ABCMdb

ABCC2 p.Ser789Phe

None has been submitted yet.

Publications

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

859 Other non-synonymous variants such as 2302C>T (A768W) and 2366C>T (S789F) in exon 18, as well as 4348G>A (A1450T) in exon 31, were found with a frequency of about only 1%. Login to comment
867 Whereas the transport activity of the wild-type, V417I, and A1450T were similar towards the substrates LTC4, 17β estradiol-D-17β-glucuronide (E217βG), and dinitrophenyl-labeled surfactant protein C (DNP-SP), the transport activity of S789F was slightly higher. Login to comment
882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press). Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment
147 For example, Hirouchi et al. (2004) found lower MRP2 expression and impaired membrane localization in cells transfected with the ABCC2 variants 2366C>T (Ser789Phe) and 4348G>A (Ala1450Thr), whereas in vivo, Ser789Phe was not associated with changes in plasma conjugated bilirubin levels (Ieiri et al., 2004). Login to comment

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."

No. Sentence Comment

36 Hirouchi and colleagues evaluated the cellular location and function of ABCC2 Val417Ile (1249G>A), Arg768Trp (2302C>T), Ser789Phe (2366C>T), and Ala1450Thr (4348G>A) variants in LLC-PK1 cells, finding that Ser789Phe and Ala1450Thr mutations caused less expression and mislocation [51]. Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96). Login to comment

PMID: 16006996 [PubMed] Conseil G et al: "Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters."

No. Sentence Comment

162 Two other missense variants that affect conserved residues in the NBDs of MRP2 are Ser789Phe (exon 18 C2366T) and Ala1450Thr (exon 31 G4348A) [30,31]. Login to comment

PMID: 12357145 [PubMed] Lotsch J et al: "Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity?"

No. Sentence Comment

106 33 T/T T/T MDR1 2 A61G Asn21Asp 11.2 20.6 9 A/G A/G Forward: 5Ј-AGG AGC AAA GAA GAA GAA CTT TTT TAA ACT GAT C-3Ј 9.3 17.6 8 Reverse: 5Ј-GAT TCC AAA GGC TAG CTT GC-3Ј 5 T307C Phe103Leu 0.6 1.2 9 T/T T/T Forward: 5Ј-GTG GTT GCA CAC AGT CAG CA-3Ј Reverse: 5Ј-GGA GGA TGT CTA ATT ACC TGG TCA-3Ј 11 G1199A Ser400Asn 5.5 11.1 9 G/G G/G Forward: 5Ј-CAG CTA TTC GAA GAG TGG GC-3Ј 6.5 12.9 8 Reverse: 5Ј-CCG TGA GAA AAA AAC TTC AAG G-3Ј 21 G2677T Ala893Ser 41.6 49.2 9 T/T T/T Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј 63.9 43.4 8 Reverse: 5Ј-GTT TGA CTC ACC TTC CCA G-3Ј 21 G2677A Ala893Thr 0.9 2 9 NA NA Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј Reverse: 5Ј-TTT AGT TTG ACT CAC CTT CCC G-3Ј 26 A3320C Gln1107Pro 0.2 0.4 9 A/A A/A 26 C3396T Ala1132Ala 0.3 0.5 8 C/C C/C Forward: 5Ј-ATC TGT GAA CTC TTG TTT TCA GC-3Ј 26 C3435T Ile1145Ile 50.3 47.7 8 T/T T/T Reverse: 5Ј-TCG ATG AAG GCA TGT ATG TTG-3Ј 53.9 50.5 9 - - MRP2 10 G1249A Val417Ile 12.5 20.8 34 G/G G/G Forward: 5Ј-GGG TCC TAA TTT CAA TCC TTA-3Ј Reverse: 5Ј-TAT TCT TCT GGG TGA CTT TTT-3Ј 18 C2302T Arg768Trp 1 2.1 34 C/C C/C Forward: 5Ј-GGA GTA GTG CTT AAT ATG AAT-3Ј 18 C2366T Ser789Phe 1 2.1 34 C/C C/C Reverse: 5Ј-CCC ACC CCA CCT TTA TAT CTT-3Ј 28 C3972T Ile132Ile 21.9 35.4 34 C/T C/T Forward: 5Ј-TGC TAC CCT TCT CCT GTT CTA-3Ј Reverse: 5Ј-ATC CAG GCC TTC CTT CAC TCC-3Ј 31 G4348A Ala1450Thr 1 2.1 34 G/G G/G Forward: 5Ј-AGG AGC TAA CAC ATG GTT GCT-3Ј Reverse: 5Ј-GGG TTA AGC CAT CCG TGT CAA-3Ј † Sequence is not translated. Login to comment

PMID: 16788565 [PubMed] Haenisch S et al: "Influence of polymorphisms of ABCB1 and ABCC2 on mRNA and protein expression in normal and cancerous kidney cortex."

No. Sentence Comment

139 The earlier described ABCC2 SNPs, namely 2302C4T (Arg768Trp), 2366C4T (Ser789Phe) and 4348G4A (Ala1450Thr),43 could not be found in our Caucasian volunteers (data not shown). Login to comment

PMID: 21619426 [PubMed] Stieger B et al: "Pharmacogenetics of drug transporters in the enterohepatic circulation."

No. Sentence Comment

97 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal efflux transporters (cont.) ABCC2 MRP2 c.1249G>A p.V417I N/A Unchanged [221] c.1249G>A p.S789F N/A Reduced transport protein expression, no change in transport activity [221] c.1249G>A p.A1450T N/A Reduced transport protein expression, no change in transport activity [221] ABCC3 MRP3 c.32G>A p.G11D N/A Unchanged [222] c.1037C>T p.S346F N/A Reduced transport activity [222] c.1820G>A p.S607N N/A Reduced transport activity [222] c.2293G>C p.V765L N/A Unchanged [222] c.2758C>T p.P920S N/A Unchanged [222] c.2768G>A p.R923Q N/A Increased transport activity [222] c.3856G>C p.R1286G N/A Unchanged [222] c.3890G>A p.R1297H 52 Unchanged [131] c.4042C>T p.R1348C N/A Increased transport activity [222] c.4094A>G p.Q1365R N/A Unchanged [222] c.4141C>A p.R1381S N/A Unchanged [222] Liver uptake transporters SLCO1B1 OATP1B1 c.218T>C p.F73L N/A Increased Km , reduced protein synthesis and membrane expression [143] c.245T>C p.V82A N/A [143] c.388A>G p.N130D N/A Increased Km [143] c.455G>A p.R152K N/A [143] c.463C>A p.P155T N/A Unchanged [143] c.467A>G p.E156G N/A [143] c.521T>C p.V174A N/A Decreased Vmax , reduced transport protein expression [143] c.721G>A p.D241N N/A [143] c.1058T>C p.I353T N/A Increased Km , reduced transport protein expression [143] c.1294A>G p.N432D N/A Decreased Vmax [143] c.1385A>G p.D462G N/A Decreased Vmax [143] c.1463G>C p.G488A N/A Reduced intrinsic clearance, reduced transport protein expression [143] c.1964A>G p.D655G N/A Increased Km [143] c.2000A>G p.E667G N/A Unchanged [143] SLCO1B3 OATP1B3 c.334T>G p.S112A N/A Unchanged [223,224] c.439A>G p.T147A N/A Unchanged [223] c.699G>A p.M233I N/A Reduced transport activity, substrate-dependent alteration of Km [223,224] c.767G>C p.G256A N/A Unchanged [223] c.1559A>G p.H520P N/A Reduced transport activity [223] c.1564G>T p.G522C N/A Reduced transport activity [224] c.1679T>C p.V560A N/A Reduced transport activity [223] SLCO2B1 OATP2B1 c.43C>T p.P15S N/A Reduced transport activity [149] c.601G>A p.V201M N/A Reduced transport activity [149] c.1175C>T p.T392I N/A Reduced Vmax [148] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

PMID: 21996082 [PubMed] Shuker N et al: "ATP-binding cassette transporters as pharmacogenetic biomarkers for kidney transplantation."

No. Sentence Comment

870 Several other ABCC2 SNPs such as 2302CNT (Arg768Trp), 2366CNT (Ser789Phe; both in exon 18), and the 4348GNA (Ala1450Th; in exon 31) were not found in this population whereas their allele frequency in an Asian population was about 1% [8,48,49]. Login to comment

PMID: 22955427 [PubMed] Nishijima T et al: "Single Nucleotide Polymorphisms in ABCC2 Associate With Tenofovir-Induced Kidney Tubular Dysfunction in Japanese Patients With HIV-1 Infection: A Pharmacogenetic Study."

No. Sentence Comment

60 The 14 SNPs selected were (1) ABCC2 (encodes MRP2) -24C → T (in the promoter; rs717620); 1249G → A (Val417Ile; rs2273697); 2366C → T (Ser789Phe; rs56220353); 2934G → A (Ser978Ser; rs3740070), (2) ABCC4 (encodes MRP4) 559G → T (Gly187Trp; rs11568658); 912G → T (Lys304Asn; rs2274407); 2269G → A (Glu757Lys; rs3765534); 3348A → G (Lys1116Lys; rs1751034); 4135T → G [in the 3' untranslated region (UTR); (rs3742106)]; 4976T → C (3' UTR; rs1059751), (3) ABCC10 (encodes MRP10) 526G → A (intron; rs9349256); 2759T → C (Ile920Thr; rs2125739), (4) SLC22A6 (encodes OAT1) 180C → T (Asn60Asn; rs11568630), and (5) ABCB1 (encodes P-glycoprotein) 2677T → A/G (A:Ser893Thr, G:Ser893Ala; rs2032582). Login to comment
84 Genotype Frequencies at ABCC2, ABCC4, ABCC10, SLC22A6, and ABCB1 in Patients With and Without Kidney Tubular Dysfunction Genotype Amino Acid Patients With KTD (n = 19) Patients With Normal Tubular Function (n = 171) P Valuea ABCC2 (MRP2) -24 C → T, rs717620 C/C 18 (94.7) 108 (63.2) C/T 1 (5.3) 52 (30.4) .018 T/T 0 (0) 11 (6.4) 1249 G → A, rs2273697 Val417Ile G/G 11 (57.9) 133 (77.8) A/G 5 (26.3) 34 (19.9) .017 A/A 3 (15.8) 4 (2.3) 2366 C → T, rs56220353 Ser789Phe C/C 19 (100) 167 (97.7) C/T 0 (0) 3 (1.8) 1.000 T/T 0 (0) 1 (0.6) 2934 G → A, rs3740070 Ser978Ser G/G 18 (94.7) 159 (93.0) G/A 1 (5.3) 11 (6.4) 1.000 A/A 0 (0) 1 (0.6) ABCC4 (MRP4) 559 G → T, rs11568658 Gly187Trp G/G 13 (68.4) 133 (77.8) G/T 4 (21.1) 34 (19.9) .126 T/T 2 (10.5) 4 (2.3) 912G → T, rs2274407 G/G 13 (68.4) 102 (59.6) T/G 6 (31.6) 52 (30.4) .461 T/T 0 (0) 17 (9.9) 2269 G → A, rs3765534 Glu757Lys G/G 15 (78.9) 129 (75.4) G/A 2 (10.5) 35 (20.5) .241 A/A 2 (10.5) 7 (4.1) 3348 A → G, rs1751034 Lys1116Lys A/A 13 (68.4) 98 (57.3) A/G 3 (15.8) 58 (33.9) .185 G/G 3 (15.8) 15 (8.8) 4135 T → G, rs3742106 T/T 6 (31.6) 46 (26.9) T/G 7 (36.8) 79 (46.2) .707 G/G 6 (31.6) 46 (26.9) 4976T → C, rs1059751 T/T 6 (31.6) 46 (26.9) T/C 5 (26.3) 86 (50.3) .090 C/C 8 (42.1) 39 (22.8) ABCC10 (MRP7) 526G → A, rs9349256 G/G 4 (21.1) 32 (18.7) A/G 9 (47.4) 65 (38) .569 A/A 6 (31.6) 74 (43.3) Table 2 summarizes the distribution of genotypes at the ABCC2, ABCC4, ABCC10, SLC22A11, and ABCB1 genes in the 2 groups. Login to comment

PMID: 21691255 [PubMed] Megaraj V et al: "Functional analysis of nonsynonymous single nucleotide polymorphisms of multidrug resistance-associated protein 2 (ABCC2)."

No. Sentence Comment

2 Objectives To characterize the transport function of human wild-type (WT) MRP2 and four SNP variants, S789F, A1450T, V417I, and T1477M. Login to comment
6 Results The Vmax for transport activity was decreased for all substrates for S789F, and for all substrates except E217G for A1450T. Login to comment
8 Examination of substrate-stimulated MRP2-dependent ATPase activity of S789F and A1450T, SNPs located in MRP2 nucleotide-binding domains (NBDs), demonstrated significantly decreased ATPase activity and only modestly decreased affinity for ATP compared with WT. Login to comment
9 Conclusion SNPs in the NBDs (S789F in the D-loop of NBD1, or A1450T near the ABC signature motif of NBD2) variably decreased the transport of all substrates. Login to comment
48 Construction of recombinant baculovirus containing multidrug resistance protein 2 The plasmid (pEF6/V5-His-TOPO; Invitrogen) containing the WT MRP2 (NM_000392) or its SNP variants S789F, A1450T, V417I, and T1477M, was used to create the MRP2 baculovirus expression vector. Login to comment
49 The pENTR 4 vector (Invitrogen) was mutated to generate a Hind III site using Quik Change II site-directed mutagenesis Kit (Stratagene; La Jolla, California, USA) using primers Hind IIIF and Hind IIIR (Hind IIIF: AGGCTCCAC- CATGGGAAGCTTCAGTCGACTGGATC; Hind IIIR: Table 1 Nucleotide sequence of variants in MRP2 leading to amino acid changes in multidrug resistance-associated protein 2 and their allelic frequencya SNP position Amino acid change Exon Location Allelic frequency Functional consequencesb C2366T S789F 18 NBD1 (D loop) 0.01 (Japanese) 52 G4348A A1450T 31 NBD2 (immediately after the ABC signature motif) 0.01 (Japanese) 52 G1249A V417I 10 MSD1 (between transmembrane helices 7 and 8) 0.125/0.312/0.184 (Japanese/Iranian/Moroccan) 27,46,47,52,58,59 C4430T T1477M 31 Carboxy terminal 0.006 (Japanese) MSD, membrane-spanning domain; NBD, nucleotide-binding domain; SNP, single nucleotide polymorphism. Login to comment
56 The pENTR4M containing the WT, S789F, A1450T, V417I, and T1477M SNPs were sequenced (MWG Biotech, Inc., Huntsville, Alabama, USA). Login to comment
86 Membrane ATPase measurements ATPase activity of WT, S789F, and A1450Twas measured as the level of sodium vanadate-sensitive release of inorganic phosphate from ATP [27]. Login to comment
94 Although the SNPs, S789F and A1405T, are reported to have low allelic frequencies, they were of interest for inclusion in this study due to their predicted functional relevance when analyzed using the Polyphen Database [5], likely due to their location in the catalytic NBD domains of MRP2. Login to comment
97 Protein expression of wild-type multidrug resistance-associated protein 2 and single nucleotide polymorphism variants in Sf9 cells WT MRP2 and the SNP variants S789F, A1450T, V417I, and T1477M were expressed in Sf9 cells using recombinant baculovirus. Login to comment
101 Statistical analysis of triplicate experiments showed that MRP2 expression was significantly reduced approximately 40% for S789F and T1477M variants, located in NBD1 and carboxy terminal region, respectively. Login to comment
108 LTC4 and E23G were transported with classic Michaelis-Menten kinetics by WT MRP2; however, E217G and TUDC demonstrated positive Fig. 1 8000 6000 4000 Density(%)INT/mm2 2000 0 T1477M * V417IA1450TS789F * WTEV 185 KD EV WT S789F A1450T V417I T1477M (a) (b) Expression of WT multidrug resistance-associated protein 2 (MRP2) and its variants in Sf9 plasma membranes. Login to comment
119 The S789F variant located in the D-loop of NBD1 showed markedly reduced transport capacity of all substrates tested compared with WT; Vmax values were decreased by 40-60% relative to WT MRP2 (Fig. 2a-d; Table 2). Login to comment
120 The apparent affinity for substrates LTC4, E217G, and TUDC were unchanged, however, the Km for E23G was increased two-fold compared with WT MRP2 for the S789F SNP (Fig. 2b; Table 2). Login to comment
126 Substrate-stimulated ATPase activity of multidrug resistance-associated protein 2 and single nucleotide polymorphism variants To identify the mechanism of reduced transport activity of the SNP variants, S789F and A1450T, located in the ATP-binding domains, we determined their vanadate-sensitive ATPase activity in the presence of E217G (300 mmol/l). Login to comment
127 Isolated plasma membrane preparations of Sf9 cells expressing WT MRP2 showed a high capacity, drug-stimulated ATPase activity (Fig. 3a), as reported Fig. 2 2000 (a) (b) (c) (d) 1000 ATP-dependent3 H-LTC4 transport(pmol/min/mg) 0 0 5 10 LTC4 (μmol/l) 15 20 4000 1000 2000 3000 ATP-dependent3 H-E217G transport(pmol/min/mg) 0 0 100 200 E217G (μmol/l) 300 200 400 600 ATP-dependent3H-TUDC transport(pmol/min/mg) 0 0 100 200 TUDC (μmol/l) 300 2000 1000 ATP-dependent3 H-E23G transport(pmol/min/mg) 0 0 250 500 E23G (μmol/l) 750 1000 WT S789F V417I T1477MA1450T ATP-dependent transport of wild-type (WT) and multidrug resistance-associated protein 2 single nucleotide polymorphism variants in Sf9 plasma membrane vesicles. Login to comment
131 S789F and A1450T exhibited vanadate-sensitive ATPase activity that was stimulated by E217G, however, the ATPase activity of S789F and A1450T was significantly decreased by 37 and 20%, respectively, compared with WT MRP2 (Fig. 3a). Login to comment
132 To determine whether the maximal rates of ATP hydrolysis or affinity for the nucleotide were altered by the mutation seen in SNP variants S789F and A1450T, we compared their Km for ATP with that of WT MRP2 (Fig. 3b; Table 3). Login to comment
133 Vesicular transport studies over a wide range of concentrations of ATP and a fixed E217G concentration (300 mmol/l) showed that the apparent Km values for ATP were increased modestly but not significantly in both S789F (125 mmol/l) and A1450T (101 mmol/l), compared with WT MRP2 (79 mmol/l) (Fig. 3b; Table 3). Login to comment
136 Four SNPs were selected for characterization, one in each of the two NBDs (S789F in NBD1 and A1450T in NBD2), one in MSD1 (V417I), and one in the carboxy terminal (T1477M), to probe how changes in these portions of MRP2 protein might impact its transport properties. Login to comment
138 The MRP2 variant S789F, located in the D-loop of NBD1, consistently decreased the Vmax for transport of all four substrates, whereas A1450T, located immediately after the ABC signature motif in NBD2, decreased the Vmax for all substrates except E217G. Login to comment
145 We, therefore, questioned whether S789F, most likely located in NBS2, and A1450T, likely located in NBS1, might have differential effects on ATP binding and hydrolysis. Login to comment
146 ATPase activity was significantly inhibited in both S789F and A1450T (Fig. 3a); whereas inhibition of ATPase activity was greater for S789F (37%) than A1450T (20%), the data did not permit unequivocal determination of the differential roles of NBS1 and NBS2 in ATP hydrolysis. Login to comment
148 These data imply that irrespective of their locations in NBS1 or NBS2, neither variant S789F nor A1450T is directly involved in ATP binding, but rather both variants impact transport by decreasing ATP hydrolysis. Login to comment
150 These data imply that valine 417 plays a critical and selective role in binding of glutathione Table 2 Kinetic parameters for transport of substrates by wild-type multidrug resistance-associated protein 2 and four single nucleotide polymorphism variants Substrates Kinetic parameters WT S789F A1450T V417I T1477M LTC4 Km 4 (1.8-6.5) 3 (1.8-4.4) 3 (2-3.6) 9 (7.8-12.7)* 6 (3.5-9) Vmax 1464 (1314-1713) 732 (648-816)* 658 (618-699)* 1366 (1200-1531) 1659 (1373-1945) E23G Km 103 (73-133) 235 (173-296)* 106 (64-148) 212 (95-330) 172 (88-230) Vmax 1458 (1339-1578) 615 (558-671)* 855 (746-964)* 1794 (1454-2134) 1157 (975-1338)* E217bG Km 84 (64-104) 72 (67-76) 88 (75-100) 263 (241-285)* 94 (89-100) Vmax 3154 (2691-3617) 1799 (1732-1866)* 2665 (2422-2907) 2647 (2520-2773) 2646 (2555-2737) HC 2.2 (1.4-3) 2.4 (2.1-2.6) 2 (1.6-2.4) 1.1 (1.1-1.2)* 1.8 (1.7-1.9) TUDC Km 71 (65-78) 64 (71-96) 71 (57-86) 74 (70-79) 109 (103-116)* Vmax 595 (563-627) 359 (343-376)* 424 (376-472)* 577 (553-600) 671 (645-699)* HC 2 (1.7-2.3) 2.3 (1.9-2.6) 1.8 (1.3-2.3) 2.6 (2.3-2.8) 2.2 (2-2.4) The kinetic parameters [Km (mmol/l); Vmax (pmol/mg/min); HC] of ATP-dependent transport of LTC4, E23G, E217G, and TUDC were determined in Sf9 plasma membrane vesicles. Login to comment
169 To ensure that the reduced expression was not antibody-dependent, we performed immunoblots using two antibodies, M2 Fig. 3 25(a) (b) 20 15 VanadatesensitiveATPaseactivity3 H-E217Gtransport(pmol/min/mg) 10 5 0 A1450TS789FWTEV 3000 2000 1000 0 7500500025000 ** ** * ATP (μmol/l) WT S789FA1450T (a) ATPase activity of Sf9 membranes expressing wild-type (WT) multidrug resistance-associated protein 2 (MRP2) and the single nucleotide polymorphism (SNP) variants S789F and A1450T. Login to comment
174 Transport in the Sf9 membrane vesicles expressing WT, or variants S789F and A1450T was measured in the presence of various concentrations of ATP ranging from 50 mmol/l to 7 mmol/l at a fixed concentration of [3 H]E217G (300 mmol/l) for 2 min at 371C. Login to comment
177 Table 3 Kinetic parameters for ATP in wild-type multidrug resistance-associated protein 2 and variants S789F and A1450T Kinetic parameters WT S789F A1450T Km 79 (43-114) 125 (96-155) 101 (57-146) Vmax 2630 (2433-2927) 1796 (1721-1870)* 2242 (2071-2413)* Nonlinear regression results [Km, (mmol/l); Vmax (pmol/mg/min)] were obtained from data in Fig. 3b. Login to comment
183 Expression of S789F (located in NBD1) was decreased to 59% of that of WT MRP2; a nearby but different mutation in NBD1 (R768W) of MRP2 was shown to be localized in the cytoplasm with an endoplasmic reticulum-like distribution [50]. Login to comment
189 From our studies, the data suggest that individuals with S789F and T1477M polymorphisms may have a lower expression level of MRP2 protein in the apical membrane of cells, and consequently, a reduced ability to export substrates. Login to comment
190 Hirouchi et al. [52] also characterized the expression and transport activity of several MRP2 variants (V417I, S789F, A1450T) using a Tet-off recombinant adenovirus system in LLC-PK1 cells. Login to comment
191 However, these researchers did not detect any change in transport of E217G, LTC4, or 2,4-dinitrophenyl-S-glutathione by SNP V417I after normalization for expression levels, and further found that transport of these substrates was increased by S789F. Login to comment
193 Further analysis of the kinetic parameters showed that the Vmax for transport of 2,4-dinitrophenyl-S-glutathione by S789F was 1.3-fold greater than that of WT MRP2. Login to comment
194 Finally, these researchers also showed a marked reduction in the expression of both S789F and A1450T to 24 and 18% of WT MRP2, respectively, such that transport of E217G by A1450T was too low to be normalized by its expression level [52]. Login to comment
200 Even though the SNPs, S789F and A1450T, exist with low allelic frequency, the decreased expression and transport function of S789F and decreased transport activity of A1450T shown here could impact drug disposition in polymorphic individuals. Login to comment
201 Most likely because of the relative rarity of these SNPs, there are no reports of an association between S789F or A1450T and altered pharmacokinetics of MRP2 substrates. Login to comment

PMID: 20082599 [PubMed] Jemnitz K et al: "ABCC2/Abcc2: a multispecific transporter with dominant excretory functions."

No. Sentence Comment

97 Mutant Predicted location Substrate Activity changes Reference Human MRP2 Δ1-188 TMD0 LTC4 ↓ Fernandez et al., 2002 K316A JC, TM6 GMF ↔ Ryu et al., 2000 K324A TM6 GMF ↓ Ryu et al., 2000 K329A TM6 GMF ↔ Ryu et al., 2000 R412G DJ IC MTX ↓ Hulot et al., 2005 W417I IC, TM7-TM8 E2-17βG ↓ Hirouchi et al., 2004 LTC4 ↓ DNP-SG ↓ H439A TM8 GMF ↔ Ryu et al., 2000 K483A IC, JM, TM9 GMF ↓ Ryu et al., 2000 K590A JC, TM11 GMF ↔ Ryu et al., 2000 S789F NBD1 E2-17βG ↓ Hirouchi et al., 2004 LTC4 ↓ DNP-SG ↓↓ R1023A EC, JM, TM13 GMF ↔ Ryu et al., 2000 H1042A TM13 GMF ↔ Ryu et al., 2000 R1100A JC, TM14 GMF ↔ Ryu et al., 2000 P1158A IC, JM, TM15 LTC4 ↓↓ Letourneau et al., 2007 E2-17βG ↔ MTX ↔ Table 1. continued on next page Mutant Predicted location Substrate Activity changes Reference I1173F DJ IC, TM15-16 LTC4 No act Keitel et al., 2003 E2-17βG No act R1210A EC, JC, TM16 GMF ↓↓ Ryu et al., 2000 R1230A TM16 GMF ↔ R1257A JC, TM17 GMF ↓↓ W1254A JC, TM17 E2-17βG ↓↓ Ito et al., 2001a W1254C ↓↓ W1254F ↔ W1254Y ↔ W1254A JC, TM17 LTC4 ↓↓ Ito et al., 2001b W1254C ↓↓↓ W1254F ↓↓ W1254Y ↓↓ W1254A JC, TM17 MTX ↓↓ Ito et al., 2001a W1254C ↓↓ W1254F ↓↓ W1254Y ↓↓↓ A1450T NBD2 E2-17βG ↓↓ Hirouchi et al., 2004 LTC4 ↓↓ DNP-SG ↓↓ Rat Mrp2 K308M IC, JM, TM6 TLC-S ↔ Ito et al., 2001b DNP-G ↑ LTC4 ↓ E3040G ↔ K320M TM6 TLC-S ↑ DNP-G ↑ LTC4 ↓ E3040G ↑ K325M TM6 TLC-S ↓* DNP-G ↓↓↓* LTC4 ↓↓↓* E3040G ↓ D329N TM6 TLC-S ↔ DNP-G ↓ LTC4 ↓↓↓* E3040G ↓ R586L TM11 TLC-S ↓ DNP-G ↓↓* LTC4 ↓↓* E3040G ↔ R1019M IC, JM, TM13 TLC-S ↔ DNP-G ↑* LTC4 ↔ E3040G ↔ R1096L TM14 TLC-S ↑ DNP-G ↑ LTC4 ↔ E3040G ↔ EC, extracellular; IC, intracellular; JC, near the cytosol in the membrane; JM, juxtamembrane; TLC-S, tauro-litocholate-sulfate; GMF, glutathione- methyl-fluorescein; ↑, activity over control>1.2; ↔, 1.2>activity over control>0.8; ↓, 0.8>activity over control>0.5; ↓↓, 0.5>activity over control>0.1; ↓↓↓, 0.1>activity over control. Login to comment

PMID: 18334920 [PubMed] Haenisch S et al: "Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol."

No. Sentence Comment

38 Genotyping The ABCC2 SNPs -24C > T (rs717620), c.1249G > A (V417I, rs2273697), c.2302C > T (Arg768Trp), c.2366C > T (Ser789Phe), c.3972C > T (I1324I, rs3740066), c.4348G > A (Ala1450Thr) were genotyped using PCR-restriction fragment length polymorphism (RFLP) analysis. Login to comment

PMID: 18445995 [PubMed] Sai K et al: "Genetic variations and haplotypes of ABCC2 encoding MRP2 in a Japanese population."

No. Sentence Comment

68 Summary of ABCC2 variations detected in this study SNP ID Position This Study dbSNP (NCBI) JSNP Reference Location NT_030059.12 From the translational initiation site or from the end of the nearest exon Nucleotide change Amino acid change Frequency (total＝472) MPJ6_AC 2082 8 5?-Flanking 20289354 －1774 acttatcttgttG/_tttttttttttt 0.343 MPJ6_AC 2078 a 5?-Flanking 20289538 －1590 tttaatttgttaG/Atgtatgtttgct 0.002 MPJ6_AC 2079 8, 10, 17 5?-Flanking 20289579 －1549 tccttatagtatG/Attgtggatatta 0.203 MPJ6_AC 2080 9, 17 5?-Flanking 20290105 －1023 tgggaggccaagG/Acagaaggattgt 0.343 MPJ6_AC 2081 10, 17 5?-Flanking 20290109 －1019 aggccaaggcagA/Gaggattgttgaa 0.203 MPJ6_AC 2028 a 5?-Flanking 20290395 －733 acagtttctagcG/Tactgatgccacc 0.004 MPJ6_AC 2029 5?-Flanking 20290395 －733 acagtttctagcG/Aactgatgccacc 0.002 MPJ6_AC 2030 a 5?-Flanking 20290715 －413 ttgcagcagaagC/Tgaaactgcacat 0.002 MPJ6_AC 2003 ssj0000371 9, 12, 15-18, 20, 26 Exon 1 20291104 －24 tagaagagtcttC/Tgttccagacgca 0.174 MPJ6_AC 2004 18 Exon 1 20291105 －23 agaagagtcttcG/Attccagacgcag 0.006 MPJ6_AC 2031 ssj0000386 17, 26 Intron 3 20301785 IVS3 －49 ctcccctcagtcC/Ttcggttagtggc 0.203 MPJ6_AC 2032 a Intron 6 20302837 IVS6 ＋86 tattttattattT/Atttttttgagat 0.076 MPJ6_AC 2033 a Exon 7 20305479 732 caagtttgaaacG/Acacatgaagaga Thr244Thr 0.002 MPJ6_AC 2066 a Intron 7 20307421 IVS7 －69 tcacaggctgacC/Gaccctggagctg 0.002 MPJ6_AC 2067 a Intron 7 20307423 IVS7 －67 acaggctgaccaC/Acctggagctgct 0.002 MPJ6_AC 2035 a Exon 9 20308814 1177 ggtgtaaaagtaC/Tggacagctatca Arg393Trp 0.002 MPJ6_AC 2068 a Exon 9 20308839 1202 tggcttctgtatA/Gtaagaaggtaag Tyr401Cys 0.002 MPJ6_AC 2036 a Intron 9 20308859 IVS9 ＋13 gtaagcagaataC/Tggcaggtatcac 0.002 MPJ6_AC 2037 a Exon 10 20312319 1227 gaccctatccaaC/Tttggccaggaag Asn409Asn 0.002 MPJ6_AC 2009 ssj0000388 17, 18, 20, 23-26 Exon 10 20312341 1249 aaggagtacaccG/Attggagaaacag Val417Ile 0.097 MPJ6_AC 2010 18 Exon 10 20312549 1457 ccaagagtaagaC/Tcattcaggtaaa Thr486Ile 0.019 MPJ6_AC 2069 a Intron 11 20315600 IVS11 －67 taaaacatgggtG/Agatcagatacac 0.002 MPJ6_AC 2038 ssj0000390 26 Intron 12 20315952 IVS12 ＋148 ccgccccatgccA/Gcttttcctcctt 0.210 MPJ6_AC 2039 a Intron 13 20318344 IVS13 －73 tcatggactaacG/Aacaaagtcaaaa 0.002 MPJ6_AC 2070 a Intron 14 20318515 IVS14 ＋14 taaataaatttgG/Taagttgcttccc 0.002 MPJ6_AC 2040 a Intron 14 20318521 IVS14 ＋20 aatttggaagtt(del/ins) b cagcaaactga 0.002 MPJ6_AC 2071 a Intron 14 20318594 IVS14 ＋93 agcaaactgagaG/Tagagtgtggaga 0.002 MPJ6_AC 2041 a Intron 14 20319757 IVS14 －62 cggagagagacaC/Tgtgagggcagac 0.002 MPJ6_AC 2042 a Intron 14 20319758 IVS14 －61 ggagagagacacG/Atgagggcagaca 0.006 MPJ6_AC 2043 ssj0000393 26 Intron 15 20320054 IVS15 ＋169 aaagcaaaggttT/Ctcagccccttcc 0.210 MPJ6_AC 2044 a Intron 15 20321170 IVS15 －131 gtcttgtatatcC/Gaaggcaaatttt 0.004 MPJ6_AC 2045 a Intron 16 20325422 IVS16 －169 ttgagtcctgagA/Tgtggaataacta 0.004 MPJ6_AC 2046 ssj0000396 17 Intron 16 20325486 IVS16 －105 tgcacagttattC/Taaatttaagctc 0.214 MPJ6_AC 2072 a Exon 18 20327159 2358 tcttctagatgaC/Acccctgtctgca Asp786Glu 0.002 MPJ6_AC 2012 18, 20, 23 Exon 18 20327167 2366 atgaccccctgtC/Ttgcagtggatgc Ser789Phe 0.008 MPJ6_AC 2073 a Intron 19 20327555 IVS19 ＋3 gaagccacaggtA/Gtgtaagaaggat 0.002 MPJ6_AC 2047 a Intron 19 20327645 IVS19 ＋93 agtatccagtgaA/Tctagatttggaa 0.002 MPJ6_AC 2048 Intron 20 20338745 IVS20 ＋29 gctggcagccctC/Agtcagctctata 0.002 MPJ6_AC 2049 a Exon 21 20339052 2801 ccttgaaaactcG/Agaatgtgaatag Arg934Gln 0.002 MPJ6_AC 2015 ssj0000398 8, 18, 26 Exon 22 20339944 2934 aggattgttttcG/Aatattcttcatc Ser978Ser 0.040 MPJ6_AC 2050 a Exon 22 20340061 3051 cgactatccagcA/Gtctcagagggac Ala1017Ala 0.002 MPJ6_AC 2051 a Exon 23 20340337 3181 cacaagcaactgC/Ttgaacaatatcc Leu1061Leu 0.002 MPJ6_AC 2052 ssj0000399 17, 26 Intron 23 20340470 IVS23 ＋56 ggatctttctgaC/Tagggaggaatta 0.222 MPJ6_AC 2074 a Exon 24 20342724 3320 ttacatgcttccT/Gggggataatcag Leu1107Arg 0.002 MPJ6_AC 2053 Intron 24 20342843 IVS24 ＋25 atggctaagtcaT/Cccttccttcctc 0.030 MPJ6_AC 2075 a Intron 24 20342880 IVS24 ＋62 agcccagcctctT/Ctcctgagaatct 0.002 MPJ6_AC 2054 Intron 24 20342926 IVS24 ＋108 cactcactcctcC/Tcctcagcagctt 0.023 MPJ6_AC 2055 a Intron 24 20344318 IVS24 －56 agaaaggaggaaG/Aatggtggatgcc 0.002 MPJ6_AC 2056 a Intron 26 20352061 IVS26 －21 atgatgattttcA/Ggtcttctggttt 0.002 MPJ6_AC 2057 a Intron 27 20352227 IVS27 ＋44 ggcaaaaacaacA/Gtgcaactccttc 0.008 MPJ6_AC 2058 ssj0000404 17, 26 Intron 27 20352307 IVS27 ＋124 aaagtttcctttC/Gctctaactcaaa 0.222 MPJ6_AC 2076 26 Exon 28 20352688 3927 ccaagtgcggtaC/Tcgacctgagctg Tyr1309Tyr 0.002 MPJ6_AC 2022 ssj0000407 8, 12, 13, 17, 18, 20, 26 Exon 28 20352733 3972 cacttgtgacatC/Tggtagcatggag Ile1324Ile 0.216 MPJ6_AC 2059 a Intron 28 20352920 IVS28 ＋172 agggaaggatagC/Tagccagggatca 0.004 MPJ6_AC 2060 a Intron 29 20354201 IVS29 ＋136 cttgagctagttC/Tcctaggatggac 0.002 MPJ6_AC 2061 ssj0000408 26 Intron 29 20354219 IVS29 ＋154 gatggacacgtcA/Gtttccagaactt 0.367 MPJ6_AC 2062 IMS-JST090926 17 Intron 29 20355209 IVS29 －35 cttttctggcatG/Aagccccaacagc 0.015 MPJ6_AC 2063 a Intron 30 20358793 IVS30 －92 ggggggttttgaA/Gagtctgatctgg 0.008 MPJ6_AC 2064 IMS-JST185750 Intron 30 20358832 IVS30 －53 ccccctgccctgC/Tgtctttccttgg 0.051 MPJ6_AC 2077 a 3?-UTR 20359975 *61 c taattttattttT/Gtataaaatacag 0.002 MPJ6_AC 2065 a 3?-Flanking 20360190 *193＋83 c ttattcctttgcC/Gtttcatttctgt 0.002a8 a Novel genetic variation b delGCTTCCCAAACTTATTCGCAGTACTGGTGCCAGAATTTTGATAATACAAGAGCTTAGTAG/insTATTTACCT c Numbered from the termination codon. Login to comment
87 The *2 [including 1249GÀA (Val417Ile)] was the most frequent among them, and its frequency (0.093) was similar to those for Asians (0.10-0.13)8,12,20) and slightly lower than those for Caucasians (0.13-0.22).9,10,14,15,21) The haplotype frequencies of *3 [harboring 1457CÀT (Thr486Ile)] and *4 [2366CÀT (Ser789Phe)] were 0.019 and 0.008. Login to comment
90 The variation 2366CÀT (Ser789Phe) (*4) has been shown to cause reduced MRP2 expression and alter localization in vitro,23) but clinical data are limited. Login to comment

PMID: 16847695 [PubMed] Nies AT et al: "The apical conjugate efflux pump ABCC2 (MRP2)."

No. Sentence Comment

139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment

PMID: 16377077 [PubMed] Wada M et al: "Single nucleotide polymorphisms in ABCC2 and ABCB1 genes and their clinical impact in physiology and drug response."

No. Sentence Comment

59 [42,49,53,91]c 18 2366COT S789F NBD1 (Transport activity) Not reported 0.9 [42]a 25 3449GOA R1150H MSD3 DJS (transport activity) 0.3 Not reported [52] 25 3517AOT I1173F MSD3 DJS (protein maturation) 1.4 Not reported [52] 28 3895AOC K1299Q NBD2 Unkown Not reported 1? Login to comment

PMID: 15846474 [PubMed] Hirouchi M et al: "Treatment of hyperbilirubinemia in Eisai hyperbilirubinemic rat by transfecting human MRP2/ABCC2 gene."

No. Sentence Comment

21 Although the wild-type MRP2 was exclusively localized at the apical membrane, S789F and A1450T MRP2 were located not only at the apical membrane but also in the intracellular compartment, suggesting that the in vivo function of these two kinds of variants may be lower than wild type MRP2 (12). Login to comment

PMID: 15226675 [PubMed] Niemi M et al: "High plasma pravastatin concentrations are associated with single nucleotide polymorphisms and haplotypes of organic anion transporting polypeptide-C (OATP-C, SLCO1B1)."

No. Sentence Comment

145 ymous SNPs in exon 18, 2302C.T (Arg768 Trp) which is associated with the Dubin-Johnson syndrome [5,50] and 2366C.T (Ser789 Phe) with suggested functional significance [51], were not found in any of the subjects. Login to comment

PMID: 15180328 [PubMed] Hirouchi M et al: "Characterization of the cellular localization, expression level, and function of SNP variants of MRP2/ABCC2."

No. Sentence Comment

8 The transport activity of S789F MRP2 was slightly higher than that of wild-type MRP2. Login to comment
9 However, the expression level of S789F and A1450T MRP2 proteins was significantly lower compared with the wild-type and V417I MRP2. Login to comment
10 In addition, although the wild-type and V417I MRP2 were exclusively localized in the apical membrane, S789F and A1450T MRP2 were located in the apical membrane and also in the intracellular compartment. Login to comment
12 These results suggest that the most frequently observed V417I substitution may not affect the in vivo function of MRP2, whereas the much less frequently observed S789F and A1450T may be associated with the reduced in vivo function. Login to comment
26 Only one respective heterozygote subject was observed out of 48 volunteers for C2302T (exon 18, Arg768Trp), C2366T (exon 18, Ser789Phe), and G4348A (exon 31, Ala1450Thr) (19), and their allele frequency was calculated to be 1%. Login to comment
43 We have generated the following four kinds of missense mutations reported previously: Val417Ile, Arg768Trp, Ser789Phe, and Ala1450Thr. Login to comment
86 The expression level of V417I, S789F, and A1450T MRP2 was 82% and 80%, 23% and 25%, and 18% and 8%, respectively, in duplicate experiments (Fig. 1). Login to comment
94 V417I MRP2 showed the same localization as wild-type MRP2 (Fig. 2), whereas two variants (S789F and A1450T MRP2s) were expressed not only at the apical surface, but also intracellularly (Fig. 2). Login to comment
95 The fraction of A1450T MRP2 located intracellularly was higher than that of S789F MRP2 (Fig. 2). Login to comment
100 As shown in Fig. 4, no significant difference was observed between the wild-type and V417I MRP2s, whereas S789F MRP2 showed approximately a 1.4-to 2.0-fold higher uptake of three substrates compared with the wild-type MRP2 (Fig. 4). Login to comment
102 Moreover, the kinetic parameters for the transport of [3 H]DNP-SG by wild-type and S789F MRP2s were determined (Fig. 5). Login to comment
123 Key: ᭺, tTA; ᭹, wt-MRP2; ᮀ, V417I; ᭿, S789F; ᭝, A1450T. Login to comment
124 nmol·min-1 ·mg-1 protein, for the membrane vesicles expressing the wild-type and S789F MRP2s, respectively. Login to comment
125 The transport activity of S789F MRP2 under linear conditions, calculated by correcting the Vmax value by the protein expression level prior to the division by the Km value, was approximately 1.3-fold higher than that of the wild type. Login to comment
136 V417I and S789F MRP2s showed similar substrate specificity for glucuronide- and glutathione-conjugates to that of wild-type MRP2 (Figs. 3 and 4). Login to comment
140 In addition, kinetic parameters for the transport of [3 H]DNP-SG were compared between wild-type and S789F MRP2s. Login to comment
142 The analysis revealed that the Km and the corrected Vmax values of [3 H]DNP-SG for S789F MRP2-mediated transport are approximately 43% and 57% that of wild-type MRP2, respectively. Login to comment
143 Consequently, the transport activity of S789F MRP2, defined as the corrected Vmax/Km, is approximately 1.3-fold higher than that of wild-type MRP2, which is consistent with its transport activity defined as the initial velocity for the uptake of ligands divided by the ligand concentration in the medium (Fig. 4). Login to comment
148 In contrast, S789F and A1450T MRP2s were expressed not only at the apical surface, but also in the intracellular compartment. Login to comment
150 It is possible that the low expression of S789F and A1450T MRP2s may be due to the degradation of the protein synthesized in the infected cells. Login to comment
153 It is possible that the two variants examined in the current study (S789F and A1450T) are also degraded in the same manner. Login to comment
156 Saturation of the ATP-dependent uptake of [3 H]DNP-SG was determined using the membrane vesicles from LLC-PK1 cells expressing wild-type (squares) and S789F MRP2s (circles). Login to comment
161 S789F and A1450T MRP2s is low compared with that of the wild type. Login to comment
162 Due to this low expression level on the apical surface, it is possible that the function of S789F and A1450T MRP2s under in vivo conditions is much lower compared with that of wild-type MRP2. Login to comment
165 Of the 48 Japanese subjects studied, both S789F and A1450T SNPs were only found in one heterozygous subject and, consequently, their allele frequency was calculated to be only 1%. Login to comment
167 Because S789F and A1450T MRP2s are located within the first and second nucleotide binding domains, respectively, where the DJS mutations are frequently located, it is possible that S789F and A1450T SNPs are associated with the pathogenesis of DJS. Login to comment
170 Although the transport activity per MRP2 molecule was not significantly decreased in much less frequently observed S789F and A1450T MRP2s, their expression level was significantly lower than wild-type MRP2, which may be associated with their intracellular localization. Login to comment

PMID: 12406647 [PubMed] Suzuki H et al: "Single nucleotide polymorphisms in multidrug resistance associated protein 2 (MRP2/ABCC2): its impact on drug disposition."

No. Sentence Comment

137 Arg768Trp), C2366T (exon 18, Ser789Phe) and Although Harris et al. Login to comment

PMID: 12130697 [PubMed] Gerk PM et al: "Regulation of expression of the multidrug resistance-associated protein 2 (MRP2) and its role in drug disposition."

No. Sentence Comment

53 Site-directed mutagenesis studies substi- TABLE 1 Mutations in human MRP2 Mutation Location Translation Domain Phenotype Reference -24(C-T) Promoter 5Ј-UTR Not reported (Ito et al., 2001e) 1249(G-A)/wt Exon 10 V4171 MSD2 Not reported (Ito et al., 2001e) 1815ϩ2(T-A)/1815ϩ2(T-A) Exon 13 147-bp deletion MSD2 DJS (Wada et al., 1998; Toh et al., 1999) 2002del67/2002del67 Exon 16 Premature termination codon NBD1 DJS (Konig et al., 1999a) 2302(C-T)/2302(C-T) Exon 18 R768W/R768W NBD1 DJS (Wada et al., 1998; Toh et al., 1999; Ito et al., 2001e) 2302(C-T)/2439ϩ2(T-C) Exon 18 R768W/168-bp deletion NBD1 DJS (Toh et al., 1999) 2302(C-T)/wt Exon 18 R768W/wt NBD1 Increased UCP1 (Toh et al., 1999) 2366(C-T)/wt Exon 18 S789F/wt NBD1 Not reported (Ito et al., 2001e) 2439ϩ2(T-C)/2439ϩ2(T-C) Exon 18 168-bp deletion/168-bp deletion NBD1 DJS (Wada et al., 1998; Toh et al., 1999) 2439ϩ2(T-C)/4145(A-G) Exon 18/29 168-bp deletion/Q1328R NBD1/2 DJS (Toh et al., 1999) 2439ϩ2(T-C)/wt Exon 18 168-bp deletion/wt NBD1 Increased UCP1 (Toh et al., 1999) 3196(C-T)/3196(C-T) Exon 23 Premature termination codon MSD3 DJS (Paulusma et al., 1997; Tsujii et al., 1999) 3449(G-A)/3449(G-A) Exon 25 R1150H/R1150H MSD3 DJS (Mor-Cohen et al., 2001) 3517(A-T)/3517(A-T) Exon 25 I1173F/I1173F MSD3 DJS (Mor-Cohen et al., 2001) 3972(C-T)/wt Exon 28 I1324I/wt near NBD2 None (Ito et al., 2001e) 4175del6 Exon 30 Loss of R1392 and M1393 NBD2 DJS (Tsujii et al., 1999) 4348(G-A)/wt Exon 31 A1450T/wt NBD2 Not reported (Ito et al., 2001e) UTR, untranslated region; wt, wild type; bp, base pair; UCP1, urinary coproporphyrin fraction 1. tuting the cationic amino acid Arg586 and Arg1096 in rat Mrp2 with neutral amino acids (R586L, R586I, R1096L, and R1096M) or a cationic amino acid (R1096K) led to acquisition of taurocholate transport and retention of glucuronide and glutathione conjugate transport by Mrp2 (Ito et al., 2001d). Login to comment

PMID: 11901087 [PubMed] Itoda M et al: "Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28."

No. Sentence Comment

4 Four SNPs, c-24t, g1249a (V417I), c2366t (S789F), and c3972t (I1324I), were the same as those recently reported. Login to comment
26 The amino acid substitutions S789F (c2366t) and S1367C (c4100g) were reportedly located in nucleotide binding domains 1 and 2, respectively, those of V417I (g1249a) and T486I (c1457t) in membrane-spanning domain 2, and that of Q1019H (g3057t) in membrane spanning domain 3 (Toh et al., 1999). Login to comment
29 It was strongly suggested that functional changes by the V417I, S789F, D883N, Q1019H, N1244K, S1367C, and C1515Y alterations seemed to be worth assessing because the TM1 to TM5 domains (200 N-terminal amino This study was supported in part by the Program for Promotion of Fundamental Studies in Health Sciences (MPJ-6) of the Organization for Pharmaceutical Safety and Research of Japan. Login to comment
57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region. Login to comment

PMID: 16815813 [PubMed] Choudhuri S et al: "Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters."

No. Sentence Comment

315 Other SNPs identified with low frequency (~1%) were C2302T (Arg768Trp), C2366T (Ser789Phe), and G4348A (Ala1450Thr), all being missense mutations. Login to comment
321 They found that the most frequently observed amino acid substitution (Val417Ile) as well as the two less frequently observed amino acid substitutions (Ser789Phe and Ala1450Thr) may not affect drug disposition function of MRP2. Login to comment
322 However, mutant MRP2 protein with two less frequently observed amino acid substitutions (Ser789Phe and Ala1450Thr) showed significantly lower expression levels compared to the wild-type MRP2. Login to comment

PMID: 20367109 [PubMed] Giraud C et al: "ABC transporters in human lymphocytes: expression, activity and role, modulating factors and consequences for antiretroviral therapies."

No. Sentence Comment

196 A rare non-synonymous polymorphism, the 2366C > T (S789F) variant, was associated in vitro with a decrease of the transporter expression and a slight increase of its activity [95]. Login to comment
197 Other rare non-synonymous variants (frequencies about 1%) have also been identified, such as the 2302C > T (A768W), 2366C > T (S789F) and 4348 G > A (A1450T) polymorphisms, but are rare and their functional impact is unknown. Login to comment