ABCA4 p.Thr901Ala
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 22229821
[PubMed]
Duno M et al: "Phenotypic and genetic spectrum of Danish patients with ABCA4-related retinopathy."
No.
Sentence
Comment
57
[1622C>T+3113C>T] p.[L541P+A1038V] 12 c.4739T>C p.L1580S 33 Known D444 c.2701A>G p.T901A 18 c.4773 + 3A>G na IVS33 New D034 c.2588G>C p.G863A 17 c.4773 + 5G>A na IVS33 New D178 c.3113C>T p.A1038V 21 c.5523_5528del p.1843_1844delRG 39 New D110 c.
X
ABCA4 p.Thr901Ala 22229821:57:83
status: NEW97 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773 + 5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005 + 1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773 + 3A>G* D110 p.[L541P+A1038V] c.5584 + 1G>A* D182 p.R2030Q c.6386 + 1G>A* D186 p.R1108C c.6386 + 1G>AA* D133 p.L510R IVS46 + 1G>A* Cone-rod dystrophy D134 c.4667 + 2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame.
X
ABCA4 p.Thr901Ala 22229821:97:770
status: NEW59 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.4739T>C p.L1580S 33 Known D444 c.2701A>G p.T901A 18 c.4773ߙ+ߙ3A>G na IVS33 New D034 c.2588G>C p.G863A 17 c.4773ߙ+ߙ5G>A na IVS33 New D178 c.3113C>T p.A1038V 21 c.5523_5528del p.1843_1844delRG 39 New D110 c.
X
ABCA4 p.Thr901Ala 22229821:59:83
status: NEW100 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773ߙ+ߙ5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005ߙ+ߙ1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773ߙ+ߙ3A>G* D110 p.[L541P+A1038V] c.5584ߙ+ߙ1G>A* D182 p.R2030Q c.6386ߙ+ߙ1G>A* D186 p.R1108C c.6386ߙ+ߙ1G>AA* D133 p.L510R IVS46ߙ+ߙ1G>A* Cone-rod dystrophy D134 c.4667ߙ+ߙ2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame.
X
ABCA4 p.Thr901Ala 22229821:100:766
status: NEW
PMID: 21721517
[PubMed]
Tsybovsky Y et al: "Posttranslational modifications of the photoreceptor-specific ABC transporter ABCA4."
No.
Sentence
Comment
79
T901A, S1185A, T1313A, and S1317A mutations were introduced by overlap extension polymerase chain reaction using Pfu DNA polymerase and the following mutagenic primers (with introduced mutations shown in bold): T901Af, gagcccctagccgaggaaacg; T901Ar, cgtttcctcggctaggggctc; S1185Af, ctaagggtttcgccac- cacgtgt; S1185Ar, acacgtggtggcgaaacccttag; T1313Af, gctgga- caggccccccaggac; T1313Ar, gtcctggggggcctgtccagc; S1317Af, gacaccccaggacgccaatgtctgc; S1317Ar, gcagacattggcgtcctgggg- tgtc.
X
ABCA4 p.Thr901Ala 21721517:79:0
status: NEW80 T901A was constructed with ABCA4-fwd (aatattgcggccgc- caccatgggcttcgtgagac) and ABCA4-FseI-rev (gccacagggct- caaaaatct) primers and subcloned into the NotI and FseI sites of the ABCA4 construct.
X
ABCA4 p.Thr901Ala 21721517:80:0
status: NEW187 To reveal possible biological roles of ABCA4 phosphorylation, we created ABCA4 constructs with alanine mutations in the most conserved phosphorylation sites, namely, T901A, S1185A, T1313A, and S1317A.
X
ABCA4 p.Thr901Ala 21721517:187:166
status: NEW190 In contrast, replacement of Thr901 with an alanine resulted in a poor expression level along with retention of the protein in the endoplasmic reticulum, indicative of misfolding (Figure 5A,B).
X
ABCA4 p.Thr901Ala 21721517:190:28
status: NEW253 The T901A mutant is poorly expressed, and the level of expression of the S1317A mutant is reduced compared to those of wild-type ABCA4 and the other ABCA4 mutants.
X
ABCA4 p.Thr901Ala 21721517:253:4
status: NEW256 Mutant T901A is retained in the ER.
X
ABCA4 p.Thr901Ala 21721517:256:7
status: NEW287 Reportedly, Ala and Arg mutations in the T901 phosphorylation site are associated with Stargardt disease,50,60 cone-rod dystrophy,61,62 and AMD.63 Retention of the T901A mutant in the endoplasmic reticulum (Figure 5B) as well as its drastically reduced level of expression (Figure 5A) demonstrated in this study suggest that replacement of the threonine at this position leads to misfolding and protein degradation, but it is not yet clear if this is caused by a lack of phosphorylation or replacement of the Thr side chain.
X
ABCA4 p.Thr901Ala 21721517:287:164
status: NEW
PMID: 19028736
[PubMed]
Aguirre-Lamban J et al: "Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants."
No.
Sentence
Comment
80
Clinical science Br J Ophthalmol 2009;93:614-621. doi:10.1136/bjo.2008.145193 Table 1 Clinical findings of the Spanish patients with Stargardt disease (STGD), autosomal recessive cone-rod dystrophy and autosomal recessive retinitis pigmentosa Pedigree Age (years) Age (years) of onset Visual acuity Diagnosis Allele 1 Allele 2 Segregation OD OS Nucleotide changes (exons) Amino acid change Nucleotide changes (exons) Amino acid change ARDM-135 42 24 0.4 0.6 STGD c.5882G.A(42) p.Gly1961Glu c.1029_1030insT(8) p.Asn344fsX NP ARDM-240 15 13 0.2 0.16 STGD c.5882G.A(42) p.Gly1961Glu c.2285C.A(15) p.Ala762Glu Yes ARDM-225 32 25 0.25 0.50 STGD c.5882G.A(42) p.Gly1961Glu c.6559C.T(48) p.Gln2187X Yes ARDM-164 21 11 NA STGD c.3386G.T(23) p.Arg1129Leu c.700C.T(6) p.Gln234X Yes ARDM-162 50 16 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND Yes ARDM-198 27 19 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND NP ARDM-125 31 9 0.3 0.4 STGD c.3211insGT(22) FS p.KNLFA1876dup Yes ARDM-158 24 9 0.2 0.2 STGD c.3211insGT(22) FS c.4537delC(30) p.Gln1513fsX1525 NP ARDM-165 40 30 NA STGD c.3211insGT(22) FS ND ND NP ARDM-167 49 23 0.05 0.05 STGD c.3211insGT(22) FS ND ND NP ARDM-146 32 13 0.06 0.1 STGD c.3056C.T(21) p.Thr1019Met c.6140T.A(44) p.Ile2047Asn Yes ARDM-40 46 9 0.1 0.1 STGD c.3056C.T(21) p.Thr1019Met c.3943C.T(27) p.Gln1315X Yes ARDM-90 26 8 Hand moving STGD c.5929G.A (43) p.Gly1977Ser IVS21-2A.T Yes ARDM-181 57 16 0.1 0.09 STGD c.3323G.A (22) p.Arg1108His IVS38+5G.A Yes ARDM-197 35 15 0.1 0.1 STGD c.4793C.A(34) (false +) p.Ala1598Asp (false +) c.5172G.T(36) p.Trp1724Cys Yes ARDM-183 63 55 0.150 0.175 STGD c.6079C.T(44) p.Leu2027Phe c.5929G.A(43) (false -) p.Gly1977Ser (false -) NP ARDM-38 35 6 0.01 0.02 STGD c.1804C.T(13) p.Arg602Trp c.4739delT(33) p.Leu1580fs Yes ARDM-163 48 32 0.01 0.32 STGD c.4457C.T(30) p.Pro1486Leu ND ND Yes ARDM-166 42 39 NA STGD c.6320G.A(46) p.Arg2107His ND ND Yes ARDM-222 26 23 NA STGD c.2791G.A(19) p.Val931Met ND ND NP ARDM-160 30 5 0.25 0.1 STGD ND ND ND ND Yes ARDM-173 49 7 NA STGD ND ND ND ND Yes ARDM-205 NA NA NA STGD c.4919G.A(35) p.Arg1640Gln ND ND NP ARDM-247 30 12 0.05 0.1 CRD c.3386G.T(23) p.Arg1129Leu c.6410G.A(47) p.Cys2137Tyr Yes ARDM-99 59 46 0.05 0.05 CRD c.4297G.A(29) p.Val1433Ile ND ND NP ARDM-131 27 15 0.9 0.7 CRD c.2701A.G(18) p.Thr901Ala ND ND Yes ARDM-100 28 4 0.2 0.16 CRD ND ND ND ND Yes ARDM-142 30 25 0.8 0.5 CRD ND ND ND ND Yes RP-773 38 20 0.05 0.05 RP c.33N86G.T(23) p.Arg1129Leu ND ND NP RP-959 53 10 0.1 0.1 RP c.466A.G(5) p.Ile156Val ND ND Yes RP-1058 37 6 0.2 0.6 RP c.4297G.A(29) p.Val1433Ile ND ND NP Twenty-seven out of 31 subjects were found to be compound heterozygous for mutations in the ABCA4 gene detected by microarray.
X
ABCA4 p.Thr901Ala 19028736:80:2291
status: NEW
PMID: 17325136
[PubMed]
Valverde D et al: "Spectrum of the ABCA4 gene mutations implicated in severe retinopathies in Spanish patients."
No.
Sentence
Comment
56
TABLE 1. Genetic Analyses of ABCA4 Mutations in Three Families with Autosomal Dominant Macular Dystrophy Family Allele 1 Allele 2 Haplotype AnalysisNucleotide Change Amino Acid Change Nucleotide Change Amino Acid Change ADDM-59 [5582G3A; 6764G3T] [G1961E; S22551] Excluded ADDM-92 466A3G I156V Not done ADDM-105 2828G3A R943Q Not done No change has been detected as allele 2.
X
ABCA4 p.Thr901Ala 17325136:56:901
status: NEW57 TABLE 2. Genetic Analyses of ABCA4 Mutations in 13 arCRD Families Family Allele 1 Allele 2 Haplotype AnalysisNucleotide Change Amino Acid Change Nucleotide Change Amino Acid Change ARDM-79 2888delG Frameshift 2888delG Frameshift Cosegregates ARDM-85 6764G3T S2255I (likely nonpathogenic) Not detected Not done* ARDM-86 2888delG Frameshift 2888delG Frameshift Cosegregates ARDM-99 4297G3A V1433I Not detected Not done* ARDM-126 [2828G3A; 5929G3A] [R943Q; G1977S] [2828G3A; 5929G3A] [R943Q; G1977S] Cosegregates ARDM-133 32T3C L11P 2888delG Frameshift Cosegregates ARDM-134 2828G3A R943Q Excluded ARDM-174 4918C3T R1640W c.6147؉2T3A Splice Cosegregates ARDM-176 2888delG Frameshift 6179T3G L2060R Cosegregates RP-267 5041del 15 pb Frameshift 5041del 15 pb Frameshift Cosegregates RP-577 1140T3A N380K Not detected Not done* SRP-964 2828G3A R943Q Not detected Not done* B210 2828G3A R943Q 2701A3G T901A Not done* The mutation detected by dHPLC is in bold.
X
ABCA4 p.Thr901Ala 17325136:57:900
status: NEW87 TABLE 3. Genetic Analyses of ABCA4 Changes in Nine Families with Autosomal Recessive RP Family Allele 1 Allele 2 Nucleotide Change Amino Acid Change Nucleotide Change Amino Acid Change SRP-716 6764G3T S2255I (likely nonpathogenic) c.858 ؉8T3G SRP-766 2300T3A V767D c.858 ؉8T3G SRP-775 466A3G I156V c.858 ؉8T3G SRP-818 6764G3T S2255I (likely nonpathogenic) SRP-834 c.5547ϩ5G3A Splice acceptor SRP-854 6764G3T S2255I B57 466A3G I156V B173 2828G3A R943Q G5466A L1821L B278 2701A3G T901A [G1961E; S2255I] did not support the pathologic role of this mutation in the family.
X
ABCA4 p.Thr901Ala 17325136:87:502
status: NEW112 The family ARDM 174 presented two mutations, one the missense mutation R1640W detected by the ABCA400 microarray and with an unknown effect in the ABCR function, and the TABLE 4.
X
ABCA4 p.Thr901Ala 17325136:112:76
status: NEW115 The last arCRD family studied also presented two missense mutations, namely T901A and R943Q, the latter described as reducing the ATPase activity in 40% and producing minimal defects in nucleotide binding,22 being categorized as a mild mutation.
X
ABCA4 p.Thr901Ala 17325136:115:76
status: NEW85 TABLE 3. Genetic Analyses of ABCA4 Changes in Nine Families with Autosomal Recessive RP Family Allele 1 Allele 2 Nucleotide Change Amino Acid Change Nucleotide Change Amino Acid Change SRP-716 6764G3T S2255I (likely nonpathogenic) c.858 d19;8T3G SRP-766 2300T3A V767D c.858 d19;8T3G SRP-775 466A3G I156V c.858 d19;8T3G SRP-818 6764G3T S2255I (likely nonpathogenic) SRP-834 c.5547af9;5G3A Splice acceptor SRP-854 6764G3T S2255I B57 466A3G I156V B173 2828G3A R943Q G5466A L1821L B278 2701A3G T901A [G1961E; S2255I] did not support the pathologic role of this mutation in the family.
X
ABCA4 p.Thr901Ala 17325136:85:502
status: NEW
PMID: 12824224
[PubMed]
Schmidt S et al: "Detailed analysis of allelic variation in the ABCA4 gene in age-related maculopathy."
No.
Sentence
Comment
123
Polymorphisms and Rare Sequence Variants in Exons of the ABCA4 Gene Exon Nucleotide Change Effect Allele Frequency* P† P§ Referenceሻ Independent ARM (n ؍ 140) All ARM (n ؍ 330) Control Subjects (n ؍ 118) 6 589G3C Asp197Asn 0.000 0.000 0.009 0.46 0.12 - 6 635G3A Arg212His 0.030 0.026 0.000 0.13 0.11 W, R 10 1268A3G His423Arg 0.394 0.371 0.427 0.62‡ 0.34 W, R 10 1269C3T His423His(syn) 0.033 0.039 0.031 1.0 0.74 W 18 2701A3G Thr901Ala 0.000 0.003 0.000 NA 0.58 W, R 23 3495C3T Asn1165Asn(syn) 0.000 0.003 0.000 NA 0.75 - 30 4469G3A Cys1490Tyr 0.007 0.003 0.000 1.0 0.59 W 37 5206T3C Ser1736Pro 0.009 0.008 0.000 1.0 0.44 W 40 5603T3A Asn1868Ile 0.100 0.102 0.054 0.29 0.18 W 40 5682G3C Leu1894Leu(syn) 0.293 0.272 0.298 1.0 0.64 W 41 5814A3G Leu1938Leu(syn) 0.160 0.169 0.218 0.33 0.38 W 42 5843C3T Pro1948Leu 0.052 0.038 0.054 1.0 0.50 W 42 5844A3G Pro1948Pro(syn) 0.199 0.192 0.205 1.0 0.77 W 44 6069C3T Ile2023Ile(syn) 0.040 0.050 0.044 1.0 0.82 W 44 6079C3T Leu2027Phe 0.000 0.000 0.009 0.48 0.13 W * Actual n (number of chromosomes) varies, as frequencies were calculated relative to nonmissing data only.
X
ABCA4 p.Thr901Ala 12824224:123:518
status: NEW
PMID: 11846518
[PubMed]
Birch DG et al: "Visual function in patients with cone-rod dystrophy (CRD) associated with mutations in the ABCA4(ABCR) gene."
No.
Sentence
Comment
207
In contrast, the ®t of the T ABLE III ABCR mutations in patients with ARRP and CRD hRmP exon # Base variation site Codon variation site # WT with mutation New mutation WT genotype RP CRD 3195 3424 5402 5398 4317 146 3793 2566 4800 4512 5581 4770 3 3 H Jxn 1 3 H Jxn 0 in 53 Yes G/G G/A 3 G161A C054Y 0 in 53 No G/G A/A G/A 6 C618G S206R 0 in 53 No C/C C/G 6 G574A A192T 0 in 53 No G/G G/A 9 C1222T R408stop 0 in 53 No C/C C/T 18 A2701G T901A 0 in 53 No A/A A/G 19 A2894G N965S 0 in 53 No A/A A/G 28 T4169C L1390P 0 in 53 Yes T/T T/C 33 3 H Jxn 2 3 H Jxn 0 in 53 Yes T/T T/C 35 C4926G S1642R 0 in 53 Yes C/C C/G 36 G5115T R1705L 0 in 53 No G/G G/T 36 deletion deletion 0 in 53 Yes no del deln 37 T5206C S1736P 0 in 53 No T/T T/C 42 G5882A G1961E 0 in 53 No G/G A/G 47 G6449A C2150Y 0 in 53 No G/G G/A phototransduction model to the cone a-waves revealed a reduction in gain of approximately 0.5 log unit.
X
ABCA4 p.Thr901Ala 11846518:207:448
status: NEW
PMID: 11726554
[PubMed]
Shroyer NF et al: "Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration."
No.
Sentence
Comment
116
To analyze the function of AMD-associated ABCR mutations, we characterized the effects of seven different missense mutations (D645N, T901A, T1428M, R1517S, I1562T, G1578R and L1970F) on protein expression and ATP binding.
X
ABCA4 p.Thr901Ala 11726554:116:133
status: NEW
No.
Sentence
Comment
102
Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ؍ 182) Control (n ؍ 96) STGD (n ؍ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ؍ 182) Control (n ؍ 96) STGD (n ؍ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution.
X
ABCA4 p.Thr901Ala 11328725:102:2289
status: NEW103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution.
X
ABCA4 p.Thr901Ala 11328725:103:2241
status: NEW
PMID: 10958763
[PubMed]
Rivera A et al: "A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration."
No.
Sentence
Comment
80
Nucleotide alterations occurring in sim- Table 2 ABCA4 Mutations Found in Patients with STGD and AMD and in Controls EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 3: 178GrA A60T 1 0 0 This study 179CrT A60E 1 0 0 This study 194GrA G65E 1 0 0 Fishman et al. (1999) 203CrT P68L 1 0 0 This study 214GrA G72R 1 0 0 This study 296insA Frameshift 2 0 0 This study 5: 454CrT R152X 1 0 0 This study 6: 634CrT R212C 1 0 0 Lewis et al. (1999) 688TrA C230S 1 0 0 This study 730delCT Frameshift 1 0 0 This study 740ArG N247S 1 0 0 This study 768GrT Splice 2 0 0 Maugeri et al. (1999) 8: 983ArT E328V 1a 0 0 This study 1086TrA Y362X 1 0 0 This study 10: 1317GrA W438X 1 0 0 This study 11: 1411GrA E471K 1 0 0 Lewis et al. (1999) 12: 1622TrC L541P 21a 1a 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 1715GrA R572Q 1a 0 0 Lewis et al. (1999) 13: 1819GrA G607R 1 0 0 This study 1903CrA Q635K 2a 0 0 This study 1903CrT Q635X 1 0 0 This study IVS13ϩ1GrA Splice 2 0 0 This study 14: 1957CrT R653C 1 0 0 This study 1988GrA W663X 1 0 0 This study 2041CrT R681X 4 0 0 Maugeri et al. (1999) 15: 2291GrA C764Y 1 0 0 This study 2292delT Frameshift 1a 0 0 This study 2295TrG S765R 1a 0 0 This study 16: 2564GrA W855X 1 0 0 Nasonkin et al. (1998) 17: 2588GrC Spliceb 17a 6 5 Allikmets et al. (1997a), Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999), Papaioannou et al. (2000) 18: 2701ArG T901A 0 2 0 This study 2741ArG H914A 0 0 1 This study 19: 2876CrT T959I 1 0 0 This study 20: IVS20ϩ5GrA Splice 1 0 0 This study 21: 3106GrA E1036K 1a 0 0 Nasonkin et al. (1998) 3113CrT A1038V 26a 4a 1 Allikmets et al. (1997a), Cremers et al. (1998), Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) T3187TrC S1063P 1 0 0 This study (Continued) 805 Table 2 Continued EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 22: 3292CrT R1097C 1 0 0 This study 3322CrT R1108C 4 0 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999) 24: 3528insTGCA Frameshift 1 0 0 This study 25: 3808GrT E1270X 1 0 0 This study 27: 3898CrT R1300X 1 0 0 This study 28: IVS28ϩ5GrA Splice 1 0 0 This study 4139CrT P1380L 1 0 0 Lewis et al. (1999) 4195GrA E1399K 2 0 0 This study 4234CrT Q1412X 4 0 0 Maugeri et al. (1999) 29: 4289TrC L1430P 2 0 0 This study 4318TrG F1440V 1 0 0 This study 4328GrA R1443H 1 0 0 This study 30: 4457CrT P1486L 1 0 0 Lewis et al. (1999) 4463GrA C1488Y 1 0 0 This study 31: 4610CrT T1537M 1 0 0 This study 35: IVS35ϩ2TrA Splice 1 0 0 This study 36: 5065TrC S1689P 1 0 0 This study 5114GrT R1705L 1 0 0 This study IVS36ϩ1GrA Splice 1 0 0 This study 37: 5198TrC M1733T 0 0 1 This study 5242GrA G1748R 1 0 0 This study 5248CrT Q1750X 1 0 0 This study 5288TrC L1763P 1 0 0 This study 38: IVS38ϩ1GrA Splice 1 0 0 This study 40: 5653GrA E1885K 1 0 0 This study 5693GrA R1898H 5 2 1 Allikmets et al. (1997b), Lewis et al. (1999) IVS40ϩ5GrA Splice 8a 0 0 Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999) 42: 5882GrA G1961E 34 4 2 Allikmets et al. (1997b), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 43: 5917delG Frameshift 3 0 0 This study 5923GrC G1975R 1 0 0 This study 5929GrA G1977S 1 0 0 Rozet et al. (1998), Lewis et al. (1999) 45: 6229CrG R2077G 1 0 0 This study 6229CrT R2077W 1 0 0 Allikmets et al. (1997a), Fishman et al. (1999), Lewis et al. (1999) 48: 6609CrA Y2203X 2 0 0 This study 6647GrT A2216V 0 0 1 This study a Mutation pairs occurring on a single haplotype.
X
ABCA4 p.Thr901Ala 10958763:80:1482
status: NEW
PMID: 10442900
[PubMed]
De La Paz MA et al: "Analysis of the Stargardt disease gene (ABCR) in age-related macular degeneration."
No.
Sentence
Comment
97
A second polymorphism, T901A, was identified in five affected patients within two AMD families (Fig 2) and in one member of the randomly selected population.
X
ABCA4 p.Thr901Ala 10442900:97:23
status: NEW99 The other familial T901A variant appeared in one affected member of a family of two affected cousins (one with grade 5 AMD demonstrated the variant; another with grade 3 AMD did not).
X
ABCA4 p.Thr901Ala 10442900:99:19
status: NEW116 One of these, T901A, is of greatest interest because it was found among all the affected members of one of our larger AMD families.
X
ABCA4 p.Thr901Ala 10442900:116:14
status: NEW124 Pedigrees showing polymorphism T901A.
X
ABCA4 p.Thr901Ala 10442900:124:31
status: NEW131 of Controls (%) P862L 2682 C 3 T 2683 C 3 T 3/112 (3.6) 3/53 (3.8) 0/56 (0) T901A 2782 A 3 G 2/112 (1.8) 0/53 (0) 1/56 (1.8) N1868I 5684 A 3 T 3/112 (2.7) 4/53 (7.5) 4/56 (7.1) L1948P* 5924 T 3 C 112/112 (100) 53/53 (100) 56/56 (100) L1948P* 5924 T 3 C 5925 G 3 A 110/112 (98) 51/53 (96) 54/56 (96) I2023I 6150 C 3 T 9/112 (8) 5/53 (9.4) 3/56 (5.4) L2026L 6160 C 3 T 0/112 (0) 0/53 (0) 0/56 (0) I2083I 6330 C 3 T 9/112 (8) 4/53 (7.5) 5/56 (8.9) * Variants identified in probands only.
X
ABCA4 p.Thr901Ala 10442900:131:76
status: NEW
PMID: 9843201
[PubMed]
Stone EM et al: "Allelic variation in ABCR associated with Stargardt disease but not age-related macular degeneration."
No.
Sentence
Comment
77
In our experiment, we screened all the study participants equally and we did observe 2 variants (Pro1314Thr and Thr901Ala) that were each present in only a single control subject.
X
ABCA4 p.Thr901Ala 9843201:77:112
status: NEW
PMID: 23953153
[PubMed]
Fujinami K et al: "Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function."
No.
Sentence
Comment
141
Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3.
X
ABCA4 p.Thr901Ala 23953153:141:982
status: NEW
PMID: 23982839
[PubMed]
Fujinami K et al: "ABCA4 gene screening by next-generation sequencing in a British cohort."
No.
Sentence
Comment
56
40 c.4926C>G p.S1642R DC c.5041_5055del GTGGTTGCCATCTGC p.V1681_C1685del DC 2 41 c.4956T>G p.Y1652* DC 1 42 c.5018&#fe;2T>C Splice site DC 1 43 c.5461-10T>C DC c.6385A>G p.S2129G PDC 2 44 c.5461-10T>C DC 1 45 c.5461-10T>C DC 1 46 c.5461-10T>C DC 1 47 c.5461-10T>C DC 1 48 c.5461-10T>C DC 1 49 c.5461-10T>C DC 1 50 c.5461-10T>C DC 1 51 c.5585-1G>A Splice site DC 1 52 c.5714&#fe;5G>A Splice site DC c.6209C>G p.T2070R DC 2 53 c.5882G>A p.G1961E DC c.2686A>G p.K896E B 1 54 c.5882G>A p.G1961E DC c.3050&#fe;1G>C Splice site DC 2 55 c.5882G>A p.G1961E DC c.3392delC/3393C>G p.A1131Gfs DC 2 56 c.5882G>A p.G1961E DC c.4539&#fe;2T>G Splice site DC 2 57 c.5882G>A p.G1961E DC c.4552A>C p.S1518R DC 2 58 c.5882G>A p.G1961E DC c.5899-2delA Splice site DC 2 59 c.5882G>A p.G1961E DC 1 60 c.6079C>T p.L2027F DC c.1906C>T p.Q636* DC 2 61 c.6079C>T p.L2027F DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 62 c.6079C>T p.L2027F DC c.3370G>T p.D1124Y DC 2 63 c.6079C>T p.L2027F DC 1 64 c.6089G>A p.R2030Q DC c.4326C>A p.N1442K DC 2 65 c.6445C>T p.R2149* DC 1 66 c.6709A>C p.T2237P DC c.5899-3_5899-2delTA Splice site DC 2 67 c.2971G>C p.G991R B c.4538A>G p.Q1513R DC 1 68 c.3602T>G p.L1201R B c.1749G>C p.K583N DC 1 69 c.3602T>G p.L1201R B c.1982_1983insG p.A662fs DC 1 70 c.3602T>G p.L1201R B c.2972G>T p.G991V DC 1 71 c.4685T>C p.I1562T B c.3289A>T p.R1097* DC 1 72 c.6320G>A p.R2107H B c.2510T>C p.L837P DC 1 73 c.6320G>A p.R2107H B c.4352&#fe;1G>A Splice site DC 1 74 c.2701A>G p.T901A B 0 75 c.3602T>G p.L1201R B 0 76 c.4283C>T p.T1428M B 0 77 c.466A>G p.I156V B 0 78 c.466A>G p.I156V B 0 79 c.4715C>T p.T1572M B 0 Putative novel variants are shown in italics.
X
ABCA4 p.Thr901Ala 23982839:56:1494
status: NEW62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred.
X
ABCA4 p.Thr901Ala 23982839:62:1424
status: NEW