ABCMdb

PMID: 26627832

Gong X, Ahner A, Roldan A, Lukacs GL, Thibodeau PH, Frizzell RA
Non-native conformers of CFTR NBD1 are recognized by Hsp27 and conjugated to SUMO-2 for degradation.
J Biol Chem. 2015 Dec 1. pii: jbc.M115.685628., [PubMed]

Sentences

No. Mutations Sentence Comment

50 ABCC7 p.Lys447Arg ABCC7 p.Lys447Arg CD4T-WT-NBD1-K447R and CD4T- F508del-NBD1-K447R mutants were generated using the following primers: 5`- CCTGTCCTGAAAGATATTAATTTCAGGATA GAAAGAGGACAGTTG-3` (forward), 5`- CAACTGTCCTCTTTCTATCCTGAAATTAAT ATCTTTCAGGACAGG-3` (reverse). Login to comment 61 ABCC7 p.Phe494Asn Variants that contain a single solubilizing mutation, F494N, were used in most experiments; this mutation enhances the yield of both NBDs from bacterial expression. Login to comment 98 ABCC7 p.Phe494Asn In vitro SUMOylation of NBD1 - WT or F508del NBD1 SUMOylation was performed in vitro using purified human 1S-NBD1, a variant containing a single solubilizing mutation (F494N) that was introduced into the NBD during crystallization trials (32). Login to comment 128 ABCC7 p.Lys447Arg Given the K447 site prediction, we determined the ability of Hsp27 to promote the degradation of F508del NBD1 in HEK293 cells by expressing CD4T-F508del-NBD1 containing the conservative mutation, K447R. Login to comment 130 ABCC7 p.Lys447Arg Similar to the data presented in Fig. 1A, Hsp27 co-expression reduced the steady-state level of F508del NBD1; however, the impact of Hsp27 was lost in the K447R mutant of CD4T- F508del-NBD1. Login to comment 132 ABCC7 p.Lys447Arg ABCC7 p.Lys447Arg Next, we determined the ability of Hsp27 to induce SUMOylation of the membrane tethered F508del NBD1 bearing the K447R mutation in HEK293 cells expressing CD4T-F508del-NBD1 with and without the K447R mutation. Login to comment 134 ABCC7 p.Lys447Arg The degree of SUMO-2/3 modification of F508del-NBD1 was increased with co-expression of Hsp27, but the sHsp did not further modify the K447R variant. Login to comment 136 ABCC7 p.Lys447Arg Next, we asked whether the introduction of the K447R mutation into the full-length protein would reduce the impact of Hsp27 on the expression of F508del CFTR. Login to comment 211 ABCC7 p.Lys447Arg A predicted SUMOylation site at K447 was verified as a critical locus of SUMO modification in F508del NBD1 using the charge preserving mutation, K447R. Login to comment 213 ABCC7 p.Lys447Arg Preliminary studies (Fig. 3C) showed that introduction of the K447R mutation into full-length F508del CFTR did not alter the ability of this sHsp to reduce its expression. Login to comment