ABCMdb

ABCC7 p.Lys447Arg

None has been submitted yet.

Publications

PMID: 26627832 [PubMed] Gong X et al: "Non-native conformers of CFTR NBD1 are recognized by Hsp27 and conjugated to SUMO-2 for degradation."

No. Sentence Comment

50 CD4T-WT-NBD1-K447R and CD4T- F508del-NBD1-K447R mutants were generated using the following primers: 5`- CCTGTCCTGAAAGATATTAATTTCAGGATA GAAAGAGGACAGTTG-3` (forward), 5`- CAACTGTCCTCTTTCTATCCTGAAATTAAT ATCTTTCAGGACAGG-3` (reverse). Login to comment
128 Given the K447 site prediction, we determined the ability of Hsp27 to promote the degradation of F508del NBD1 in HEK293 cells by expressing CD4T-F508del-NBD1 containing the conservative mutation, K447R. Login to comment
130 Similar to the data presented in Fig. 1A, Hsp27 co-expression reduced the steady-state level of F508del NBD1; however, the impact of Hsp27 was lost in the K447R mutant of CD4T- F508del-NBD1. Login to comment
132 Next, we determined the ability of Hsp27 to induce SUMOylation of the membrane tethered F508del NBD1 bearing the K447R mutation in HEK293 cells expressing CD4T-F508del-NBD1 with and without the K447R mutation. Login to comment
134 The degree of SUMO-2/3 modification of F508del-NBD1 was increased with co-expression of Hsp27, but the sHsp did not further modify the K447R variant. Login to comment
136 Next, we asked whether the introduction of the K447R mutation into the full-length protein would reduce the impact of Hsp27 on the expression of F508del CFTR. Login to comment
211 A predicted SUMOylation site at K447 was verified as a critical locus of SUMO modification in F508del NBD1 using the charge preserving mutation, K447R. Login to comment
213 Preliminary studies (Fig. 3C) showed that introduction of the K447R mutation into full-length F508del CFTR did not alter the ability of this sHsp to reduce its expression. Login to comment