62 R GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N F AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC 34 47 59 R GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L F GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG 46 34 62 R CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC Sites of mutagenesis are indicated by underbars.
X
ABCG2 p.Phe431Leu 17228519:67:563
status: VERIFIED
Login to comment

104 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 0 1 2 RelativemRNAlevel Mock WT V12M Q141K mRNA A ABCG2 GAPDH Mock WT F208S S248P F431L S441N F489L ABCG2 GAPDH 0 1 2 RelativemRNAlevel mRNA B GAPDH ABCG2 Mock WT F208S S248P F431L S441N F489L Protein 0 1 2 Relativeproteinlevel * * * C DProtein GAPDH ABCG2 0 1 2 Relativeproteinlevel * * Mock WT V12M Q141K Figure 3. mRNA and protein expression levels of ABCG2 WT and variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe431Leu 17228519:104:201
status: VERIFIED
X
ABCG2 p.Phe431Leu 17228519:104:294
status: VERIFIED
Login to comment

114 Characterization of V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells The mRNA levels of ABCG2 and GAPDH were measured by quantitative PCR, and the ratios of ABCG2 variants vs. GAPDH were plotted.
X
ABCG2 p.Phe431Leu 17228519:114:47
status: VERIFIED
Login to comment

119 Figure 3 demonstrates mRNA and protein levels of ABCG2 WT and V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe431Leu 17228519:119:89
status: VERIFIED
Login to comment

124 The other variants, i.e., V12M, Q141K, S248P, F431L, and F489L, were expressed in plasma membrane as was ABCG2 WT.
X
ABCG2 p.Phe431Leu 17228519:124:46
status: VERIFIED
Login to comment

132 Figure 4 summarizes the characteristics of those Tamura et al. 8 Journal of Experimental Therapeutics and Oncology Vol. 6 2006 Class Class Class Class WT V12M Q141K F431L S248P F489L F208S S441N R482G R482T Protein expression + + + + + + - - + + SN-38 resistance + + + + + / - - - - + + MX resistance + + + + / - - - - - + + Doxorubicin resistance - - - - - - - - + + Daunorubicin resistance - - - - - - - - + + Figure 4.
X
ABCG2 p.Phe431Leu 17228519:132:165
status: VERIFIED
Login to comment

139 On the other hand, S248P, F431L, and F489L appear to form the second class, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance.
X
ABCG2 p.Phe431Leu 17228519:139:26
status: VERIFIED
Login to comment

143 Resistance profile (IC50 ) of ABCG2 Compounds IC50 (nM) Mock WT V12M Q141K F208S S248P F431L S441N F489L SN-38 1.0 ± 0.2 49.9 ± 6.0 51.1 ± 13.8 17.7 ± 0.9 0.7 ± 0.0 3.6 ± 0.4 12.1 ± 1.5 0.8 ± 0.0 3.9 ± 0.4 (49.9)* (51.1)* (17.7)* (0.7) (3.6) (12.1)* (0.8) (3.9) Mitoxantorone 7.0 ± 1.1 108.0 ± 4.9 94.0 ± 18.6 46.7 ± 12.7 5.1 ± 1.0 13.4 ± 1.3 15.2 ± 1.4 5.7 ± 0.8 12.1 ± 6.2 (15.4)* (13.4)* (6.7)* (0.7) (1.9) (2.2)* (0.8) (1.7) Doxorubicin 38.8 ± 3.8 105.2 ± 24.9 123.6 ± 35.3 156.8 ± 27.5 19.9 ± 8.7 23.7 ± 6.7 43.5 ± 6.1 39.4 ± 4.1 47.6 ± 3.1 (2.7) (3.2) (4.0) (0.5) (0.6) (1.1) (1.0) (1.2) Daounorubicin 13.0 ± 0.6 32.3 ± 6.5 58.2 ± 5.0 57.7 ± 4.1 14.1 ± 2.3 22.1 ± 4.2 15.9 ± 1.2 13.3 ± 1.1 23.6 ± 1.6 (2.5) (4.5) (4.4) (1.1) (1.7) (1.2) (1.0) (1.8) Etoposide 117.1 ± 16.0 210.2 ± 18.4 297.3 ± 58.5 233.9 ± 54.2 122.9 ± 17.6 137.7 ± 14.8 139.1 ± 12.3 154.3 ± 8.5 186.9 ± 10.1 (1.8) (2.5) (2.0) (1.0) (1.2) (1.2) (1.3) (1.6) Vincristine 1.8 ± 0.2 4.3 ± 0.3 7.1 ± 1.4 5.6 ± 1.6 0.6 ± 0.0 4.3 ± 0.9 1.8 ± 0.3 0.9 ± 0.1 3.0 ± 0.7 (2.4) (3.0) (3.1) (0.3) (2.4) (1.0) (0.5) (1.7) The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, V12M, Q141K, F208S, S248P, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, daunorubicin, etoposide, or vincristine at different concentrations as described in Materials and Methods.
X
ABCG2 p.Phe431Leu 17228519:143:87
status: VERIFIED
X
ABCG2 p.Phe431Leu 17228519:143:1479
status: VERIFIED
Login to comment

PMID: 17297656 [PubMed] Tamura A et al: "Re-evaluation and functional classification of non-synonymous single nucleotide polymorphisms of the human ATP-binding cassette transporter ABCG2."
No. Sentence Comment
3 To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system.
X
ABCG2 p.Phe431Leu 17297656:3:156
status: VERIFIED
Login to comment

8 The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type.
X
ABCG2 p.Phe431Leu 17297656:8:59
status: VERIFIED
Login to comment

137 Characterization of the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe431Leu 17297656:137:38
status: VERIFIED
Login to comment

138 Figure 2C demonstrates the mRNA and protein levels of WT ABCG2 and the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe431Leu 17297656:138:85
status: VERIFIED
Login to comment

142 The other variants (S248P, F431L and F489L) were expressed in the plasma membrane, as was WT ABCG2.
X
ABCG2 p.Phe431Leu 17297656:142:27
status: VERIFIED
Login to comment

146 On the contrary, the S248P, F431L and F489L variants contributed drug resistance; however, their contribution was not so large as that of WT.
X
ABCG2 p.Phe431Leu 17297656:146:28
status: VERIFIED
Login to comment

155 For this purpose, we expressed WT ABCG2, V12M, Q141K, S248P, F431L, F489L, R482G and R482T in Sf9 insect cells and prepared plasma membranes as described previously,(16,35) as the plasma membrane of Sf9 cells has lower endogenous background ATPase activity than Flp-In-293 cells.
X
ABCG2 p.Phe431Leu 17297656:155:61
status: VERIFIED
Login to comment

176 Resistance profile (IC50) of ABCG2 Compound IC50 (nM) Mock Wild type V12M Q141K F208S S248P F431L S441N F489L SN-38 0.9 40.0 (44.4) 40.0 (44.4) 17.0 (18.9) 0.6 (0.7) 3.0 (3.3) 10.0 (11.1) 0.7 (0.8) 3.1 (3.4) Mitoxantorone 5.2 >100 (>19) 92.0 (17.7) 45.0 (8.7) 4.5 (0.9) 11.0 (2.1) 21.0 (4.0) 4.6 (0.9) 11.0 (2.1) Doxorubicin 32.0 78.0 (2.4) 100.0 (3.1) 110.0 (3.4) 20.0 (0.6) 20.0 (0.6) 40.0 (1.3) 21.0 (0.7) 45.0 (1.4) Daunorubicin 12.0 30.0 (2.5) 50.0 (4.2) 50.0 (4.2) 12.0 (1.0) 21.0 (1.8) 14.0 (1.2) 12.0 (1.0) 19.0 (1.6) Etoposide 110.0 200.0 (1.8) 220.0 (2.0) 200.0 (1.8) 110.0 (1.0) 120.0 (1.1) 120.0 (1.1) 130.0 (1.2) 170.0 (1.5) Vincristine 1.4 4.0 (2.9) 5.0 (3.6) 4.5 (3.2) 0.6 (0.4) 4.0 (2.9) 1.4 (1.0) 0.8 (0.6) 2.8 (2.0) Relative resistances to mock cells are described in parentheses.
X
ABCG2 p.Phe431Leu 17297656:176:92
status: VERIFIED
Login to comment

192 As clearly demonstrated in this study, the F208S, S248P, F431L, S441N and F489L variants exhibited greatly altered protein expression levels (Fig. 2C) or drug resistance profiles (Fig. 4 and Table 1).
X
ABCG2 p.Phe431Leu 17297656:192:57
status: VERIFIED
Login to comment

202 As one of the specific aims of the present study, we functionally classified the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity.
X
ABCG2 p.Phe431Leu 17297656:202:138
status: VERIFIED
Login to comment

207 Drug resistance profiles of Flp-In-293 cells expressing the wild-type (WT) BCRP/MXR1/ABCP (ABCG2), F208S, S248P, F431L, S441N or F489L variants toward (A) SN-38 and (B) mitoxantrone.
X
ABCG2 p.Phe431Leu 17297656:207:113
status: VERIFIED
Login to comment

216 Finally, S248P, F431L and F489L appear to form the fourth heterogeneous group, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance and transport activity.
X
ABCG2 p.Phe431Leu 17297656:216:16
status: VERIFIED
Login to comment

PMID: 17373578 [PubMed] Yoshioka S et al: "The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein."
No. Sentence Comment
6 PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products.
X
ABCG2 p.Phe431Leu 17373578:6:3
status: VERIFIED
Login to comment

7 In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38.
X
ABCG2 p.Phe431Leu 17373578:7:25
status: VERIFIED
Login to comment

42 The cells were selected with 120 ng/mL of methotrexate, and the resulting mixed populations of resistant cells were designated as PA/WT, PA/V12M, PA/ G51C, PA/Q141K, PA/T153M, PA/I206L, PA/F208S, PA/ S248P, PA/F431L, PA/N590Y and PA/D620N, respectively. The PA/F208S clones and PA/F431L clones were obtained by limiting dilution.
X
ABCG2 p.Phe431Leu 17373578:42:210
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:42:281
status: VERIFIED
Login to comment

43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study.
X
ABCG2 p.Phe431Leu 17373578:43:568
status: VERIFIED
Login to comment

45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1.
X
ABCG2 p.Phe431Leu 17373578:45:23
status: VERIFIED
Login to comment

70 The BCRP (824 bp) and GAPDH (551 bp) transcripts were amplified by RT-PCR from 0.3 mg of total RNA. c, Western blot analysis of BCRP in PA317, PA/WT, PA/F431L, and PA/F208S cells as described above.
X
ABCG2 p.Phe431Leu 17373578:70:153
status: VERIFIED
Login to comment

75 SN-38 Resistance Levels of PA317 Transfectantsa Cell type IC50 (nmol/L) Degree of resistance PA317 11 T 0.2 1 PA/WT 550 T 16 50 PA/V12M 490 T 13 45 PA/Q141K 110 T 5.9 10 PA/T153M 260 T 15 24 PA/Q166E 680 T 40 62 PA/F208S 10 T 0.7 1 PA/F431L 34 T 0.9 3 PA/D620N 190 T 5.7 17 a Cells were cultured for 5 days with various concentrations of SN-38.
X
ABCG2 p.Phe431Leu 17373578:75:235
status: VERIFIED
Login to comment

80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N).
X
ABCG2 p.Phe431Leu 17373578:80:250
status: VERIFIED
Login to comment

82 F431L, N590Y and D620N are located within the transmembrane domain (Fig. 1 and Table I).
X
ABCG2 p.Phe431Leu 17373578:82:0
status: VERIFIED
Login to comment

87 PA/F431L expressed BCRP products of two distinct molecular sizes, 70-kDa and 65-kDa (Fig. 2a and c).
X
ABCG2 p.Phe431Leu 17373578:87:3
status: VERIFIED
Login to comment

97 Each of the other transfectants (PA/G51C, PA/I206L, PA/S248P, PA/F431L, and PA/N590Y cells) showed similar cell surface BCRP expression levels to PA/WT (Fig. 2d).
X
ABCG2 p.Phe431Leu 17373578:97:65
status: VERIFIED
Login to comment

101 PA/F431L cells showed 3-fold higher resistance to SN-38 than PA317 cells but PA/F431L cells were found to be 15-fold more sensitive to this agent than PA/WT cells (Table II).
X
ABCG2 p.Phe431Leu 17373578:101:3
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:101:80
status: VERIFIED
Login to comment

107 Analyses of PA/F431L Clones PA/F431L cells expressed two species of BCRP of molecular weights 70- and 65-kDa (Fig. 2a).
X
ABCG2 p.Phe431Leu 17373578:107:15
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:107:31
status: VERIFIED
Login to comment

108 To confirm whether these two versions of the protein were derived from a single gene, we isolated independent PA/F431L subclones, PA/F431L-cl.6 and -cl.15.
X
ABCG2 p.Phe431Leu 17373578:108:113
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:108:133
status: VERIFIED
Login to comment

109 As shown in Fig. 4a, both of these clones simultaneously expressed the 70- and 65-kDa BCRP species, similar to the original mass population of PA/F431L cells.
X
ABCG2 p.Phe431Leu 17373578:109:146
status: VERIFIED
Login to comment

110 FACS analysis further revealed that these clones also showed similar BCRP expression levels on their cell surfaces to PA/WT and PA/F431L cells (Fig. 4c).
X
ABCG2 p.Phe431Leu 17373578:110:131
status: VERIFIED
Login to comment

111 Moreover, these clones showed no change in their exogenous BCRP mRNA levels compared with PA/WT and PA/F431L (Fig. 4b) but showed only marginal resistance to SN-38 treatment (Fig. 4d).
X
ABCG2 p.Phe431Leu 17373578:111:103
status: VERIFIED
Login to comment

128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function.
X
ABCG2 p.Phe431Leu 17373578:128:251
status: VERIFIED
Login to comment

130 The resulting mixed populations of cells were designated a PA/WT, PA/V12M, PA/G51C, PA/Q141K, PA/ T153M, PA/I206L, PA/F208S, PA/S248P, PA/F431L, PA/ N590Y and PA/D620N.
X
ABCG2 p.Phe431Leu 17373578:130:138
status: VERIFIED
Login to comment

133 PA/F431L cells expressed a 65-kDa and 70-kDa species of BCRP (Figs. 2a and 4a).
X
ABCG2 p.Phe431Leu 17373578:133:3
status: VERIFIED
Login to comment

134 In addition, although PA/ F431L cells expressed BCRP at cell surface levels that were similar to PA/WT cells (Figs. 2d and 4c), they showed only marginal resistance to SN-38 (Fig. 4d and Table II).
X
ABCG2 p.Phe431Leu 17373578:134:26
status: VERIFIED
Login to comment

143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain.
X
ABCG2 p.Phe431Leu 17373578:143:89
status: VERIFIED
Login to comment

158 BCRP protein and mRNA expression in PA/F431L clones as described in Figs. 2 and 3. a, Western blot analysis of BCRP in PA/ F431L clones b, Semi-quantitative RT-PCR of BCRP mRNA in PA/ F431L clones.
X
ABCG2 p.Phe431Leu 17373578:158:39
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:158:123
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:158:184
status: VERIFIED
Login to comment

159 c, BCRP cell surface expression analysis of PA/F431L clones by FACS.
X
ABCG2 p.Phe431Leu 17373578:159:47
status: VERIFIED
Login to comment

160 d, Drug resistance levels in the PA/F431L clones. PA317 (open circle), PA/WT (closed circle), PA/F431L (closed triangle), PA/F431L clone 6 (closed lozenge), and PA/F431L clone 15 (closed square) cells were cultured for 5 days with various concentrations of SN-38 and assayed as described in Fig. 3d.
X
ABCG2 p.Phe431Leu 17373578:160:36
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:160:97
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:160:125
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:160:164
status: VERIFIED
Login to comment

164 The F431L residue is located in the second transmembrane domain (Fig. 1) and PA/F431L cells express two species of BCRP of 70-kDa and 65-kDa in size.
X
ABCG2 p.Phe431Leu 17373578:164:4
status: VERIFIED
X
ABCG2 p.Phe431Leu 17373578:164:80
status: VERIFIED
Login to comment

165 The 65-kDa F431L BCRP product has the same molecular weight as F208S BCRP by SDS-PAGE (Fig. 2a and c).
X
ABCG2 p.Phe431Leu 17373578:165:11
status: VERIFIED
Login to comment

166 From the results of our analysis of PA/F431L clones, these two products seemed to be generated from a single cDNA species (Fig. 4b).
X
ABCG2 p.Phe431Leu 17373578:166:39
status: VERIFIED
Login to comment

167 The 70-kDa BCRP expression levels in PA/F431L cells were also much higher than the 65-kDa BCRP protein in the same cells (Figs. 2c and 4c).
X
ABCG2 p.Phe431Leu 17373578:167:40
status: VERIFIED
Login to comment

168 Although PA/F431L cells express higher quantities of 70-kDa BCRP compared with PA/Q141K, PA/T153M, and PA/D620N cells (Fig. 2a) these cells in fact show a lower resistance to SN-38 than these other three transfectants (Table II).
X
ABCG2 p.Phe431Leu 17373578:168:12
status: VERIFIED
Login to comment

169 From these results, we speculate that this residue might in fact be important in the recognition of SN-38, and that the F431L substitution may result in lower transporter function than the wild-type protein.
X
ABCG2 p.Phe431Leu 17373578:169:120
status: VERIFIED
Login to comment

178 CONCLUSION We have characterized two important BCRP germ-line mutations, T623C (F208S) and T1291C (F431L).
X
ABCG2 p.Phe431Leu 17373578:178:99
status: VERIFIED
Login to comment

PMID: 18237272 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of non-synonymous SNP variants of human ABC transporter ABCG2."
No. Sentence Comment
27 Furthermore, the F208S, S248P, F431L, S441N, and F489L ABCG2 variants exhibited greatly altered protein expression levels and drug Abbreviations used: ABC, ATP-binding cassette; ABCG2, ABC subfamily G, member 2; BMA, bafilomycin A1; CPT, camptothecin; DMEM, Dulbecco`s modified Eagle`s medium; endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated degradation; FCS, fetal calf serum; Flp, flippase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HRP, horseradish peroxidase; ME, 2-mercaptoethanol; PNGase F, peptide N-glycosidase F; RT-PCR, reverse transcription-PCR; SN-38, 7-ethyl-10-hydroxycamptothecin; SNP, single nucleotide polymorphism; TBS, Tris-buffered saline; WT, wild-type.
X
ABCG2 p.Phe431Leu 18237272:27:31
status: NEW
Login to comment

208 In a previous study using the Flp recombinase system [33], we functionally characterized the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity.
X
ABCG2 p.Phe431Leu 18237272:208:150
status: NEW
Login to comment

PMID: 18249138 [PubMed] Hazai E et al: "Homology modeling of breast cancer resistance protein (ABCG2)."
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand.
X
ABCG2 p.Phe431Leu 18249138:245:1039
status: NEW
Login to comment

PMID: 18363541 [PubMed] Tamura A et al: "Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems."
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A.
X
ABCG2 p.Phe431Leu 18363541:230:132
status: NEW
Login to comment

231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids.
X
ABCG2 p.Phe431Leu 18363541:231:96
status: NEW
Login to comment

245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Phe431Leu 18363541:245:198
status: NEW
Login to comment

252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative).
X
ABCG2 p.Phe431Leu 18363541:252:395
status: NEW
Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult.
X
ABCG2 p.Phe431Leu 18464048:250:451
status: VERIFIED
Login to comment

315 22.Itoda,M.,etal.EightnovelsinglenucleotidepolymorphismsinABCG2/BCRPinJapanesecancerpatientsadministeredirinotacan.DrugMetabPharmacokinet.2003; 18(3):212-217. decreased MTX and porphyrin transport in cells transfected with variant cDNA in comparison to wild-type cDNA has also been reported for the following variants Phe208Ser, Ser248Pro, and Phe431Leu (Tamura et al., 2006).
X
ABCG2 p.Phe431Leu 18464048:315:347
status: VERIFIED
Login to comment

PMID: 18668433 [PubMed] Koshiba S et al: "Human ABC transporters ABCG2 (BCRP) and ABCG4."
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007).
X
ABCG2 p.Phe431Leu 18668433:225:182
status: NEW
Login to comment

234 The F431L variant as well as the acquired mutants R482G and R482T transported haematoporphyrin (Figure 9a), although they did not transport methotrexate (Figure 9b).
X
ABCG2 p.Phe431Leu 18668433:234:4
status: NEW
Login to comment

PMID: 18958403 [PubMed] Furukawa T et al: "Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations."
No. Sentence Comment
130 As shown in Fig. 3A, the protein level of the Q141K variant was approximately two-fold enhanced by treatment with the proteasome inhibitor MG132.
X
ABCG2 p.Phe431Leu 18958403:130:31
status: NEW
Login to comment

175 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles (18).
X
ABCG2 p.Phe431Leu 18958403:175:31
status: NEW
Login to comment

PMID: 19111841 [PubMed] Noguchi K et al: "Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy."
No. Sentence Comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain.
X
ABCG2 p.Phe431Leu 19111841:874:536
status: NEW
Login to comment

PMID: 19111842 [PubMed] Wakabayashi-Nakao K et al: "Quality control of human ABCG2 protein in the endoplasmic reticulum: ubiquitination and proteasomal degradation."
No. Sentence Comment
951 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles [34].
X
ABCG2 p.Phe431Leu 19111842:951:31
status: NEW
Login to comment

PMID: 19200005 [PubMed] Porcelli L et al: "Intracellular trafficking of MDR transporters and relevance of SNPs."
No. Sentence Comment
206 The polymorphisms T623C (F208S), T742C (S248P), T1291C (F431L) and T1465C (F489L) were studied by Tamura et al.
X
ABCG2 p.Phe431Leu 19200005:206:56
status: NEW
Login to comment

PMID: 19827267 [PubMed] Ishikawa T et al: "Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics."
No. Sentence Comment
222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004).
X
ABCG2 p.Phe431Leu 19827267:222:79
status: NEW
Login to comment

228 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles Figure 7. Continued WT V12M Q141K F208S S248P F431L S441N F489L R482G R482T Protein expression + + + - + + - + + + MTX transport + + + - - - - +/ - - Porphyrin transport + + + - - + - +/ + + SN-38 resistance + + + - +/ + - - + + MX resistance + + + - - - - - -- - - - - - - - +/ - - - - - - - - + + Doxorubicin resistance + + Daunorubicin resistance + + ATPase activity (Prazosin) + + WTV12M Q141K F431L F489L S248P F208S S441L R482G R482T ∆1.5 ∆3 ∆3.5 ∆5 ∆4 - - - - - - -- - - B 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:51 20     Journal of Experimental Therapeutics and Oncology  Vol. 8  2009 (Tamura et al., 2007b).
X
ABCG2 p.Phe431Leu 19827267:228:31
status: NEW
X
ABCG2 p.Phe431Leu 19827267:228:191
status: NEW
X
ABCG2 p.Phe431Leu 19827267:228:543
status: NEW
Login to comment

232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7.
X
ABCG2 p.Phe431Leu 19827267:232:174
status: NEW
X
ABCG2 p.Phe431Leu 19827267:232:382
status: NEW
Login to comment

PMID: 19949928 [PubMed] Ross DD et al: "Impact of breast cancer resistance protein on cancer treatment outcomes."
No. Sentence Comment
93 Tamura et al. used multicolor fluorescence in situ hybridization to assure uniform mRNA expression of cDNAs of seven BCRP SNPs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) transduced into Flp-In-293 cells (87, 88).
X
ABCG2 p.Phe431Leu 19949928:93:155
status: VERIFIED
Login to comment

PMID: 20345483 [PubMed] Kawahara H et al: "Pharmacological interaction with sunitinib is abolished by a germ-line mutation (1291T>C) of BCRP/ABCG2 gene."
No. Sentence Comment
5 These inhibitory effects of sunitinib were further analyzed in Q141K-, R482G-, R482S-, and F431L-variant BCRPs.
X
ABCG2 p.Phe431Leu 20345483:5:91
status: VERIFIED
Login to comment

6 Intriguingly, the F431L-variant BCRP, which is expressed by a germ-line mutant allele 1291T>C, was almost insensitive to both sunitinib- and fumitremorgin C (FTC)-mediated inhibition in a cell proliferation assay.
X
ABCG2 p.Phe431Leu 20345483:6:18
status: VERIFIED
Login to comment

7 Sunitinib and FTC did not inhibit 125 I-iodoarylazidoprazosin-binding to F431L-BCRP.
X
ABCG2 p.Phe431Leu 20345483:7:73
status: VERIFIED
Login to comment

21 (16) In addition, we reported that a germ-line mutant allele 1291T>C expresses the F431L variant of BCRP with lower functional resistance to SN-38.
X
ABCG2 p.Phe431Leu 20345483:21:83
status: VERIFIED
Login to comment

22 (17) This suggests that amino acid substitution F431L may affect substrate recognition of SN-38.
X
ABCG2 p.Phe431Leu 20345483:22:48
status: VERIFIED
Login to comment

37 Moreover, we show for the first time that this inhibitory effect of sunitinib on BCRP is cancelled by a germ-line mutation of BCRP gene (1291T>C) that causes a single amino acid substitution of F431L.
X
ABCG2 p.Phe431Leu 20345483:37:194
status: VERIFIED
Login to comment

45 (17,21) To establish K562 /F431L cells, parental K562 cells were transduced with a HaBCRP retrovirus- harboring Myc-tagged human BCRP (F431L) cDNA in the Ha retrovirus vector as previously described.
X
ABCG2 p.Phe431Leu 20345483:45:27
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:45:135
status: VERIFIED
Login to comment

46 (17) After limiting dilution without any selective drugs and screening of over 700 clones, we selected two F431L-BCRP-expressing K562 cell clones K562/F431L-1 and -3.
X
ABCG2 p.Phe431Leu 20345483:46:107
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:46:151
status: VERIFIED
Login to comment

109 (13,35-37) The Q141K variant, a widespread SNP in Japanese individuals, is associated with the low protein expression of BCRP,(15) and the F431L variant, also a germ-line mutation of BCRP, shows a low level of resistance to SN-38.
X
ABCG2 p.Phe431Leu 20345483:109:139
status: VERIFIED
Login to comment

126 marginal ability to overcome SN-38 resistance in the F431L-BCRP variant, even though the other BCRP variants were all sensitive to sunitinib with comparable efficacy.
X
ABCG2 p.Phe431Leu 20345483:126:53
status: VERIFIED
Login to comment

127 To confirm these observations, we also tested the effect of sunitinib on F431L-BCRP in different cell lines.
X
ABCG2 p.Phe431Leu 20345483:127:73
status: VERIFIED
Login to comment

128 The F431L BCRP-expressing K562 cell clones K562/F431L-1 and -3 were established without the drug selection process.
X
ABCG2 p.Phe431Leu 20345483:128:4
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:128:48
status: VERIFIED
Login to comment

129 FACS analysis showed that the protein expression of F431L-BCRP in K562 cells was relatively low (1/8-1 /4-fold compared with wild-type BCRP-expressing K562 cells) (Fig. 5a).
X
ABCG2 p.Phe431Leu 20345483:129:52
status: VERIFIED
Login to comment

130 The reason for the lower protein expression of F431L-BCRP in K562 cells is unknown, but we could not isolate K562 /F431L clones expressing high levels of F431L-BCRP protein, even after the screening of over 700 clones.
X
ABCG2 p.Phe431Leu 20345483:130:47
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:130:115
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:130:154
status: VERIFIED
Login to comment

131 These additional experiments also revealed that sunitinib could not overcome SN-38 resistance conferred by F431L-BCRP (Fig. 5b).
X
ABCG2 p.Phe431Leu 20345483:131:107
status: VERIFIED
Login to comment

132 We also examined the inhibition of the F431L-BCRP variant by the typical BCRP inhibitor FTC and found that the F431L-BCRP variant was also resistant to FTC-mediated inhibition (Fig. 5c).
X
ABCG2 p.Phe431Leu 20345483:132:39
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:132:111
status: VERIFIED
Login to comment

134 Effects of sunitinib on IAAP binding to F431L-BCRP.
X
ABCG2 p.Phe431Leu 20345483:134:40
status: VERIFIED
Login to comment

135 We next examined the effect of sunitinib on photoaffinity labeling of wild-type and F431L-BCRP with [I125 ]IAAP-binding to investigate the direct competition between the substrate IAAP and sunitinib on the F431L variant.
X
ABCG2 p.Phe431Leu 20345483:135:84
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:135:206
status: VERIFIED
Login to comment

136 Because F431L-BCRP protein expression was lower than wild-type BCRP in K562 cell lines (Fig. 6a), [I125 ]IAAP-binding to the membrane vesicles prepared from these K562/F431L cells was weaker than that from wild-type BCRP-expressing membrane vesicles.
X
ABCG2 p.Phe431Leu 20345483:136:8
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:136:168
status: VERIFIED
Login to comment

137 Consistent with other reports, sunitinib (10 lmol /L) and FTC (10 lmol /L) inhibited [I125 ]IAAP-binding to wild-type BCRP, whereas [I125 ]IAAP-binding to the F431L variant was apparently resistant to sunitinib- and FTC-mediated inhibition (Fig. 6b,c).
X
ABCG2 p.Phe431Leu 20345483:137:159
status: VERIFIED
Login to comment

138 These data clearly showed that the F431L variant has decreased affinity for physical interactions with sunitinib and FTC.
X
ABCG2 p.Phe431Leu 20345483:138:35
status: VERIFIED
Login to comment

173 Reversal ratios are shown for wild-type (gray circles), and Q141K (open squares), F431L (filled circles), R482S (open diamonds), and R482G (open triangles) BCRP variant-expressing cells.
X
ABCG2 p.Phe431Leu 20345483:173:82
status: VERIFIED
Login to comment

175 Moreover, the germ-line BCRP variant F431L showed decreased affinity for sunitinib and therefore would be irrelevant to the pharmacological and physical interaction between BCRP and sunitinib.
X
ABCG2 p.Phe431Leu 20345483:175:37
status: VERIFIED
Login to comment

180 Second, we investigated the effect of sunitinib on mutants of BCRP, and found that the F431L variant conferred resistance to sunitinib-mediated suppression.
X
ABCG2 p.Phe431Leu 20345483:180:87
status: VERIFIED
Login to comment

188 Sunitinib failed to overcome F431L-breast cancer resistance protein (BCRP)-mediated drug resistance in K562 cells.
X
ABCG2 p.Phe431Leu 20345483:188:29
status: VERIFIED
Login to comment

189 Protein expression of BCRP in K562 / F431L cells was analyzed by flow cytometry (a).
X
ABCG2 p.Phe431Leu 20345483:189:37
status: VERIFIED
Login to comment

190 The F431L-BCRP-expressing K562 cell lines K562 / F431L-1 and -3 were cultured for 5 days with SN-38 and sunitinib (b) or fumitremorgin C (FTC) (c).
X
ABCG2 p.Phe431Leu 20345483:190:4
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:190:49
status: VERIFIED
Login to comment

193 Effect of sunitinib on photoaffinity labeling of wild-type and F431L-breast cancer resistance protein (BCRP) with [125 I]IAAP.
X
ABCG2 p.Phe431Leu 20345483:193:63
status: VERIFIED
Login to comment

194 Protein expression of BCRP was analyzed by western blotting (a) in F431L-BCRP-transduced K562 cells.
X
ABCG2 p.Phe431Leu 20345483:194:67
status: VERIFIED
Login to comment

195 Membrane vesicles (90 lg / mL) from K562 / BCRP and K562 / F431L-3 cells were pre-incubated for 5 min with sunitinib or fumitremorgin C (FTC) (10 lmol / L each) and then 10 nmol / L of [125 I]IAAP was added for a further 10 min.
X
ABCG2 p.Phe431Leu 20345483:195:59
status: VERIFIED
Login to comment

202 The germ-line mutant F431L-BCRP was previously shown to have low ability to confer drug-resistance to SN-38.
X
ABCG2 p.Phe431Leu 20345483:202:21
status: VERIFIED
Login to comment

203 (34) Our present study also showed that the F431L mutation in BCRP compromised the pharmacological and physical interactions with sunitinib and FTC.
X
ABCG2 p.Phe431Leu 20345483:203:44
status: VERIFIED
Login to comment

206 (26) Thus F431L substitution may reduce substrate /inhibitor-recognition efficacy or may be an important amino acid residue involved in the functional transporter activity of BCRP.
X
ABCG2 p.Phe431Leu 20345483:206:10
status: VERIFIED
Login to comment

210 Our observations also indicate that the F431L-BCRP protein forms a dimer (data not shown), but our data appeared to be inconsistent with their conclusion because the F431L-BCRP variant showed reduced sensitivity to FTC.
X
ABCG2 p.Phe431Leu 20345483:210:40
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:210:166
status: VERIFIED
Login to comment

211 Unfortunately, we failed to confirm the inhibitory effects of sunitinib and FTC on F431L-BCRP-mediated drug transport using the in vitro vesicle transport assay because the membrane vesicles prepared from K562 /F431L cells did not show good transport activity in vitro (data not shown).
X
ABCG2 p.Phe431Leu 20345483:211:83
status: VERIFIED
X
ABCG2 p.Phe431Leu 20345483:211:211
status: VERIFIED
Login to comment

212 However, we also monitored anti-BCRP antibody 5D3 reactivity to F431L-BCRP in the presence or absence of FTC because the direct interaction between FTC and BCRP is thought to stimulate the binding efficacy of the anti-BCRP antibody 5D3 by inducing a conformational change in BCRP.
X
ABCG2 p.Phe431Leu 20345483:212:64
status: VERIFIED
Login to comment

213 (46) In this 5D3 reactivity test, the fluorescence intensity associated with 5D3 antibody binding was changed by FTC treatment in K562 /BCRP cells, but not in K562/F431L cells (Fig. S3, Supporting information).
X
ABCG2 p.Phe431Leu 20345483:213:164
status: VERIFIED
Login to comment

214 This experiment suggested that F431L-BCRP is resistant to the FTC-induced conformational change required for 5D3 antibody-binding to BCRP.
X
ABCG2 p.Phe431Leu 20345483:214:31
status: VERIFIED
Login to comment

215 Overall, we suspect that the F431L variant shows compromised physical interaction with FTC and sunitinib, or altered conformational dynamics that are required for substrate recognition and transport cycling by BCRP.
X
ABCG2 p.Phe431Leu 20345483:215:29
status: VERIFIED
Login to comment

217 (31) Although F431L-BCRP had lower transporter activity than wild-type BCRP, this mutant BCRP still conferred significant drug-resistance in both PA317 and K562 cells, so that we should pay attention to functional relevance between drug-drug interaction and this mutant BCRP.
X
ABCG2 p.Phe431Leu 20345483:217:14
status: VERIFIED
Login to comment

218 Importantly, our findings demonstrate that germ-line mutations of the BCRP /ABCG2 gene 1291T>C (F431L), affect its pharmacological interaction with sunitinib.
X
ABCG2 p.Phe431Leu 20345483:218:96
status: VERIFIED
Login to comment

221 In future personalized medicine, functional analysis of germ-line mutation affecting efficacy of drug-drug interactions such as F431L-BCRP with sunitinib would contribute to design for the evidence-based optimized chemotherapy regimen in each patient.
X
ABCG2 p.Phe431Leu 20345483:221:128
status: VERIFIED
Login to comment

PMID: 20518788 [PubMed] Shigeta J et al: "BCRP/ABCG2 confers anticancer drug resistance without covalent dimerization."
No. Sentence Comment
260 We have also reported that two germ line mutations of BCRP in our laboratory, namely 623T>C (F208S) and 1291T>C (F431L), also resulted in the loss of function or severely reduced the function of BCRP.
X
ABCG2 p.Phe431Leu 20518788:260:113
status: VERIFIED
Login to comment

261 (44) Sunitinib clearly reversed the SN-38 resistance of PA /WT cells but not of BCRP-F431L transfectants.
X
ABCG2 p.Phe431Leu 20518788:261:85
status: VERIFIED
Login to comment

262 In addition, sunitinib did not inhibit [125 I]iodoarylazidoprazosin-binding to BCRP-F431L.
X
ABCG2 p.Phe431Leu 20518788:262:84
status: VERIFIED
Login to comment

PMID: 20812902 [PubMed] Ni Z et al: "Structure and function of the human breast cancer resistance protein (BCRP/ABCG2)."
No. Sentence Comment
270 Similarly, Leu substitution of Phe431 retained full transport activity for porphyrin, but not for methotrexate [120].
X
ABCG2 p.Phe431Leu 20812902:270:11
status: VERIFIED
Login to comment

PMID: 21103975 [PubMed] Meyer zu Schwabedissen HE et al: "In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2)."
No. Sentence Comment
253 SNPs with low AF including the c.1291T>C (p.F431L, AF 0.006 in Japanese populations), or the c.1768A>T (p.N590Y, AF 0.001-0.003 in Caucasian populations) mutation have been studied for their activity in vitro showing reduced resistance toward known substrates such as SN-38, mitoxantrone, or topotecan, respectively (An et al. 2009; Itoda et al. 2003; Mizuarai et al. 2004; Tamura et al. 2006; Vethanayagam et al. 2005; Yoshioka et al. 2007; Zamber et al. 2003).
X
ABCG2 p.Phe431Leu 21103975:253:44
status: VERIFIED
Login to comment

PMID: 21188243 [PubMed] Ishikawa T et al: "Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis."
No. Sentence Comment
167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90].
X
ABCG2 p.Phe431Leu 21188243:167:198
status: NEW
Login to comment

177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms.
X
ABCG2 p.Phe431Leu 21188243:177:160
status: NEW
X
ABCG2 p.Phe431Leu 21188243:177:360
status: NEW
Login to comment

PMID: 21567408 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts."
No. Sentence Comment
118 Impact of SNPs on Protein Stability and ERAD of ABCG2 By functional validation in vitro, the above-mentioned 17 nonsynonymous polymorphisms of ABCG2 were classified into four groups.99 The nonsynonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin.100 The F208S, S248P, F431L, S441N, and F489L variants, on the contrary, exhibited greatly reduced protein expression levels and drug resistance profiles.99 In particular, expression levels of the F208S and S441N variant proteins were markedly low.99 These variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the ERAD pathway.78 The immature and nonglycosylated forms of F208S and S441N (Fig. 6a) were detected.
X
ABCG2 p.Phe431Leu 21567408:118:364
status: NEW
Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined.
X
ABCG2 p.Phe431Leu 20103563:6589:242
status: NEW
Login to comment

PMID: 19414346 [PubMed] Katayama K et al: "Pharmacological interplay between breast cancer resistance protein and gefitinib in epidermal growth factor receptor signaling."
No. Sentence Comment
149 The expression levels of BCRP gene products harboring a C421A (Q141K) SNP are 5-fold lower than those of the wild-type gene, and the resistance of cells with a C421A BCRP SNP to SN-38 is also 5-fold lower than those with wild-type BCRP (25, 27).
X
ABCG2 p.Phe431Leu 19414346:149:21
status: NEW
Login to comment

151 In addition, T1291C (F431L) BCRP-transfectants express two BCRP products of 65 kDa and 70 kDa, and resistance to SN-38 in these cells is significantly lower than wild-type BCRP-transfectants (27).
X
ABCG2 p.Phe431Leu 19414346:151:21
status: NEW
Login to comment

PMID: 24388985 [PubMed] Deppe S et al: "Impact of genetic variability in the ABCG2 gene on ABCG2 expression, function, and interaction with AT1 receptor antagonist telmisartan."
No. Sentence Comment
7 Moreover, basal pheophorbide A efflux capacity of S248P, F431L, and F489L variants was significantly impaired.
X
ABCG2 p.Phe431Leu 24388985:7:57
status: NEW
Login to comment

37 Site-directed mutagenesis Non-synonymous ABCG2 single nucleotide polymorphisms (SNPs) G34A (V12M), C421A (Q141K), T742C (S248P), T1291C (F431L), T1465C (F489L) as well as somatic mutation A1444G (R482G) were inserted into the ABCG2 cDNA sequence in the pTRE-Tight-BI-AcGFP1-ABCG2 plasmid using the QuickChange&#d2; Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Waldbronn, Germany) with specific primers according to the manufacturer`s instructions (Supplemental Fig. 1).
X
ABCG2 p.Phe431Leu 24388985:37:137
status: NEW
Login to comment

91 The average PhA-associated fluorescence in non-induced HEK293-Tet-On cells transiently transfected with the various ABCG2 variants was not significantly different as compared with that observed in HEK293-Tet-On cells transfected with ABCG2 wild-type (wild-type (100 &#b1; 12.1%), V12M (106.7 &#b1; 2.0%), Q141K (97.1 &#b1; 9.3%), S248P (99.1 &#b1; 9.8%), F431L (104.7% &#b1; 10.9%), R482G A B C D Fig. 2.
X
ABCG2 p.Phe431Leu 24388985:91:355
status: NEW
Login to comment

100 However, basal PhA efflux was significantly lower in HEK293- Tet-On cells transfected with the ABCG2 variants S248P (44.2 &#b1; 2.8%; P < 0.01 vs. doxycycline-induced ABCG2 wild-type), F431L (28.4 &#b1; 3.1%; P < 0.01 vs. doxycycline-induced ABCG2 wild-type), and F489L (20.9 &#b1; 2.0%; P < 0.05 vs. doxycycline-induced ABCG2 wild-type), demonstrating that these mutations significantly reduce ABCG2-mediated PhA transport in HEK293-Tet-On cells.
X
ABCG2 p.Phe431Leu 24388985:100:185
status: NEW
Login to comment

104 Inhibitory efficacy of telmisartan was not altered by the ABCG2 polymorphisms V12M and Q141K but tended to be lower in the ABCG2 variants S248P and F431L (Fig. 4A and C).
X
ABCG2 p.Phe431Leu 24388985:104:148
status: NEW
Login to comment

128 Moreover, ABCG2 variants S248P and F431L displayed a significantly reduced PhA transport, although protein expression was similar to that of ABCG2 wild-type.
X
ABCG2 p.Phe431Leu 24388985:128:35
status: NEW
Login to comment

130 Moreover, SN-38 and methotrexate transport activity has been shown to be reduced in PA317 cells as well as in Sf9 membrane vesicles expressing the F431L variant [19,23], thereby indicating that substrate transport may be generally reduced by this polymorphism.
X
ABCG2 p.Phe431Leu 24388985:130:147
status: NEW
Login to comment

PMID: 24777822 [PubMed] Jani M et al: "Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics."
No. Sentence Comment
95 Histone deacetylase inhibitors rescue newly synthesized transporter proteins and prevent aggresome targeting by disturbing TableÊf;1ߒߙMajor non-synonymous single-nucleotide polymorphisms found in the ABCG2 coding region Allele frequencies presented in this table do not reflect interethnic differences Mutation Position in BCRP Cellular effects of SNP Allele frequency % References 34G>A, V12M (rs2231137) N-terminus Lower expression, no impact on function 0-29.8 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 151G>T, G51C N-terminus Slightly overexpressed, decreased transport activity 0.1 Tamura et al. (2006), Yoshioka et al. (2007) 376C>T, Q126X (rs7255271) NBD No expression, no activity 0-1.7 Tamura et al. (2006), Mizuarai et al. (2004), Itoda et al. (2003), Imai et al. (2002), Kobayashi et al. (2005), Kondo et al. (2004) 421C>A, Q141K (rs2231142) NBD Lower expression, decreased transport activity, substrate specificity altered 0-35.7 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 458C>T, T153 M NBD Slightly lower expression, no impact on function 3.3 Tamura et al. (2006), Mizuarai et al. (2004) 479G>A, R160Q NBD Not determined 0.5 Bosch et al. (2005), Tamura et al. (2006) 496C>G, Q166E (rs1061017) NBD Slightly lower expression, no impact on function 0-1.1 Tamura et al. (2006), Kondo et al. (2004), Yoshioka et al. (2007) 616A>C, I206L (rs12721643) NBD Well expressed, decreased transport activity 0-10.0 Tamura et al. (2006), Zamber et al. (2003), Vethanayagam et al. (2005), Ieiri (2012a) 623T>C, F208 (rs1061018) NBD No expression, no transport activity 0.9-3.9 Tamura et al. (2006) 742T>C, S248P (rs3116448) NBD Well expressed, no transport activity 0.5 Tamura et al. (2006), Yoshioka et al. (2007) 1000G>T, E334X (rs3201997) NBD No expression, no transport activity Not determined Tamura et al. (2006), Ishikawa et al. (2005) 1291T>C F431L ECL1 Lower expression, substrate specificity altered 0.6-0.8 Tamura et al. (2006), Itoda et al. (2003), Yoshioka et al. (2007) 1322G>A, S441 N ECL1 Slightly lower expression, no transport activity 0.5 Tamura et al. (2006), Kobayashi et al. (2005), Kondo et al. (2004) 1465T>C, F489L TM3 Slightly lower expression, no transport activity 0.5-0.8 Tamura et al. (2006), Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F506S TM4 Not determined 0.5 Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F507L 1515delC, V508L 1515delC, M509X 1711T>A, F571I (rs9282571) TM5 Well expressed, substrate specificity altered 0.5 Tamura et al. (2006) 1723C>T, R575X TM5 Not determined 0.5 Tamura et al. (2006) 1768A>T, N590Y (rs34264773) ECL3 Slightly overexpressed, substrate specificity altered 0-9.7 Tamura et al. (2006), Mizuarai et al. (2004), Zamber et al. (2003), Vethanayagam et al. (2005) 1858G>A, D620 N (rs34783571) ECL3 Slightly overexpressed, substrate specificity altered 0-11.1 Tamura et al. (2006), Bosch et al. (2005), Honjo et al. (2002), Vethanayagam et al. (2005) the trafficking along microtubules (Basseville et al. 2012).
X
ABCG2 p.Phe431Leu 24777822:95:2138
status: NEW
Login to comment

PMID: 25036722 [PubMed] Szafraniec MJ et al: "Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2)."
No. Sentence Comment
201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells.
X
ABCG2 p.Phe431Leu 25036722:201:226
status: NEW
Login to comment

204 In the Phe489 Leu mutant transport was also impaired, while the Ser441 Asn variant lost the ability to transport methotrexate and the Phe431 Leu variant seemed to transport hematoporphyrin normally but showed no transport of methotrexate.
X
ABCG2 p.Phe431Leu 25036722:204:134
status: NEW
Login to comment

209 Position Type of mutation Effect on the transporter References NBD Lys 86 Met (i) No stimulation of the ATPase activity by prazosin; (ii) no influence on the transport of mitoxantrone Henriksen et al. (2005b) Glu 126 stop, Phe 208 Ser, Ser 248 Phe, Glu 334 stop Inability to transport hematoporphyrin Tamura et al. (2006) Glu 211 Gln Complete abolishment of the ATPase activity and methotrexate transport Hou et al. (2009) Pro 392 Ala Significant reduction in the efflux activity of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Ni et al. (2011) TM1 Gly 406 Ala Gly 410 Ala No influence on the activity of the transporter Polgar et al. (2004) Gly 406 Leu Gly 410 Leu (i) Loss of the ability to transport rhodamine123; (ii) impaired transport of mitoxantrone, Pheide and BODIPY-prazosin Polgar et al. (2004) Extracellular loop 1 Phe 431 Leu (i) Loss of the ability to transport methotrexate; (ii) 10% level of hematoporphyrin transport compared to the WT protein Tamura et al. (2006) Ser 441 Asn Inability to transport hematoporphyrin Tamura et al. (2006) Ser 441 Asn Loss of the ability to transport methotrexate Tamura et al. (2006) TM2 Lys 452 Ala His 457 Ala Increase in transport of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Cai et al. (2010) Lys 453 Ala Arg 465 Ala Decrease in transport of mitoxantrone, BODIPY-prazosin, Hoechst 33342, doxorubicin, SN-38 and rhodamine 123 Cai et al. (2010) TM3 Arg 482 Gly Arg 482 Thr (i) No change in the inhibitory activity of lapatinib; (ii) about two times greater inhibition by ritonavir, saquinavir and nalfinavir than in the WT variant; (iii) gaining the ability to transport rhodamine123 and doxorubicin; (iv) no influence on the transport of mitoxantrone; (v) loss of the ability to transport methotrexate Dai et al. (2008), Gupta et al. (2004), Honjo et al. (2001), Mitomo et al. (2003) Arg 482 Thr (i) Lower IC 50 of cyclosporine A for mutant than for WT variant; (ii) lower elacridar inhibition potency Xia et al. (2007) Arg 482 Lys Complete loss of transport activity Ejendal et al. (2006) Phe 489 Leu Impaired transport of porphyrins, no transport of methotrexate Tamura et al. (2006) Extracellular loop 3 Asn 590 Tyr Over twice reduced transport of mitoxantrone, topotecan, daunorubicin and rhodamine 123 Vethanayagam et al. (2005) Cys 592 Ala/Cys 608 Ala (i) Transport of mitoxantrone almost unchanged; (ii) transport of BODIPY-prazosin significantly impaired Henriksen et al. (2005a) Extracellular loop 3 Cys 603 Ser Cys 592 Ser/Cys 608 Ser Cys 592 Ser/Cys 603 Ser/Cys 608 Ser Diminished susceptibility to the inhibitory activity of fumitremorgin C Shigeta et al. (2010) Cys-less Arg 482 Gly-BCRP Complete loss of the ability to efflux mitoxantrone Liu et al. (2008b) The positions of the amino acid residues refer to the topological model of BCRP proposed by Wang et al. (2009).
X
ABCG2 p.Phe431Leu 25036722:209:830
status: NEW
Login to comment