ABCC7 p.Lys447Arg
| Predicted by SNAP2: | A: N (78%), C: N (78%), D: N (61%), E: N (72%), F: N (82%), G: N (72%), H: N (97%), I: N (78%), L: N (82%), M: N (78%), N: N (93%), P: N (57%), Q: N (87%), R: N (93%), S: N (87%), T: N (93%), V: N (82%), W: N (57%), Y: N (93%), |
| Predicted by PROVEAN: | A: N, C: D, D: N, E: N, F: D, G: D, H: N, I: D, L: D, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, V: D, W: D, Y: N, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Non-native conformers of CFTR NBD1 are recognized ... J Biol Chem. 2015 Dec 1. pii: jbc.M115.685628. Gong X, Ahner A, Roldan A, Lukacs GL, Thibodeau PH, Frizzell RA
Non-native conformers of CFTR NBD1 are recognized by Hsp27 and conjugated to SUMO-2 for degradation.
J Biol Chem. 2015 Dec 1. pii: jbc.M115.685628., [PMID:26627832]
Abstract [show]
A newly identified pathway for selective degradation of the common mutant of the cystic fibrosis transmembrane conductance regulator (CFTR), F508del, is initiated by binding of the small heat shock protein (sHsp), Hsp27. Hsp27 collaborates with Ubc9, the E2 enzyme for protein SUMOylation, to selectively degrade F508del CFTR via the SUMO-targeted ubiquitin E3 ligase, RNF4 (1). Here, we ask what properties of CFTR are sensed by the Hsp27-Ubc9 pathway by examining the ability of NBD1 (locus of the F508del mutation) to mimic the disposal of full-length (FL) CFTR. Similar to FL CFTR, F508del NBD1 expression was reduced 50-60% by Hsp27, it interacted preferentially with the mutant, and was modified primarily by SUMO-2. Mutation of the consensus SUMOylation site, K447, obviated Hsp27 mediated F508del NBD1 SUMOylation and degradation. As for FL CFTR and NBD1 in vivo, SUMO modification using purified components in vitro was greater for F508del NBD1 vs. WT, and for the SUMO-2 paralog. Several findings indicated that Hsp27-Ubc9 targets the SUMOylation of a transitional, non-native conformation of F508del NBD1: a) its modification decreased as [ATP] increased, reflecting stabilization of the NBD by ligand binding, b) a temperature-induced increase in intrinsic fluorescence, which reflects formation of a transitional NBD1 conformation, was followed by its SUMO modification, and c) introduction of solubilizing or revertant mutations to stabilize F508del NBD1 reduced its SUMO modification. These findings indicate that the Hsp27-Ubc9 pathway recognizes a non-native conformation of mutant NBD1, which leads to its SUMO-2 conjugation and degradation by the ubiquitin-proteasome system.
Comments [show]
None has been submitted yet.
No. Sentence Comment
50 CD4T-WT-NBD1-K447R and CD4T- F508del-NBD1-K447R mutants were generated using the following primers: 5`- CCTGTCCTGAAAGATATTAATTTCAGGATA GAAAGAGGACAGTTG-3` (forward), 5`- CAACTGTCCTCTTTCTATCCTGAAATTAAT ATCTTTCAGGACAGG-3` (reverse).
X
ABCC7 p.Lys447Arg 26627832:50:13
status: NEWX
ABCC7 p.Lys447Arg 26627832:50:42
status: NEW128 Given the K447 site prediction, we determined the ability of Hsp27 to promote the degradation of F508del NBD1 in HEK293 cells by expressing CD4T-F508del-NBD1 containing the conservative mutation, K447R.
X
ABCC7 p.Lys447Arg 26627832:128:196
status: NEW130 Similar to the data presented in Fig. 1A, Hsp27 co-expression reduced the steady-state level of F508del NBD1; however, the impact of Hsp27 was lost in the K447R mutant of CD4T- F508del-NBD1.
X
ABCC7 p.Lys447Arg 26627832:130:155
status: NEW132 Next, we determined the ability of Hsp27 to induce SUMOylation of the membrane tethered F508del NBD1 bearing the K447R mutation in HEK293 cells expressing CD4T-F508del-NBD1 with and without the K447R mutation.
X
ABCC7 p.Lys447Arg 26627832:132:113
status: NEWX
ABCC7 p.Lys447Arg 26627832:132:194
status: NEW134 The degree of SUMO-2/3 modification of F508del-NBD1 was increased with co-expression of Hsp27, but the sHsp did not further modify the K447R variant.
X
ABCC7 p.Lys447Arg 26627832:134:135
status: NEW136 Next, we asked whether the introduction of the K447R mutation into the full-length protein would reduce the impact of Hsp27 on the expression of F508del CFTR.
X
ABCC7 p.Lys447Arg 26627832:136:47
status: NEW211 A predicted SUMOylation site at K447 was verified as a critical locus of SUMO modification in F508del NBD1 using the charge preserving mutation, K447R.
X
ABCC7 p.Lys447Arg 26627832:211:145
status: NEW213 Preliminary studies (Fig. 3C) showed that introduction of the K447R mutation into full-length F508del CFTR did not alter the ability of this sHsp to reduce its expression.
X
ABCC7 p.Lys447Arg 26627832:213:62
status: NEW