ABCA1 p.Val399Ala

[switch to full view]
Comments [show]
Publications
PMID: 20800056 [PubMed] Berge KE et al: "Mutations in APOA-I and ABCA1 in Norwegians with low levels of HDL cholesterol."
No. Sentence Comment
59 of patients (het/hom)a Mutation Nucleotide Exon/Intron (i) PolyPhen prediction (score) SNP rs ID, ref.# ABCA1 Missense 8/3 R219K c.656, GNA 7 Benign (0.489) rs2230806 0/1 R282Q c.845, GNA 9 Benign (0.592) Novel 1/0 V399A c.1196, TNC 11 Benign (0.040) rs9282543 1/0 M636V c.1906, ANG 15 Benign (0.418) Novel 3/0 V771M c.2311, GNA 16 Benign (0.931) rs2066718 2/0 V825I c.2473, GNA 17 Benign (0.440) rs2066715 3/1 I883M c.2649, ANG 18 Benign (0.147) rs2066714 1/0 C887F c.2660, GNT 19 Benign (0.888) Novel 3/0 E1172D c.3516, GNC 24 Benign (0.546) rs33918808 1/0 G1216V c.3647, GNT 25 Prob damb (2.154) Ref. [18] 1/0 L1244Q c.3731, TNA 25 Prob dam (2.269) Novel 1/0 C1477F c.4430, TNA 31 Prob dam (3.688) Ref. [17] 14/1 R1587K c.4760, ANT 35 Benign (0.284) rs2230808 1/0 V1674I c.5020, GNA 37 Benign (0.821) Novel 1/0 R1680Q c.5039, GNA 37 Poss damc (1.926) Ref. [17] 1/0 N1800H c.5398, ANC 40 Poss dam (1.845) Ref. [19] Nonsense/splice 1/0 IVS4+1, GNA c.302+1, GNA i4 - 1/0 C1429X c.4287, CNA 31 - 1/0 IVS32+1, GNA c.4559+1, GNA i32 - APOA-I 7/0 R160L c.551, GNT 4 Prob dam (2.491) Ref. [21] 1/0 del182K del c.616-618 AAG 4 - Novel a Het: heterozygote, hom: homozygote.
X
ABCA1 p.Val399Ala 20800056:59:215
status: NEW
Login to comment

78 Variants R219K, V399A, V771M, V825I, I883M, E1172D, and R1587K have been reported as single nucleotide polymorphisms (SNPs) (Table 1).
X
ABCA1 p.Val399Ala 20800056:78:16
status: NEW
Login to comment

79 Except for V399A, these nonsynonymous SNPs were observed in two or more patients included in this study.
X
ABCA1 p.Val399Ala 20800056:79:11
status: NEW
Login to comment

122 Mutation V399A, for example, was predicted by PolyPhen as benign but was found by Vaughan et al. [24] to reduce cholesterol efflux.
X
ABCA1 p.Val399Ala 20800056:122:9
status: NEW
Login to comment

124 Based on this controversy, we decided to consider V399A in ABCA1 as a normal variant.
X
ABCA1 p.Val399Ala 20800056:124:50
status: NEW
Login to comment

PMID: 18776170 [PubMed] Vaughan AM et al: "ABCA1 mutants reveal an interdependency between lipid export function, apoA-I binding activity, and Janus kinase 2 activation."
No. Sentence Comment
49 the first extracellular loop (V399A, R587W, W590S, and Q597R), two were in the second extracellular loop (C1477R and I1517R), and one was in the Walker A motif of the first nucleotide binding domain (A937V, NBD1) (Fig. 1).
X
ABCA1 p.Val399Ala 18776170:49:30
status: NEW
Login to comment

PMID: 17303779 [PubMed] Kiss RS et al: "Genetic etiology of isolated low HDL syndrome: incidence and heterogeneity of efflux defects."
No. Sentence Comment
47 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N.
X
ABCA1 p.Val399Ala 17303779:47:268
status: NEW
Login to comment

42 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N.
X
ABCA1 p.Val399Ala 17303779:42:268
status: NEW
Login to comment

PMID: 16806540 [PubMed] Saleheen D et al: "A novel haplotype in ABCA1 gene effects plasma HDL-C concentration."
No. Sentence Comment
50 Subjects were classified as having diabetes mellitus if he or she already Table 1 Methods for restriction fragment length polymorphism for screening of ABCA1 SNPs Variant Forward oligo (5VY3V), reverse oligo (5VY3V) Annealing temperature Enzyme Product (bp), wild-type allele, variant allele R219K (G1051A) ''aaagacttcaaggacccagctt``, ''cctcacattccgaaagcatta`` 62.5 -C EcoNI 309, 184, 125 V399A (T1591C) ''ctcattgtctgtgcttctcctc``, ''gtgaccagaaactcacctctcc`` 64.0 -C HphI 117, 71, 48, 188, 48 V771M (G2706A) ''tacaagtgagtgcttgggattg``, ''cccattggaaaagacaatcatc`` 60.0 -C BsaAI 254, 137, 391 V825L (G2868A) ''ttctgcaccttatgattgatcc``, ''agcacaaagaaaggacatcagc`` 62.5 -C BsaI 265, 127, 392 Polymerase chain reaction (PCR) was carried out using a Perkin Elmer GeneAmp PCR system 2400 (Perkin Elmer Corp., Applied Biosystems Division, USA).
X
ABCA1 p.Val399Ala 16806540:50:389
status: NEW
Login to comment

77 R219K, V399A and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides.
X
ABCA1 p.Val399Ala 16806540:77:7
status: NEW
Login to comment

80 R219K, V399A and T774P polymorphisms followed the HWE however V825L and V771M showed a departure from HWE.
X
ABCA1 p.Val399Ala 16806540:80:7
status: NEW
Login to comment

84 Interestingly, V399A Table 2 Characteristics of the study population Total (200) Males (64%) Females (36%) P-value Age1 49.35 (5.0) 49.13 (5.30) 49.93 (4.47) 0.32 HDL-C1 (mmolÀ1 ) 1.05 (0.28) 1.02 (0.27) 1.15 (0.30) 10À2 Cholesterol1 (mmolÀ 1 ) 4.86 (1.16) 4.83 (1.17) 4.95 (1.13) 0.53 Triglycerides1 (mmolÀ1 ) 1.89 (1.17) 1.93 (1.24) 1.79 (0.94) 0.42 LDL-C1 (mmolÀ1 ) 3.09 (0.95) 3.08 (0.97) 3.14 (0.91) 0.67 Hypertension2 22.1% 20.1% 27.3% 0.27 Diabetes mellitus2 11.1% 12.5% 7.3% 0.29 Smoking status2 17.1% 22.9% 1.8% 10À4 Variables1 are expressed in mean (S.D.).
X
ABCA1 p.Val399Ala 16806540:84:15
status: NEW
Login to comment

97 South Asian populations (from Pakistan, India, Bangladesh and Sri Lanka) represent a quarter of the developing world and harbor thirty percent of the global Table 4 Haplotype association analysis of the ABCA1 gene polymorphisms in relation with the HDL-C levels Haplotype Haplotype frequencies Haplotypic additive effects [95% CI] P-value R219K RV 0.47 + V825L RL 0.18 À0.12 [À0.22 to À0.03] 0.001 KV 0.28 À0.04 [À0.10 to 0.01] 0.15 KL 0.06 0.08 [À0.06 to 0.22] 0.25 T774P TV 0.21 0.03 [À0.05 to 0.12] 0.41 V825L TL 0.09 0.10 [À0.06 to 0.27] 0.22 PV 0.47 + PL 0.21 À0.06 [À0.14 to 0.02] 0.15 R219K RM 0.55 + V771M RV 0.07 À0.13 [À0.45 to 0.19] 0.41 KM 0.34 À0.02 [À0.09 to 0.05] 0.54 KV 0.04 0.07 [À0.12 to 0.27] 0.46 Table 3 Mean HDL-C levels (S.D.) for the genotypes and alleles of the studied polymorphisms Frequencies HDL-C (S.D.) b (95% CI) P-value R219K RR 39.8 1.06 (0.30) À0.02 (À0.16 to 0.13) 0.85 RK 46.0 1.10 (0.28) 0.00 (À0.14 to 0.14) 0.99 KK 14.3 1.10 (0.31) + R 62.7 1.08 (0.26) 0.01 (À0.05 to 0.07) 0.79 K 37.3 1.09 (0.31) V399A AA 6.0 1.01 (0.23) À0.03 (À0.24 to 0.16) 0.70 AV 34.7 1.11 (0.28) 0.10 (À0.04 to 0.16) 0.22 VV 59.3 1.04 (0.31) + A 23.3 1.09 (0.28) À0.03 (À0.10 to 0.05) 0.58 V 76.7 1.04 (0.31) T774P PP 9.6 1.10 (0.31) 0.20 (0.01 to 0.40) 0.03 PT 37.5 1.03 (0.32) 0.13 (À0.03 to 0.20) 0.14 TT 52.9 0.97 (0.28) + P 28.4 1.05 (0.32) À0.15 (À0.18 to À0.02) 0.01 T 71.6 0.99 (0.29) V771M MM 6.1 1.09 (0.30) 0.01 (À0.24 to 0.25) VM 10.1 0.98 (0.24) À0.07 (À0.27 to 0.12) 0.46 VV 83.8 1.07 (0.29) + 0.94 M 11.1 1.04 (0.27) 0.03 (À0.10 to 0.15) 0.71 V 88.9 1.07 (0.29) V825L LL 9.8 0.89 (0.299) À0.17 (À0.32 to À0.19) 0.02 LV 32.8 1.06 (0.265) À0.03 (À0.11 to 0.076) 0.70 VV 57.5 1.07 (0.30) + L 26.1 1.07 (0.29) 0.10 (À0.00 to .13) 0.05 V 73.9 1.00 (0.28) P-values are adjusted for age and gender.
X
ABCA1 p.Val399Ala 16806540:97:1032
status: NEW
X
ABCA1 p.Val399Ala 16806540:97:1134
status: NEW
Login to comment

115 Similarly, a lack of association of V399A and V771M polymorphisms is consistent with the published literature [28].
X
ABCA1 p.Val399Ala 16806540:115:36
status: NEW
Login to comment

PMID: 16704350 [PubMed] Brunham LR et al: "Variations on a gene: rare and common variants in ABCA1 and their impact on HDL cholesterol levels and atherosclerosis."
No. Sentence Comment
605 Many of these variants have been studied in relationship to their association with HDL cholesterol levels and atherosclerosis (11, 15, 22, 27, 28, 38, TABLE 4 Nonsynonymous single-nucleotide polymorphisms (SNPs) in ABCA1 SNP id Nucleotidea Amino acidb Observed heterozygosity rs2230806 G969A R219K 0.488 rs9282541 C1001T R230C 0.029 rs9282543 T1509C V399A 0.020 rs4131108 A1556C M415L - rs13306068 A1949G I546V - rs2066718 G2624A V771M 0.074 rs2472458 G2804A D831N - rs4149313 A2962G I883M - rs2482437 C3326T E1005K - rs13306072 G3473A V1054I - rs13306073 G3599A V1096I - rs1997618 T4977C I1555T - rs2230808 A5073G K1587R 0.480 rs1883024 T5256C L1648P - - C5505G S1731C - a Nucleotide position is with respect to NM 005502. b Amino acid position is with respect to NP 005493.
X
ABCA1 p.Val399Ala 16704350:605:353
status: NEW
Login to comment

PMID: 16429166 [PubMed] Brunham LR et al: "Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene."
No. Sentence Comment
48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes.
X
ABCA1 p.Val399Ala 16429166:48:352
status: NEW
X
ABCA1 p.Val399Ala 16429166:48:367
status: NEW
Login to comment

PMID: 12763760 [PubMed] Singaraja RR et al: "Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene."
No. Sentence Comment
136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I.
X
ABCA1 p.Val399Ala 12763760:136:401
status: NEW
Login to comment

148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2).
X
ABCA1 p.Val399Ala 12763760:148:168
status: NEW
Login to comment

128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I.
X
ABCA1 p.Val399Ala 12763760:128:416
status: NEW
Login to comment

140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2).
X
ABCA1 p.Val399Ala 12763760:140:165
status: NEW
Login to comment

PMID: 12840658 [PubMed] Miller M et al: "Genetics of HDL regulation in humans."
No. Sentence Comment
66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.]
X
ABCA1 p.Val399Ala 12840658:66:15
status: NEW
Login to comment

PMID: 11238261 [PubMed] Clee SM et al: "Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease."
No. Sentence Comment
44 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed.
X
ABCA1 p.Val399Ala 11238261:44:14
status: NEW
Login to comment

48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site.
X
ABCA1 p.Val399Ala 11238261:48:458
status: NEW
Login to comment

85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened.
X
ABCA1 p.Val399Ala 11238261:85:166
status: NEW
Login to comment

118 Heterozygous carriers of V399A had a trend toward higher HDL-C compared with noncarriers.
X
ABCA1 p.Val399Ala 11238261:118:25
status: NEW
Login to comment

127 A depicts the relationship between HDL-C and age in R219K carriers (RKϩKK; dashed line) compared with noncarriers (RR; solid line).
X
ABCA1 p.Val399Ala 11238261:127:12
status: NEW
Login to comment

132 Carriers of V399A had half the frequency of a positive family history of CAD (22.2% versus 49.4%, Pϭ0.18) and trends toward an increased baseline MOD (Table 6) and less progression in MSD (-0.05Ϯ0.10 versus 0.08Ϯ0.19 mm in noncarriers, Pϭ0.16) during the trial.
X
ABCA1 p.Val399Ala 11238261:132:12
status: NEW
Login to comment

156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D.
X
ABCA1 p.Val399Ala 11238261:156:646
status: NEW
Login to comment

161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n).
X
ABCA1 p.Val399Ala 11238261:161:646
status: NEW
Login to comment

179 In heterozygotes, the phenotype is more pronounced in older individuals.9 This suggests that ABCA1 activity may normally increase with age but that this is blunted in R219K heterozygotes.
X
ABCA1 p.Val399Ala 11238261:179:13
status: NEW
Login to comment

180 Age-related increases in the expression and activity of P-glycoprotein, another ATP-binding cassette transporter, have been described.22,23 In the present study, we show that the R219K polymorphism was also associated with an altered relationship between age and HDL-C.
X
ABCA1 p.Val399Ala 11238261:180:27
status: NEW
Login to comment

184 Of note, the V399A and I883M variants were shown to cosegregate on a mutation-bearing chromosome in one of the initial Tangier families described.6 The authors suggested that 1 of these 2 variants was likely the functional mutation.
X
ABCA1 p.Val399Ala 11238261:184:13
status: NEW
Login to comment

185 Yet, here we show that the V399A variant was associated with a trend toward increased HDL-C.
X
ABCA1 p.Val399Ala 11238261:185:27
status: NEW
Login to comment

39 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed.
X
ABCA1 p.Val399Ala 11238261:39:14
status: NEW
Login to comment

43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site.
X
ABCA1 p.Val399Ala 11238261:43:457
status: NEW
Login to comment

80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened.
X
ABCA1 p.Val399Ala 11238261:80:166
status: NEW
Login to comment

113 Heterozygous carriers of V399A had a trend toward higher HDL-C compared with noncarriers.
X
ABCA1 p.Val399Ala 11238261:113:25
status: NEW
Login to comment