ABCC7 p.Lys447Arg
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 26627832
[PubMed]
Gong X et al: "Non-native conformers of CFTR NBD1 are recognized by Hsp27 and conjugated to SUMO-2 for degradation."
No.
Sentence
Comment
50
CD4T-WT-NBD1-K447R and CD4T- F508del-NBD1-K447R mutants were generated using the following primers: 5`- CCTGTCCTGAAAGATATTAATTTCAGGATA GAAAGAGGACAGTTG-3` (forward), 5`- CAACTGTCCTCTTTCTATCCTGAAATTAAT ATCTTTCAGGACAGG-3` (reverse).
X
ABCC7 p.Lys447Arg 26627832:50:13
status: NEWX
ABCC7 p.Lys447Arg 26627832:50:42
status: NEW128 Given the K447 site prediction, we determined the ability of Hsp27 to promote the degradation of F508del NBD1 in HEK293 cells by expressing CD4T-F508del-NBD1 containing the conservative mutation, K447R.
X
ABCC7 p.Lys447Arg 26627832:128:196
status: NEW130 Similar to the data presented in Fig. 1A, Hsp27 co-expression reduced the steady-state level of F508del NBD1; however, the impact of Hsp27 was lost in the K447R mutant of CD4T- F508del-NBD1.
X
ABCC7 p.Lys447Arg 26627832:130:155
status: NEW132 Next, we determined the ability of Hsp27 to induce SUMOylation of the membrane tethered F508del NBD1 bearing the K447R mutation in HEK293 cells expressing CD4T-F508del-NBD1 with and without the K447R mutation.
X
ABCC7 p.Lys447Arg 26627832:132:113
status: NEWX
ABCC7 p.Lys447Arg 26627832:132:194
status: NEW134 The degree of SUMO-2/3 modification of F508del-NBD1 was increased with co-expression of Hsp27, but the sHsp did not further modify the K447R variant.
X
ABCC7 p.Lys447Arg 26627832:134:135
status: NEW136 Next, we asked whether the introduction of the K447R mutation into the full-length protein would reduce the impact of Hsp27 on the expression of F508del CFTR.
X
ABCC7 p.Lys447Arg 26627832:136:47
status: NEW211 A predicted SUMOylation site at K447 was verified as a critical locus of SUMO modification in F508del NBD1 using the charge preserving mutation, K447R.
X
ABCC7 p.Lys447Arg 26627832:211:145
status: NEW213 Preliminary studies (Fig. 3C) showed that introduction of the K447R mutation into full-length F508del CFTR did not alter the ability of this sHsp to reduce its expression.
X
ABCC7 p.Lys447Arg 26627832:213:62
status: NEW