ABCMdb

ABCC7 p.Asn900Ala

None has been submitted yet.

Publications

PMID: 15923638 [PubMed] Farinha CM et al: "Most F508del-CFTR is targeted to degradation at an early folding checkpoint and independently of calnexin."

No. Sentence Comment

208 As the N-glyconjugate is attached to asparagine residues 894 and 900 of CFTR, we replaced both these residues by either glutamine (N894Q and N900Q) or alanine (N894A and N900A) residues and studied the CFTR turnover of the resulting proteins on wt and F508del backgrounds when stably expressed in BHK cells as above. Login to comment
219 BHK cells stably expressing wt CFTR (A, lanes 1 to 5), N894A-N900A (WAA) (A, lanes 6 to 10), N894Q-N900Q (WQQ) (A, lanes 11 to 15), F508del-CFTR (B, lanes 1 to 5), F508del-N894A-N900A (FAA) (B, lanes 6 to 10), or F508del-N894Q-N900Q CFTR (FQQ) (B, lanes 11 to 15) were pulse-labeled and chased as before (Fig. 2) for 0 h (lanes 1, 6, and 11), 0.5 h (lanes 2, 7, and 12), 1 h (lanes 3, 8, and 13), 2 h (lanes 4, 9, and 14), and 3 h (lanes 5, 10, and 15). Login to comment
284 Asparagine residues at positions 894 and 900 were replaced by either two alanines (N894A and N900A) or two glutamines (N894Q and N900Q). Login to comment

PMID: 19019984 [PubMed] Pitonzo D et al: "Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon."

No. Sentence Comment

46 Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A). Login to comment