ABCMdb

ABCB1 p.Pro1051Ala

None has been submitted yet.

Publications

PMID: 15882131 [PubMed] Lepper ER et al: "Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2."

No. Sentence Comment

126 In addition to the possible decrease in expression levels, ATPase activity in the ABCG2 +24 Intron 20 G A +40 Intron 20 C T 2547 Exon 21 A G 849 Ile to Met 2650 Exon 21 C T 884 Syn 2677 Exon 21 G T 893 Ala to Ser 2677# Exon 21 G A 893 Ala to Thr +31 Intron 22 G A 2956 Exon 24 A G 986 Met to Val 2995 Exon 24 G A 999 Ala to Thr 3151 Exon 25 C G 1051 Pro to Ala 3320 Exon 26 A C 1107 Gln to Pro 3322 Exon 26 T C 1108 Trp to Arg 3396 Exon 26 C T 1132 Syn 3421 Exon 26 T A 1141 Ser to Thr 3435** Exon 26 C T 1145 Syn 3751 Exon 28 G A 1251 Val to Ile 3767 Exon 28 C A 1256 Thr to Lys 4030 Exon 28 G C Non-coding 4036 Exon 28 A G Non-coding +21 Intron 28 T C Table 2. Summary of common genetic variants in the ABCB1 gene (continued) *cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758 with an A as the reference at position 43. Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."

No. Sentence Comment

106 Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % 61 A G 21 Asn 21 Asp 799 89.7 10.3 193 100 0 100 97.5 2.5 266 T C 89 Met 89 Thr 100 99.5 0.5 145 100 0 100 100 0 307 T C 103 Phe 103 Leu 546 99.9 0.1 48 100 0 ND ND ND 325 G A 108 Glu 108 Lys ND ND ND 37 95.9 4.1 ND ND ND 781 A G 261 Ile 261 Val 100 100 0 145 100 0 100 98.5 1.5 1199 G A 400 Ser 400 Asn 696 95.0 5.0 193 100 0 100 99 1 1985 T G 662 Leu 662 Arg 100 99.5 0.5 145 100 0 100 100 0 2005 C T 669 Arg 669 Cys 100 100 0 145 100 0 100 99 1 2485 A G 829 Ile 829 Val 185 99.2 0.8 ND ND ND ND ND ND 2547 A G 849 Ile 849 Met 100 99.5 0.5 145 100 0 100 100 0 2677 G T A 893 Ala 893 Ser 893 Thr 611 55.1 42.1 2.8 241 40.0 41.1 18.9 100 90 10 0.5 2956 A G 986 Met 986 Val ND ND ND 100 99.5 0.5 ND ND ND 3151 C G 1051 Pro 1051 Ala 100 100 0 145 100 0 100 99.5 0.5 3320 A C 1107 Gln 1107 Pro 461 99.8 0.2 ND ND ND ND ND ND 3322 T C 1108 Trp 1108 Arg 100 100 0 145 100 0 100 99.5 0.5 3421 T A 1141 Ser 1141 Thr 100 100 0 145 100 0 100 88.9 11.1 3751 G A 1251 Val 1251 Ile 100 100 0 145 99 1 100 100 0 3767 C A 1256 Thr 1256 Lys 100 99.5 0.5 145 100 0 100 100 0 Data from [31-38, 203]. Login to comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis. Login to comment
124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity. Login to comment
129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2. Login to comment

PMID: 16399366 [PubMed] Ishikawa T et al: "High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics."

No. Sentence Comment

167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis. Login to comment

PMID: 18855611 [PubMed] Zhou SF et al: "Clinical pharmacogenetics and potential application in personalized medicine."

No. Sentence Comment

532 Nucleotide change rs number Amino acid change 49T>C rs28381804 F17L 61A>G rs61615398; rs9282564 N21D 131A>G rs1202183 N44S 178A>C rs41315618 I60L 239C>A rs9282565 A80E 266T>C Rs35810889 M89T 431T>C rs61607171 I144T 502G>A rs61122623 V168I 548A>G rs60419673 N183S 554G>T rs1128501 G185V 781A>G rs36008564 I261V 1199G>A rs2229109 S400N 1696G>A rs28381902 E566K 1777C>T rs28381914 R593C 1778G>A rs56107566 R593H 1795G>A rs2235036 A599T 1837G>T rs57001392 D613Y 1985T>G rs61762047 L662R 2005C>T rs35023033 R669C 2207A>T rs41316450 I736K 2398G>A rs41305517 D800N 2401G>A rs2235039 V801M 2485A>G rs2032581 I829V 2506A>G rs28381967 I836V 2547A>G rs36105130 I849M 2677T>A/G rs2032582 S893A/T 2975G>A rs56849127 S992N 3151C>G rs28401798 P1051A 3188G>C rs2707944 G1063A 3262G>A rs57521326 D1088N 3295A>G rs41309225 K1099E 3320A>C rs55852620 Q1107P 3322T>C rs35730308 W1108R 3410G>T rs41309228 S1137I 3421T>A rs2229107 S1141T 3502A>G rs59241388 K1168E 3669A>T rs41309231 E1223D 3751G>A rs28364274 V1251I 3767C>A r35721439 T1256K Data are from NCBI dbSNP (access date: 2 August 2008). Login to comment

PMID: 12893986 [PubMed] Kroetz DL et al: "Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene."

No. Sentence Comment

103 A total of 30 segregating sites have not been previously described, including eight non-synonymous changes coding for the following amino acid changes: Met89Thr, Leu662Arg, Arg669Cys, Ile849Met, Pro1051Ala, Trp1108Arg, Val1251Ile, and Thr1256Lys. Login to comment
111 These ten variants included five non-synonymous sites (Ile261Val, Leu662Arg, Pro1051Ala, Ser1141Thr, and Thr1256Lys). Login to comment
141 Unauthorized reproduction of this article is prohibited. Table 1 Genetic variation in ABCB1 Allele frequencyd Variant cDNA NT DNA/AA AA Total CA AA AS ME PA No.a positionb changec position change (n ¼ 494) (n ¼ 200) (n ¼ 200) (n ¼ 60) (n ¼ 20) (n ¼ 14) 1.1Ã (À274) G to A Intron À1 0.006 0 0.016 0 0 0 1.2Ã (À223) C to T Intron À1 0.002 0.005 0 0 0 0 1.3Ã (À146) T to C Intron À1 0.002 0 0.005 0 0 0 1.4Ã (À60) A to T Intron À1 0.004 0 0.010 0 0 0 1.5 (À41) A to G Intron À1 0.002 0 0 0.017 0 0 1.6Ã À241 G to A Non-coding 0.002 0 0 0.017 0 0 1.7 À145 C to G Non-coding 0.002 0 0 0.017 0 0 1.8 À129 T to C Non-coding 0.060 0.051 0.071 0.036 0.100 0.071 1.9 À43 A to G Non-coding 0.012 0 0.020 0.036 0 0 1.10Ã (+140) C to A Intron 1 0.013 0.005 0.021 0 0 0.071 1.11Ã (+237) G to A Intron 1 0.004 0 0.010 0 0 0 2.1 À4 C to T Non-coding 0.004 0 0.010 0 0 0 2.2 À1 G to A Non-coding 0.036 0.080 0.005 0 0.050 0 2.3 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 4.1Ã (À8) C to G Intron 3 0.002 0.005 0 0 0 0 4.2Ã 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 5.1 (À25) G to T Intron 4 0.210 0.158 0.300 0.067 0.200 0.286 8.1 729 A to G 243 Syn 0.002 0.005 0 0 0 0 8.2Ã 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 10.1Ã (À44) A to G Intron 9 0.400 0.450 0.255 0.685 0.450 0.571 11.1Ã (À41) T to G Intron 10 0.002 0 0 0.017 0 0 11.2 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 12.1Ã (À4) G to A Intron 11 0.002 0 0.005 0 0 0 12.2 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 12.3Ã 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 12.4Ã (+17) G to A Intron 12 0.008 0 0.020 0 0 0 12.5 (+44) C to T Intron 12 0.088 0.046 0.168 0 0 0 13.1 (+24) C to T Intron 13 0.530 0.521 0.542 0.540 0.450 0.571 14.1 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 14.2 (+38) A to G Intron 14 0.540 0.505 0.540 0.683 0.450 0.500 15.1 (+38) G to A Intron 15 0.004 0.005 0.005 0 0 0 16.1Ã 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 16.2Ã 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 18.1Ã (À27) A to G Intron 17 0.008 0.010 0.005 0 0.050 0 20.1Ã (+8) C to G Intron 20 0.002 0 0.005 0 0 0 20.2 (+24) G to A Intron 20 0.126 0.121 0.150 0.067 0.200 0 20.3Ã (+40) C to T Intron 20 0.014 0 0.035 0 0 0 21.1Ã 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 21.2 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 21.3a 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 21.3b 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 22.1 (+31) G to A Intron 22 0.002 0 0.005 0 0 0 25.1Ã 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 26.1Ã 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 26.2 3421 T to A 1141 Ser toThr 0.047 0 0.111 0 0.050 0 26.3 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 28.1 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 28.2 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 28.3 (+21) T to C Intron 28 0.031 0 0.077 0 0 0 a Variants are numbered sequentially by exon. Login to comment

PMID: 15212152 [PubMed] Pauli-Magnus C et al: "Functional implications of genetic polymorphisms in the multidrug resistance gene MDR1 (ABCB1)."

No. Sentence Comment

28 6, June 2004 ((c) 2004) 9040724-8741/04/0600-0904/0 (c) 2004 Plenum Publishing Corporation Table I. MDR1 Coding Variants cDNA positiona NT change DNA/AA position AA change Allele frequencyb Total (n ‫ס‬ 494) CA (n ‫ס‬ 200) AA (n ‫ס‬ 200) AS (n ‫ס‬ 60) ME (n ‫ס‬ 20) PA (n ‫ס‬ 14) 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 729 A to G 243 Syn 0.002 0.005 0 0 0 0 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 3421 T to A 1141 Ser to Thr 0.047 0 0.111 0 0.050 0 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 a cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758. Login to comment

PMID: 15499174 [PubMed] Ozawa S et al: "Ethnic differences in genetic polymorphisms of CYP2D6, CYP2C19, CYP3As and MDR1/ABCB1."

No. Sentence Comment

85 Ethnic dierences in nonsynonymous SNPs of ABCB1W MDR1 cDNA positiona Position and amino acid change C AA AS J 61AÀG N21D 0.080 0.025 0.017 0 266TÀC M89T 0.005 0 0 0 781AÀG I261V 0 0.015 0 0 1199GÀA S400N 0.025 0.010 0 0 1985TÀG L662R 0.005 0 0 0 2005CÀT R669C 0 0.010 0 0 2547AÀG I849M 0.005 0 0 0 2677GÀT A893S 0.464 0.100 0.450 0.403 2677GÀA A893T 0.036 0.005 0.067 0.200 3151CÀG P1051A 0 0.005 0 0 3322TÀC W1108R 0 0.005 0 0 3421TÀA S1141T 0 0.111 0 0 3751GÀA V1251I 0 0 0 0.010 3767CÀA T1256K 0.005 0 0 0 C, 100 Caucasians; AA, 100 African-Americans; AS, 30 Asians; J, 145 Japanese (our study 116) ). Login to comment

PMID: 17352537 [PubMed] Jeong H et al: "Function-altering SNPs in the human multidrug transporter gene ABCB1 identified using a Saccharomyces-based assay."

No. Sentence Comment

81 In addition, the P1051A SNP was chosen because of its conservation despite a low Grantham value, and the S1141T SNP was included due to its relatively high allele frequency (11% in African Americans) and evolutionary conservation. Login to comment
92 Features of the ABCB1 Variants Analyzed in This Study SNPa Evolutionary Conservationb Chemical Dissimilarity (Grantham Valuec ) Allele Count (out of 494 Alleles) M89T 0 81 1 L662R 3 102 1 R669C 2 180 2 A893S 2 99 151 P1051A 3 27 1 W1108R 3 101 1 S1141T 3 58 23 a Positions are relative to the transcription start site and based on the cDNA sequence from GenBank accession number M14758.1 with the change V185G, which is the most common haplotype in African Americans in the Pharmacogenetics of Membrane Transporters dataset. Login to comment
109 Different P-gp variants displayed higher levels of resistance (A893S-M89T, L662R, and R669C) or lower levels of resistance (A893S, S1141T, A893S-R669C, A893S-P1051A, W1108R, and W1108R-R669C) relative to the P-gp reference (Figure 2A and 2B). Login to comment
129 The average 6 standard deviation of three measurements of relative protein levels is 103 6 19 for A893S, 83 6 17 for S1141T, 94 6 16 for A893S-R669C, 115 6 20 for A893S-M89T, 93 6 19 for L662R, 70 6 22 for A893S-P1051A, 134 6 25 for R669C, 102 6 18 for W1108R, 148 6 24 for R669C-W1108R, and 53 6 13 for frame-shifted, relative to the average of reference P-gp set to 100. Login to comment
166 The A893S and A893S-P1051A variants caused an increase in resistance only for doxorubicin and valinomycin, respectively. Login to comment
194 Our data on functional consequences revealed that these predictions were sound: four functional SNPs (L662R, R669C, W1108R, and S1141T) scored highly on both criteria, while the two SNPs (A893S and P1051A) that showed no significant functional impact had lower scores on evolutionary conservation and chemical dissimilarity, respectively. Login to comment

PMID: 17559192 [PubMed] Sakurai A et al: "Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1)."

No. Sentence Comment

1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. Login to comment
38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis. Login to comment
53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944). Login to comment
80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse. Login to comment
142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures. Login to comment
180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts. Login to comment
186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6). Login to comment
187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6. Login to comment
189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6. Login to comment
269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function. Login to comment
273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance). Login to comment
293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5. Login to comment
316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1. Login to comment
340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined. Login to comment

PMID: 21619426 [PubMed] Stieger B et al: "Pharmacogenetics of drug transporters in the enterohepatic circulation."

No. Sentence Comment

91 Gene name Transporter SNP Protein Population size (n) Invitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transportactivity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transportactivity [202] c.3151C>G p.P1051A N/A Increased transport activity (substratedependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression invitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells invitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPaseactivity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment
94 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transport activity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transport activity [202] c.3151C>G p.P1051A N/A Increased transport activity (substrate dependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression in vitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells in vitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPase activity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment

PMID: 21625253 [PubMed] Wolf SJ et al: "An update on ABCB1 pharmacogenetics: insights from a 3D model into the location and evolutionary conservation of residues corresponding to SNPs associated with drug pharmacokinetics."

No. Sentence Comment

48 Four of the 12 associated nsSNPs (E3/61A4G, E5/266C4T, E17/1985T4C and E17/2005C4T) cannot be mapped to the mouse crystal Table 1 Genetic conservation of amino acids corresponding to ABCB1 coding region SNPs 1 - rs28381804 E3/49T>C (F17L) F17 W16 S16 Y17 Y35 F39 - A42 - - G11 - - 2 - rs41304191 E3/55C>T (L19L) L19 M18 M18 I19 G37 P41 - E44 - - L13 - - 3 - rs76199854 E3/57G>A (L19L) L19 M18 M18 I19 G37 P41 - E44 - - L13 - - --51I--64H-34K93N12N02K02K12N)D12N(G>A16/3E4652829sr-4 7.832.8105P12A01K88D61D18T07T55S34G34N44N)S44N(G>A131/5E3812021sr1sn5 6 ns2 rs41315618 E5/178A>C (I60L) I60 I59 I59 A71 I86 A97 G32 G104 K26 N37 L66 27.3 46.6 1.924.6368N75G64N421Y25G711I601I19V97A97A08A)E08A(A>C932/5E5652829sr3sn7 8 - rs35810889 E5/266C>T (M89T) - M89 F89 S85 T96 I112 - - - - - - - - 9 ns4 rs61607171 E7/431T>C (I144T) TM2 I144 I145 I140 V152 N168 I176 A98 A172 L93 V97 L124 36.4 40.9 2.645.45841G121T711V691A221T002S291S671A461V961V861V)I861V(A>G205/7E32622116sr5sn01 11 s1 rs1128500 E8/540C>T (S180S) S180 S181 S176 S188 E204 S212 L136 N208 E129 E133 E160 27.3 42.0 12 ns6 rs60419673 E8/548A>G (N183S) N183 N184 N179 N191 K207 E215 Q139 Q211 K132 A136 S163 27.3 39.9 9.045.54561G831S431F312G141F712G902G391G181G681G581G)V581G(T>G455/8E1058211sr7sn31 14 s2 rs1128502 E8/555A>T (G185G) G185 G186 G181 G193 G209 G217 F141 G213 F134 S138 G165 45.5 40.9 15 s3 rs2235022 E9/729A>G (E243E) E243 E244 E239 E251 E267 E275 I199 Q271 R192 M196 S223 18.2 33.3 16 s4 rs28381867 E9/738G>A (A246A) A246 A247 A242 A254 R270 M278 E202 V274 A195 T199 Y226 9.1 34.5 17 ns8 rs36008564 E9/781A>G (I261V) C-NBD (Internal) I261 I262 I257 V267 I285 I293 V217 I289 I210 H214 I241 36.4 50.3 18 s5 rs80153317 E10/879T>C (I293I) TM5 I293 I294 I289 I301 L317 M325 L249 I321 R242 S246 F273 18.2 36.3 19 ns9 rs2229109 E12/1199G>A (S400N) N-NBD (Internal) S400 S401 S396 N408 T424 Q439 T355 V428 Q348 T350 H386 18.2 60.7 20 s6 rs1128503 E13/1236C>T (G412G) N-NBD (External) G412 G413 G408 G420 G436 K451 D367 N440 D359 N361 D398 27.3 55.9 21 s7 rs35068177 E13/1308A>G (T436T) T436 T437 T432 T44 I460 C475 V391 I464 L383 I385 I422 54.5 64.6 22 s8 rs41311775 E15/1326G>A (R442R) R442 R443 R438 R450 R466 R481 R397 R470 R389 R391 R428 100.0 54.5 23 s9 rs35633772 E15/1617C>T (I539I) I539 I540 I535 I547 I563 I578 I494 I576 L486 I489 I571 90.9 65.8 24 s10 rs60247941 E15/1632C>T (A544A) A544 A545 A540 A552 A568 A583 A499 A581 I491 A494 A576 63.6 65.1 25 s11 rs2235012 E15/1662G>C (L554L) L554 L555 L550 L562 L578 L593 L509 L591 L501 L504 L586 100.0 73.6 26 s12 rs56871767 E15/1674G>A (T558T) T558 T559 T554 T566 T582 T597 T513 T595 T505 T508 T590 100.0 78.7 27 s13 rs59697741 E15/1695C>T (S565S) S565 S566 S561 S573 S589 S604 S520 S602 S512 S515 S597 100.0 75.4 28 ns10 rs28381902 E15/1696G>A (E566K) E566 E567 E562 E574 E590 E605 E521 E603 E513 E516 E598 100.0 76.6 29 ns11 rs28381914 E16/1777C>T (R593C) R593 R594 R589 R601 R617 R632 R548 R630 T540 E543 R627 54.5 67.3 30 ns12 rs56107566 E16/1778G>A (R593H ) R593 R594 R589 R601 R617 R632 R548 R630 T540 E543 R627 54.5 67.3 31 s14 rs28381915 E16/1794C>T (I598I) I598 I599 I594 I606 I622 I637 I553 I635 I545 I548 I632 100.0 65.5 32 ns13 rs2235036 E16/1795G>A (A599T) A599 A600 A595 A607 I623 V638 C554 V636 V546 V549 F633 54.5 63.6 33 ns14 rs57001392 E16/1837G>T (D613Y) N-NBD (External) D613 D614 D609 S621 R637 Q652 E568 N650 R560 N563 D677 45.5 60.5 -0.0637E--807A516E896K496M176E856L366L266L)R266L(C>T5891/71E06975653sr-43 35 - rs35023033 E17/2005C>T (R669C) R669 R670 R665 R678 I702 D705 S662 T715 - - N743 0.0 - 36 - rs59340265 E17/2037C>T (D679D) D679 D680 D675 N688 D712 N715 S632 N725 - - E753 9.1 - 37 ns15 rs41316450 E18/2207T>A (I736K) TM7 I736 I737 V732 I745 M779 I771 V682 I820 I37 L48 V814 72.7 36.7 38 ns16 rs77144566 E19/2281A>C (A761S) TM8 A761 V763 I757 A769 V802 I796 G706 I844 I647 G655 L836 63.6 42.1 39 ns17 rs41305517 E21/2398G>A (D800N) C-NBD (Internal) D800 D801 D796 D808 H841 D835 E745 D883 S108 P112 E875 9.1 45.4 40 ns18 rs2235039 E21/2401G>A (V801M) C-NBD (External) V801 V802 V797 M809 I842 V836 V746 V884 A109 V113 M876 63.6 47.6 2.035.54409L931S531I219S447V468T078I738T528T038I928I)V928I(G>A5842/22E1852302sr91sn14 42 s15 rs28381966 E22/2505A>G (V835V) V835 V836 V831 L843 T876 T870 L780 T918 N141 T145 F911 45.5 33.0 43 ns20 rs28381967 E22/2506A>G (I836V) I836 I837 I832 I844 V877 I871 L781 V919 I142 V146 F911 63.6 28.5 7.448.18429M951M551I239L497I488D098I758I548I058I948I)M948I(G>A7452/22E03150163sr12sn44 45 s16 rs9282563 E22/2650C>T (L884L) L884 L885 L880 K892 V925 M919 R829 E967 R190 K194 I959 27.3 31.2 7.535.54289P302V991V679S838S829C439S109A988S498A398S)T/A398S(A/T>G7762/22E2852302sr22sn64 4.834.631801M203T892V5701F739G7201L5301T0001S889S399S299S)N299S(A>G5792/52E72194865sr32sn74 5.633.729801E903Q503T2801T449V4301Q2401A7001A599A0001A999A)T999A(A>G5992/52E48725527sr42sn84 49 s17 rs2235044 E26/3084G>A (P1028P) P1028 P1029 P1024 P1036 - P1063 P973 V1111 P332 V334 I1117 0.0 33.0 50 ns25 rs28401798 E26/3151C>G (P1051A) P1051 P1052 P1047 K1059 E1093 Q1086 I996 K1135 P355 P357 P1142 18.2 57.6 51 ns26 rs2707944 E26/3188G>C (G1063A) G1063 G1064 G1059 G1071 G1105 G1098 G1008 G1147 G367 G369 K1154 45.5 53.8 52 s18 rs2707943 E26/3189C>G (G1063G) G1063 G1064 G1059 G1071 G1105 G1098 G1008 G1147 G367 G369 K1154 45.5 53.8 53 ns27 rs74755520 E26/3222A>C (C1074W) C-NBD (Internal) C1074 C1075 C1070 C1082 C1116 C1109 S1019 C1158 G378 S380 S1165 63.6 67.8 54 ns28 rs57521326 E26/3262G>A (D1088N) D1088 D1089 D1084 D1096 D1130 D1123 D1033 D1172 D392 D394 D1179 100.0 53.9 55 ns29 rs41309225 E27/3295A>G (K1099E) K1099 K1100 K1095 I1107 S1141 C1134 R1044 V1183 H403 H405 I1237 18.2 38.5 56 ns30 rs55852620 E27/3320A>C (Q1107P) Q1107 Q1108 Q1103 Q1115 E1149 T1142 R1052 N1191 G411 A413 R1245 27.3 43.7 57 ns31 rs35730308 E27/3322T>C (W1108R) W1108 Q1109 W1104 Q1116 H1150 N1143 S1053 D1192 S412 S414 D1246 27.3 43.5 58 s19 rs34748655 E27/3396C>T (A1132A) C-NBD (Internal) A1132 A1133 A1128 A1140 I1174 S1167 M1077 V1216 L436 A438 K1270 27.3 56.8 59 ns32 rs41309228 E27/3410G>T (S1137I ) S1137 S1138 S1133 S1145 P1179 A1172 S1082 S1220 P440 E443 - 18.2 41.8 60 ns33 rs2229107 E27/3421T>A (S1141T) S1141 S1142 S1137 S1149 T1183 T1176 D1086 S1224 D444 R447 T1277 45.5 50.9 61 s20 rs1045642 E27/3435C>T (I1145I) C-NBD (Internal) I1145 I1146 I1141 I1153 V1187 I1180 I1090 M1228 V447 I450 V1281 72.7 57.6 62 ns34 rs59241388 E28/3502A>G (K1168E) K1168 R1169 R1164 R1176 R1210 R1203 C1113 L1251 E470 V473 N1304 27.3 61.9 63 ns35 rs41309231 E29/3669A>T (E1223D) E1223 E1224 E1219 E1231 E1265 E1258 V1168 Q1306 K525 K528 D1359 27.3 60.2 64 s21 rs2235051 E29/3747C>G (G1249G) C-NBD (Internal) G1249 G1250 G1245 G1257 G1291 G1284 G1194 G1332 G551 G554 T1392 63.6 63.0 65 ns36 rs45456698 E29/3751G>A (V1251I) V1251 V1252 V1247 V1259 I1293 V1286 V1196 I1334 I553 I556 V1394 81.8 59.2 4.957.279931T165T855T9331T1021N1921D8921T4621T2521T7521T6521T)K6521T(A>C7673/92E93412753sr73sn66 C-NBD (External) C-NBD (External) C-NBD (External) C-NBD (External) TM4 - TM9 TM10 - TM1 S. aureus TM12 N-NBD (Internal) N-NBD (External) N-NBD (Internal) C-NBD (External) TM3 C. elegans D. melanoga ster A. thaliana S. pombe # SNP (amino acid substitution) Mapped to Abcb1a domain (internal/external surface) rsNo Conservation (%)a H. Sapiens C. l. Familiaris M. Musculus G. gallus P. falciparum Amino acid residue housing SNP Individual Regional 3 structure E. coli a The conservation of residues corresponding to all coding regions SNPs was obtained following multiple sequence alignment of 11 confirmed ABCB1 homolog protein sequences. Login to comment
120 Majority of the other SNPs previously associated with drug pharmacokinetics that could be mapped to the crystal structure reside at the outer surface of the C-terminal NBD Of the eight remaining SNPs to have been associated with drug response or expression, four can be mapped to the mouse Abcb1a crystal structure based on pair-wise alignment (Supplementary Figure 1).24,25 These are E26/3151C4G (P1051A) (#ns25), E27/3322T4C (W1108R) (#ns31), E27/ 3421T4A (S1141T) (#ns33) and E29/3751G4A (V1251I) (#ns36) (Figure 2b). Login to comment
124 We highlight the E26/3151C4G (#ns25) SNP, which is translated to P1051A substitution (Figures 2b and 4c). Login to comment
125 This Figure 4 Location and conservation of (a) E8/554G4T (G185V), (b) E12/1199G4A (S400N), (c) E26/3151C4G (P1051A), (d) E27/3322T4C (W1108R), (e) E27/3421T4A (S1141T), (f) E29/3751G4A (V1251I). Login to comment
142 Hence, of these several SNPs that had been previously associated with functional differences, most of them (E26/3151C4G (P1051A) (#ns25), E27/3421T4A (S1141T) (#ns33) and E29/3751G4A (V1251I) (#ns36) reside at the outer surface of the C-terminal NBD except for SNP E27/ 3322T4C (W1108R) (#ns31), which resides within the interior of the C-terminal NBD (Table 1, Figure 2b and flash movie http://pfs.nus.edu.sg/demo_src/abcb1.html). Login to comment

PMID: 20799350 [PubMed] Kelly L et al: "Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains."

No. Sentence Comment

72 Predictions of the Functional Effects of 40 nsSNPs in ABC Transporters Comon name HUGO name Mutation NBD Prediction BSEP ABCB11 E592Q NBD1 Neutral BSEP ABCB11 N591S NBD1 Neutral BSEP ABCB11 Q558H NBD1 Neutral BSEP ABCB11 V444A NBD1 Neutral BSEP ABCB11 E1186K NBD2 Disease MDR1 ABCB1 P1051A NBD2 Neutral MDR1 ABCB1 S1141T NBD2 Neutral MDR1 ABCB1 T1256K NBD2 Disease MDR1 ABCB1 V1251I NBD2 Neutral MDR1 ABCB1 W1108R NBD2 Disease MRP2 ABCC2 I670T NBD1 Disease MRP2 ABCC2 L849R NBD1 Disease MRP2 ABCC2 C1515Y NBD2 Disease MRP3 ABCC3 D770N NBD1 Neutral MRP3 ABCC3 K718M NBD1 Neutral MRP3 ABCC3 T809M NBD1 Disease MRP3 ABCC3 V765L NBD1 Disease MRP3 ABCC3 Q1365R NBD2 Disease MRP3 ABCC3 R1297H NBD2 Disease MRP3 ABCC3 R1348C NBD2 Disease MRP3 ABCC3 R1381S NBD2 Disease MRP4 ABCC4 G487E NBD1 Disease MRP4 ABCC4 K498E NBD1 Neutral MRP4 ABCC4 R1220Q NBD2 Neutral MRP4 ABCC4 T1142M NBD2 Neutral MRP4 ABCC4 V1071I NBD2 Neutral MRP6 ABCC6 I1330L NBD1 Neutral MRP6 ABCC6 I742V NBD1 Neutral MRP6 ABCC6 P664S NBD1 Neutral MRP6 ABCC6 R724K NBD1 Neutral MRP6 ABCC6 R769K NBD1 Neutral MRP6 ABCC6 A1291T NBD2 Neutral MRP6 ABCC6 E1369K NBD2 Neutral MRP6 ABCC6 G1327E NBD2 Disease MRP6 ABCC6 L1416R NBD2 Disease MRP6 ABCC6 R1268Q NBD2 Disease MRP6 ABCC6 R1461H NBD2 Disease MXR ABCG2 I206L NBD1 Neutral MXR ABCG2 P269S NBD1 Disease MXR ABCG2 Q141K NBD1 Neutral nsSNPs. Login to comment

PMID: 20138191 [PubMed] Ishikawa T et al: "Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1)."

No. Sentence Comment

478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6. Login to comment
533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment
476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6. Login to comment
502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const. Login to comment
534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment