ABCMdb

ABCC4 p.Gly187Trp

None has been submitted yet.

Publications

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

191 MRP4 protein has been detected in human kidney (van Aubel et al., 2002), lung (Torky et al., 2005), liver (Rius et al., 2003), prostate (Lee et al., 2000), brain (Nies et al., 2004), pancreas (König et al., 2005), lymphocytes (Schuetz et al., 1999), and platelets Figure 4 Predicted membrance topology of MRP4 (ABCC4) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 4 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD Val854Phe Ile18Leu Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304Asn in out Membrane Cys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val MRP4 (ABCC4) COOH NBD NBD Val854Phe Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304AsnCys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val COOH NBD NBD Val854Phe Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304AsnCys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val (Jedlitschky et al., 2004). Login to comment
216 Polymorphisms in exons 1, 5, 12, 13, 19, 21, and 28 leading to the following amino acid exchanges Ile18Leu, Gly187Trp, Arg531Gln, Tyr556Cys, Val776Ile, Val854Phe, Ile866Val, and Thr1142Met were analysed in relation to expression and localization of MRP4 in human liver. Login to comment
217 Some of the amino acid substitutions are located within highly conserved regions such as membrane spanning domains (Val776Ile, Val854Phe, Ile866Val) or ATP-binding domains (Tyr556Cys, Thr1142Met), others are located in intracellular regions where they might influence substrate recognition (Gly187Trp). Login to comment
236 Following the discovery and Table 4 MRP4 (ABCC4) Single nucleotide polymorphisms. Location, allele frequency and functional effects. Position in coding sequence Amino acid exchange Location Allele frequency Effect NCBI ID ReferenceAf Ca Jp others 52A>C Ile18Leu Exon 1 - 1.1 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568681 511T>G Cys171Gly Exon 4 - 0 [1] [2] - - rs4148460 559G>T Gly187Trp Exon 5 - 2.2 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568658 912G>T Lys304Asn Exon 8 - 9.9 [1] [2] - No influence on expression and localization in liver [1] rs2274407 1208T>C Pro403Leu Exon 9 - - - - - rs11568705 1492A>G Lys498Glu Exon 11 - - - - - rs11568669 1592G>A Arg531Gln Exon 12 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 1667A>G Tyr556Cys Exon 13 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 2230A>G Met744Val Exon 18 - - - - - rs9282570 2269G>A Glu757Lys Exon 18 - 0.6 [1] [2] - No influence on expression and localization in liver [1] rs3765534 2326G>A Val776Ile Exon 19 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 2560G>T Val854Phe Exon 21 - 1.7 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568694 2596A>G Ile866Val Exon 21 - 2.8 [1] 0 [2] - No influence on expression and localization in liver [1] 3425C>T Thr1142Met Exon 27 - 1.6 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568644 3814A>G Met1272Val Exon 30 - - - - - rs1134217 Reference without frequency means that SNP was detected but no frequency determined. Login to comment

PMID: 21619426 [PubMed] Stieger B et al: "Pharmacogenetics of drug transporters in the enterohepatic circulation."

No. Sentence Comment

117 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Liver efflux transporters (cont.) SLC47A1 (cont.) MATE1 (cont.) c.1490G>C c.149G>T p.C497S p.C497F N/A Reduced, unchanged or increased transport activities (substrate dependent) [170,229] c.1557G>C p.Q519H N/A Unchanged [170] ABCC4 MRP4 c.232C>G p.P78A N/A Increased intracellular drug accumulation (substrate dependent), lower transport protein expression [161] c.559C>T p.G187W N/A Increased intracellular drug accumulation, reduced transport protein expression Slightly reduced function [161] [162] c.877A>G p.K293E N/A Unchanged [161] c.912G>T p.K304N N/A Unchanged Unchanged [161] [162] c.1208C>T p.P403L N/A Increased intracellular drug accumulation [161] c.1460G>A p.G487E N/A Increased intracellular drug accumulation Reduced transport activity (substrate dependent) [161] [162] c.1492A>G p.K498E N/A Unaltered [161] c.1667A>G p.Y556C N/A Increased transport activity [162] c.2269G>A p.E575K N/A Increased transport activity [162] c.2230A>G p.M744V N/A Unchanged [161] c.2326G>A p.V776I N/A Reduced transport activity [162] c.2459G>T p.R820I N/A Reduced transport activity [162] c.2560G>T p.V854F N/A Unchanged [162] c.2596A>G p.I866V N/A Unchanged [162] c.2867G>C p.C956S N/A Reduced intracellular drug accumulation [161] c.3211G>A p.V1071I N/A Unchanged [161] c.3425C>T p.T1142M N/A Increased transport activity [162] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment
225 Most of the changes were minor, with the exception p.G187W, which resulted in a significantly lower protein expression. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

7079 Two ABCC4 variants (G187W, G487E) demonstrate reduced in vitro MRP4 function as shown by higher intracellular accumulation of zidovudine and PMEA (Table 20) (Abla et al., 2008). Login to comment
7080 In the case of the G187W variant, lower MRP4 function was due to reduced protein (Abla et al., 2008). Login to comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7076 Two ABCC4 variants (G187W, G487E) demonstrate reduced in vitro MRP4 function as shown by higher intracellular accumulation of zidovudine and PMEA (Table 20) (Abla et al., 2008). Login to comment
7077 In the case of the G187W variant, lower MRP4 function was due to reduced protein (Abla et al., 2008). Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

PMID: 22955427 [PubMed] Nishijima T et al: "Single Nucleotide Polymorphisms in ABCC2 Associate With Tenofovir-Induced Kidney Tubular Dysfunction in Japanese Patients With HIV-1 Infection: A Pharmacogenetic Study."

No. Sentence Comment

60 The 14 SNPs selected were (1) ABCC2 (encodes MRP2) -24C → T (in the promoter; rs717620); 1249G → A (Val417Ile; rs2273697); 2366C → T (Ser789Phe; rs56220353); 2934G → A (Ser978Ser; rs3740070), (2) ABCC4 (encodes MRP4) 559G →; T (Gly187Trp; rs11568658); 912G → T (Lys304Asn; rs2274407); 2269G → A (Glu757Lys; rs3765534); 3348A → G (Lys1116Lys; rs1751034); 4135T → G [in the 3' untranslated region (UTR); (rs3742106)]; 4976T → C (3' UTR; rs1059751), (3) ABCC10 (encodes MRP10) 526G → A (intron; rs9349256); 2759T → C (Ile920Thr; rs2125739), (4) SLC22A6 (encodes OAT1) 180C → T (Asn60Asn; rs11568630), and (5) ABCB1 (encodes P-glycoprotein) 2677T → A/G (A:Ser893Thr, G:Ser893Ala; rs2032582). Login to comment
84 Genotype Frequencies at ABCC2, ABCC4, ABCC10, SLC22A6, and ABCB1 in Patients With and Without Kidney Tubular Dysfunction Genotype Amino Acid Patients With KTD (n = 19) Patients With Normal Tubular Function (n = 171) P Valuea ABCC2 (MRP2) -24 C → T, rs717620 C/C 18 (94.7) 108 (63.2) C/T 1 (5.3) 52 (30.4) .018 T/T 0 (0) 11 (6.4) 1249 G → A, rs2273697 Val417Ile G/G 11 (57.9) 133 (77.8) A/G 5 (26.3) 34 (19.9) .017 A/A 3 (15.8) 4 (2.3) 2366 C → T, rs56220353 Ser789Phe C/C 19 (100) 167 (97.7) C/T 0 (0) 3 (1.8) 1.000 T/T 0 (0) 1 (0.6) 2934 G → A, rs3740070 Ser978Ser G/G 18 (94.7) 159 (93.0) G/A 1 (5.3) 11 (6.4) 1.000 A/A 0 (0) 1 (0.6) ABCC4 (MRP4) 559 G → T, rs11568658 Gly187Trp G/G 13 (68.4) 133 (77.8) G/T 4 (21.1) 34 (19.9) .126 T/T 2 (10.5) 4 (2.3) 912G → T, rs2274407 G/G 13 (68.4) 102 (59.6) T/G 6 (31.6) 52 (30.4) .461 T/T 0 (0) 17 (9.9) 2269 G → A, rs3765534 Glu757Lys G/G 15 (78.9) 129 (75.4) G/A 2 (10.5) 35 (20.5) .241 A/A 2 (10.5) 7 (4.1) 3348 A → G, rs1751034 Lys1116Lys A/A 13 (68.4) 98 (57.3) A/G 3 (15.8) 58 (33.9) .185 G/G 3 (15.8) 15 (8.8) 4135 T → G, rs3742106 T/T 6 (31.6) 46 (26.9) T/G 7 (36.8) 79 (46.2) .707 G/G 6 (31.6) 46 (26.9) 4976T → C, rs1059751 T/T 6 (31.6) 46 (26.9) T/C 5 (26.3) 86 (50.3) .090 C/C 8 (42.1) 39 (22.8) ABCC10 (MRP7) 526G → A, rs9349256 G/G 4 (21.1) 32 (18.7) A/G 9 (47.4) 65 (38) .569 A/A 6 (31.6) 74 (43.3) Table 2 summarizes the distribution of genotypes at the ABCC2, ABCC4, ABCC10, SLC22A11, and ABCB1 genes in the 2 groups. Login to comment

PMID: 17083032 [PubMed] Izzedine H et al: "Association between ABCC2 gene haplotypes and tenofovir-induced proximal tubulopathy."

No. Sentence Comment

77 (%) P Group 1 (n p 13) Group 2 (n p 17) ABCC2 Exon 1, -24 CrT (rs717620) … Genotype .29 CC 9 (69) 11 (64) CT 3 (23) 5 (29) TT 1 (8) 1 (6) Allele C 21 (80.8) 27 (79.4) T 5 (19.2) 7 (20.6) Exon 9, 1058 GrA (rs7080681) Arg353His Genotype .43 GG 12 (92) 17 (100) GA 1 (8) 0 AA 0 0 Allele G 25 (96.2) 34 (100) A 1 (3.8) 0 Exon 10, 1249 GrA (rs2273697) Val417Ile Genotype .02 GG 3 (23) 11 (64) GA 9 (69) 6 (35) AA 1 (8) 0 Allele G 15 (57.7) 28 (82.4) A 11 (42.3) 6 (17.6) Exon 25, 3563 TrA (rs8187694) Val1188Glu Genotype .01 TT 13 (100) 10 (59) TA 0 6 (35) AA 0 1 (6) Allele T 26 (100) 26 (76.5) A 0 8 (23.5) Exon 28, 3972 CrT (rs3740066) Ile1324Ile Genotype .96 CC 6 (46) 8 (47) CT 4 (31) 7 (41) TT 3 (23) 2 (12) Allele C 16 (61.5) 23 (67.7) T 10 (38.5) 11 (32.3) Exon 32, 4544 GrA (rs8187710) Cys1515Tyr Genotype .01 GG 13 (100) 10 (59) GA 0 6 (35) AA 0 1 (6) Allele G 26 (100) 26 (76.5) A 0 8 (23.5) ABCC4 Exon 5, 559GrT (rs11568658) Gly187Trp Genotype .07 GG 10 (77) 17 (100) GT 3 (23) 0 TT 0 0 Allele G 23 (88.5) 34 (100) T 3 (11.5) 0 (continued) 1485 Table 2. Login to comment

PMID: 18364470 [PubMed] Abla N et al: "The human multidrug resistance protein 4 (MRP4, ABCC4): functional analysis of a highly polymorphic gene."

No. Sentence Comment

9 However, two variants (G187W and G487E) showed a significantly reduced function compared to reference with both substrates, as evidenced by higher intracellular accumulation of AZT and PMEA compared to the reference MRP4 (43 and 69% increase in accumulation for G187W compared with the reference MRP4, with AZT and PMEA, respectively). Login to comment
100 Only three nonsynonymous variants (G187W, K304N, and M744V) have frequencies higher than 5% in a given ethnic group. Login to comment
110 Initially, ABCC4 haplotypes were inferred from all variable sites with a frequency higher than TABLE 1 Primers used for constructing the variants and the nonfunctional mutant by site-directed mutagenesis Variant Sequencea (5Ј-3Ј) P78A F: GAATGACGCACAGAAGGCTTCTTTAACAAGAGC R: GCTCTTGTTAAAGAAGCCTTCTGTGCGTCATTC G187W F: GTAACATGGCCATGTGGAAGACAACCACAG R: CTGTGGTTGTCTTCCACATGGCCATGTTAC K293E F: GTACGCCTGGGAAGAGTCATTTTCAAATC R: GATTTGAAAATGACTCTTCCCAGGCGTAC K304N F: CCAATTTGAGAAATAAGGAGATTTCCAAG R: CTTGGAAATCTCCTTATTTCTCAAATTGG P403L F: GCGCAACCGTCAGCTGCTGTCAGATGGTAAAAAG R: CTTTTTACCATCTGACAGCAGCTGACGGTTGCGC G487E F: CCCTGGGTGTTCTCGGAAACTCTGAGGAG R: CTCCTCAGAGTTTCCGAGAACACCCAGGG K498E F: GTAATATTTTATTTGGGAAGGAATACGAAAAGG R: CCTTTTCGTATTCCTTCCCAAATAAAATATTAC M744V F: GGGCAAACAAACAAAGTGTGCTAAATGTCACTG R: CAGTGACATTTAGCACACTTTGTTTGTTTGCCC C956S F: CGTCTGGATGCCATCTCTGCCATGTTTGTCATC R: GATGACAAACATGGCAGAGATGGCATCCAGACG V1071I F: CACAAGAAAAGATTGGCATTGTGGGAAG R: CTTCCCACAATGCCAATCTTTTCTTGTG G538D F: GGAACCACGCTGAGTGGAGACCAGAAAGCACGGGTAAACC R: GGTTTACCCGTGCTTTCTGGTCTCCACTCAGCGTGGTTCC F, forward; R, reverse. Login to comment
126 Ten nonsynonymous variants were chosen for this study based on a frequency of Ն5% in the populations studied (G187W, K304N, and M744V), high evolutionary conservation (all variants with the exception of M744V), or a high Grantham value (G187W Ͼ C956S Ͼ P403L ϭ G487E Ͼ K304N). Login to comment
144 However, the function of two variants (G187W and G487E) was significantly reduced compared to the reference, and this was observed both with AZT and PMEA (p Ͻ 0.001 and p Ͻ 0.005, Student`s t test with Bonferroni`s correction for 10 comparisons) (Fig. 4B). Login to comment
145 The P78A and P403L TABLE 2 Selected genetic variants in ABCC4a Exon Nucleotide Position Golden Path Positionb Variant Flagb Nucleotide Change Amino Acid or Intronic Position Amino Acid Change Grantham Score Allele Frequencyc AA (n ϭ 160) CA (n ϭ 160) AS (n ϭ 120) ME (n ϭ 100) 1 -49 chr13:94751618 rs3751333 C Ͼ T 5Ј-UTR - - 0.013 0.019 0.102 0.03 1 52 chr13:94751518 rs11568681 C Ͼ A 18 Leu to Ile 5 0.006 0.044 0.034 0.01 1 IVS1ϩ10 chr13:94751486 rs11568682 C Ͼ T Intronic - - 0.006 0.019 0 0 2 IVS2ϩ7 chr13:94697891 rs11568700 C Ͼ T Intronic - - 0.031 0 0 0 3 IVS3-5 chr13:94697355 rs4148437 T Ͼ C Intronic - - 0.087 0.331 0.183 0.25 3d 232 chr13:94697304 rs11568689 C Ͼ G 78 Pro to Ala 27 0 0 0.008 0 4 IVS4-10 chr13:94685099 rs11568638 C Ͼ T Intronic - - 0.025 0 0 0 4 IVS4ϩ10 chr13:94684855 rs11568637 A Ͼ G Intronic - - 0.031 0 0.117 0 5 551 chr13:94661017 rs11568657 T Ͼ C 184 Met to Thr 81 0.013 0 0 0 5 559 chr13:94661009 rs11568658 G Ͼ T 187 Gly to Trp 184 0 0.025 0.108 0.130 6 669 chr13:94659805 rs899494 C Ͼ T 223 Syn 0.219 0.200 0.125 0.090 6 717 chr13:94659757 rs11568674 T Ͼ C 239 Syn 0 0 0.008 0 7 877 chr13:94658089 rs11568684 A Ͼ G 293 Lys to Glu 56 0.006 0 0 0 8 912 chr13:94657036 rs2274407 G Ͼ T 304 Lys to Asn 94 0.181 0.087 0.225 0.160 8 951 chr13:94656997 rs2274406 G Ͼ A 317 Syn 0.619 0.406 0.458 0.390 8 969 chr13:94656979 rs2274405 G Ͼ A 323 Syn 0.312 0.406 0.458 0.320 8 1035 chr13:94656913 rs11568703 G Ͼ A 345 Syn 0 0.013 0 0 8 1067 chr13:94656881 rs11568701 C Ͼ T 356 Thr to Met 81 0 0 0 0.010 8 IVS8ϩ8 chr13:94656779 rs11568702 T Ͼ A Intronic - 0 0.013 0 0 9 1208 chr13:94645146 rs11568705 C Ͼ T 403 Pro to Leu 98 0.006 0 0 0 11 1458 chr13:94637043 rs11568670 G Ͼ A 486 Syn 0 0.006 0 0 11 1460 chr13:94637041 rs11568668 G Ͼ A 487 Gly to Glu 98 0 0 0.008 0 11 1492 chr13:94637009 rs11568669 A Ͼ G 498 Lys to Glu 56 0.025 0 0 0 11 1497 chr13:94637004 rs1557070 C Ͼ T 499 Syn 0.238 0 0 0 14 1737 chr13:94620874 rs11568664 T Ͼ C 579 Syn 0.006 0 0 0 15 IVS15-7 chr13:94616629 rs11568696 A Ͼ G Intronic - 0.031 0 0 0 15 1875 chr13:94616572 rs11568699 A Ͼ G 625 Ile to Met 10 0.006 0 0 0 15 2000 chr13:94616447 rs11568697 C Ͼ T 667 Pro to Leu 98 0 0.006 0 0 15 2001 chr13:94616446 rs11568698 C Ͼ T 667 Syn 0.013 0 0 0 16 2100 chr13:94614708 rs11568666 C Ͼ T 700 Syn 0 0.013 0 0 18 2230 chr13:94613455 rs9282570 A Ͼ G 744 Met to Val 21 0.050 0 0 0 18 2269 chr13:94613416 rs3765534 G Ͼ A 757 Glu to Lys 56 0.025 0.013 0.033 0.030 19 2364 chr13:94611535 rs11568709 C Ͼ T 788 Syn 0.006 0 0 0 20 2459 chr13:94566253 rs11568659 G Ͼ T 820 Arg to Ile 97 0.006 0 0 0 21 2560 chr13:94533521 rs11568694 G Ͼ T 854 Val to Phe 50 0.006 0 0 0 21 2577 chr13:94533504 rs11568691 C Ͼ T 859 Syn 0 0.006 0 0 22 2698 chr13:94525795 rs11568673 G Ͼ T 900 Val to Leu 32 0 0.006 0 0.010 22 2712 chr13:94525781 rs1678339 G Ͼ A 904 Syn 0.156 0.031 0.217 0.020 23 2844 chr13:94524542 rs1189466 C Ͼ T 948 Syn 0.075 0.031 0.208 0.020 23 2847 chr13:94524539 rs11568708 C Ͼ T 949 Syn 0.019 0 0 0 23 2867 chr13:94524519 rs11568707 G Ͼ C 956 Cys to Ser 112 0.006 0 0 0 26 3211 chr13:94513114 rs11568653 G Ͼ A 1071 Val to Ile 29 0.006 0 0 0 26 3255 chr13:94513070 rs11568652 C Ͼ A 1085 Syn 0.013 0 0 0.010 26 3310 chr13:94513015 rs11568655 T Ͼ C 1104 Syn 0.100 0 0 0.010 26 3348 chr13:94512977 rs1751034 A Ͼ G 1116 Syn 0.231 0.169 0.242 0.200 27 3425 chr13:94503381 rs11568644 C Ͼ T 1142 Thr to Met 81 0 0.006 0 0 28 3609 chr13:94494541 rs11568695 G Ͼ A 1203 Syn 0.206 0 0 0.010 29 3659 chr13:94494013 rs11568639 G Ͼ A 1220 Arg to Gln 43 0.006 0 0 0 29 3723 chr13:94493949 rs11568640 C Ͼ T 1241 Syn 0.006 0 0 0 30 3774 chr13:94484956 rs11568704 G Ͼ A 1258 Syn 0.037 0 0 0 31 IVS31-3 chr13:94471940 rs9524765 C Ͼ T Intronic - 0.225 0 0 0.02 31 3941 chr13:94471867 rs11568688 A Ͼ G 1314 Gln to Arg 43 0.006 0 0 0 31 4016 chr13:94471792 rs3742106 T Ͼ G 3Ј-UTR - 0.287 0.388 0.467 0.470 Dashes indicate not relevant. Login to comment
153 The G187W variant had the greatest decrease in function, with a 43 and 69% increase in accumulation of AZT and PMEA, respectively, compared to reference MRP4. Login to comment
154 To characterize the functional difference observed with some of the variants, we measured the intracellular accumulation of AZT and PMEA as a function of the extracellular concentration for the reference and the variants that showed a reduced function with one or both substrates (P78A, G187W, and G487E), as well as the C956S variant, which was more functional with respect to PMEA transport (Fig. 5). Login to comment
156 The transport velocity curves (Fig. 5) suggest that the differences reported with some of the variants (G187W and G487E) are real and concentration-independent, and this effect seems more pronounced with AZT. Login to comment
176 The MRP4 and GAPDH signals were quantified using image analysis, and the G187W variant was expressed at a significantly lower level than that of the reference MRP4 (data not shown). Login to comment
179 To check that the functional differences were not due to differences in localization of the variants at the cell membrane, immunocytochemistry studies were carried out with the less functional variants (G187W, G487E, and P78A), the nonfunctional mutant (G538D) and the more functional variant (C956S). Login to comment
195 The values represent the mean Ϯ S.D. of n ϭ 3 (AZT) or n ϭ 4 (PMEA) determinations (f, reference; ࡗ, P78A; Œ, G187W; ‚, G487E; and E, C956S). Login to comment
218 Four variants have significantly lower function, with the G187W variant displaying the greatest reduction in function. Login to comment
229 One exception to this is the G187W variant, which had lower levels of antiretroviral transport and showed deceased expression by Western blotting. Login to comment
234 The Grantham value for G187W is the greatest among the nonsynonymous variants of MRP4 (D ϭ 184), indicating that this variant has the greatest structural change, with respect to composition, Fig. 7. Login to comment
240 C, P78A; D, G187W; E, P403L; F, G487E; G, C956S; H, G538D. Login to comment
246 The ϳ50% reduction in function observed with the G187W variant could be clinically relevant, whereas the small differences observed with the other variants (G487E, P78A, P403L, and C956S) are less likely to be significant. Login to comment
247 The G187W variant is present at a frequency of 2.5 to 13% in various ethnic groups. Login to comment
249 The G187W MRP4 variant could also play a role at the organism level, because MRP4 is expressed in the kidney and the liver where it may be involved in antiviral elimination (Zamek-Gliszczynski et al., 2006; Imaoka et al., 2007). Login to comment
261 The G187W variant shows the greatest decrease in function and lower expression in this in vitro system. Login to comment

PMID: 18300232 [PubMed] Janke D et al: "6-mercaptopurine and 9-(2-phosphonyl-methoxyethyl) adenine (PMEA) transport altered by two missense mutations in the drug transporter gene ABCC4."

No. Sentence Comment

34 We also sequenced large regions of the MRP4 gene of these individuals and identified 74 genetic variations, among them 10 missense mutations (I18L, G187W, K304N, R531Q, Y556C, E757 K, V776I, V854F, I866 V, and T1142 M). Login to comment
107 The following primer pairs were applied to amplify SNP-containing fragments by PCR: * rs11568658 (c.559G4T, Gly187Trp): 50 -Biotin-CCTCTTTT ATTTCAGGCACTTCG-30 , * 50 -TGCAGCTTACCTGATCAAACTTGT-30 (117 bp) * rs2274407 (c.912G4T, Lys304Asn): 50 -Biotin-ACGATGA TTTTGCTTGCACT-30 , * 50 - CGTGAGCCACTTTATCTGGT-30 (146 bp) * rs11568644 (c.3425C4T, Thr1142Met): 50 -GGGCACTTAG GAACCTGTTTTGT-30 , * 50 -Biotin-CTCTTGTAAGGCATTCCACAGTTC-30 (101 bp). Login to comment
110 Procedures of Pyrosequencing were performed according to the manufacturer`s instructions using the PSQ 96 SNP Reagent Kit (Biotage AB) and following sequencing primers: rs11568658 (Gly187Trp): 50 -CCTGTGGTTGTCTTCC-30 and rs2274407 (Lys304Asn): 50 -CTGTACTCTCTTTCAG-30 for reverse assay, rs11568644 (Thr1142Met), 50 -TGGATCCCTTTAATGAGC-30 for forward assay. Login to comment
164 A summary of all MRP4 protein mutations examined, their distribution within the protein, their frequencies and their functional prediction scores (SIFT/PolyPhen/Grantham) are listed in Supplementary Table S1 and Supplementary Figure S3. A total of six of them (G187W, G487E, Y556C, R820I, V854F, and T1142 M) are located either within transmembrane regions or near the ATP-binding domain of MRP4 and were predicted to have a functional effect by the computer-based algorithms (Supplementary Table S2). Login to comment
190 Hepatic MRP4 Expression in Relation to MRP4 Protein Variants Genomic DNA samples corresponding to 285 liver samples of Caucasian origin were screened for three frequent Caucasian MRP4 mutations: c.559G4T (G187W), c.912G4T (K304N), and c.3425C4T (T1142 M) (Supplementary Table S1) [Gradhand et al., in press]. Login to comment
211 MRP4 protein expression in samples carrying nonsynonymous SNPs relative to the control group taken as 100% was as follows: G187W (69%, n 5 7, all heterozygous), K304N (101%, n 5 12, 11 heterozygous, one homozygous), and T1142 M (60%, n 5 4, all heterozygous). Login to comment
250 In this study, the more common variants G187W, K304N, and I866 V exhibited normal functional activity, consistent with the observation that common variants are less likely to exhibit altered function than are rare variants. Login to comment
257 When SIFT and PolyPhen were used to evaluate the MRP4 nonsynonymous SNPs, both predicted the same variants as deleterious (G187W, G487E, Y556C, R820I, V854F, and TABLE 1. Login to comment
258 Conservation of the MRP4 Polymorphic AminoAcids Among Di¡erent ABCC Orthologs and HomologsÃ Protein Speciesa G187W K304N G487E Y556C E757K V776I R820I V854F I866V T1142M MRP4 Human G K G Y E V R V I T Mouse G K G Y E V R I V T Rat G K G Y G V R I L S MRP1 Human K Q D Y K ^ N C F S Mouse K Q D Y F A ^ V F S Rat K Q D Y ^ G N V V S MRP2 Human K K G Y S G R L V S Mouse R K G Y S G R L V S Rat K K G Y S G R L I S MRP3 Human R Q C F L G R L V S Rat R Q C F S G R I V S MRP5 Human ^ ^ A Y D L R V S T Mouse ^ ^ A Y D L R V S T Rat ^ ^ A Y D L R V S T MRP6 Human K G T Y G H S V V S Mouse K G T Y H G N G V T Rat K G T Y G N G V V T ÃAligned using ClustalW (www.ebi.ac.uk/clustalw). Login to comment
264 In our human liver study we found no significant influence of three MRP4 missense mutations (G187W, K304N, and T1142 M) on its hepatic expression. Login to comment

PMID: 17404579 [PubMed] Gradhand U et al: "Variability in human hepatic MRP4 expression: influence of cholestasis and genotype."

No. Sentence Comment

52 MRP4 protein expression in samples carrying non-synonymous polymorphisms relative to the control group (n ¼ 8) was as follows: G187W 58% (n ¼ 2), K304N 54% (n ¼ 3), R531Q 20% (n ¼ 1), Y556C 60% (n ¼ 1), E757K 86% (n ¼ 1), V776I 161% (n ¼ 1), V854F 96% (n ¼ 1), I866V 78% (n ¼ 4) and T1142M 40% (n ¼ 2). Login to comment
72 Prediction of functional effects of non-synonymous variations In silico analysis of all 10 detected amino acid exchanges revealed that five of them (I18L, K304N, R531Q, E757K, V776I) can be considered benign, whereas others especially near or within transmembrane regions or ATP-binding domains are possibly (G187W, Y556C, V854F, I866V) or in one case (T1142M) even very likely damaging for protein localization and/or function (Figure 3). Login to comment
53 MRP4 protein expression in samples carrying non-synonymous polymorphisms relative to the control group (n &#bc; 8) was as follows: G187W 58% (n &#bc; 2), K304N 54% (n &#bc; 3), R531Q 20% (n &#bc; 1), Y556C 60% (n &#bc; 1), E757K 86% (n &#bc; 1), V776I 161% (n &#bc; 1), V854F 96% (n &#bc; 1), I866V 78% (n &#bc; 4) and T1142M 40% (n &#bc; 2). Login to comment
73 Prediction of functional effects of non-synonymous variations In silico analysis of all 10 detected amino acid exchanges revealed that five of them (I18L, K304N, R531Q, E757K, V776I) can be considered benign, whereas others especially near or within transmembrane regions or ATP-binding domains are possibly (G187W, Y556C, V854F, I866V) or in one case (T1142M) even very likely damaging for protein localization and/or function (Figure 3). Login to comment