ABCMdb

ABCC7 p.Arg668Cys

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications

PMID: 10601093 [PubMed] Pallares-Ruiz N et al: "Complete mutational screening of the cystic fibrosis transmembrane conductance regulator gene: cystic fibrosis mutations are not involved in healthy men with reduced sperm quality."

No. Sentence Comment

63 Frequency distribution of CFTR gene variants in populations from southern France infertile men with OAT and in controls (T)n-1540A/G-(TG)n Controls OAT PVariants Allele frequency, % of chromosomes (n ϭ 50) (n ϭ 56) Controls CBAVDa OAT 9/9 A/A 10/10 1 (2) 1 (2) NS(n ϭ 100) (n ϭ 100) (n ϭ 112) 7/9 A/A 10/12 1 0 11/10 0 1223C/T (R31C) 0.01 0 0 10/10 0 3356G/A (R75Q) 0.02 0.01 0.009 Total 1 (2) 4 (7) NS1655T/G (F508C) 0 0.01 0.009 7/9 A/G 11/10 2 41716 G/A (E528E) 0 0.01 0.018 10/12 5 21859G/C (G576A)ϩ2134C/T 0.01 0.04c 0.009 7 (14) 6 (11) NS(R668C)b 7/7 A/A 12/12 0 12377C/T (L749L) 0 0.01d 0.009 11/12 1 03417A/T (T1095T) 0.01 0 0.018 10/11 3 03419T/G (L1096R) 0.01 0 0 10/10 1 44002A/G (P1290P) 0.01 0 0.018 Total 5 (10) 5 (9) NS4404C/T (T1424T) 0.01 0.01 0.018 7/7 A/G 12/12 0 2125G/C (5ЈUTR) 0.07 0.01 0.027 11/12 0 3405ϩ46G/T 0 0 0.018 11/11 5 0406-6T/C 0.01 0 0 10/11 3 3875ϩ40A/G 0.05 0.06 0.045 10/10 8 03041-71G/Cϩ4002A/Gb 0.02 0.02 0.009 Total 16 (32) 8 (14) NS3499ϩ37G/A 0 0 0.009 7/7 G/G 11/11 16 (32) 31 (55) Ͻ 0.024374ϩ13A/G 0 0 0.009 8/11 0 1 Total 16 (32) 32 (57) 0.018aGroup of CBAVD patients whose genotypes had been previously analysed 7/5 A/G 11/11 2 (4) 0 -in our laboratory. Login to comment
75 Several missense variations identified in this study (R31C, R75Q, F508C, G576A, R668C, or E528E) have previously Table IV. Login to comment
79 G/G 18 (36) 31 (55) 9 (18) Second, some variants can been found on chromosomes carrying 'true` CFTR mutations (for instance, R668C onaP ϭ 0.008 for comparison with the CBAVD group. Login to comment

PMID: 10746558 [PubMed] Bombieri C et al: "A new approach for identifying non-pathogenic mutations. An analysis of the cystic fibrosis transmembrane regulator gene in normal individuals."

No. Sentence Comment

79 Out of the 20 missense mutations, three (G85E, ∆F508, and N1303K) are certainly CF-causing, and several (R31C, K68E, R75Q, I148T, V562L, G576A-R668C, L997F, F1052V, S1235R) have been described in congenital bilateral absence of the vas deferens, in disseminated bronchiectasis, in pancreatitis, or in atypical CF cases mutations as reported in the CFGAC website (). Login to comment
80 Many (13 out of 20) of the missense mutations change highly conserved (5/5 species analyzed) amino acid residues (R75Q, G85E, I148T, I506V, R668C, G622D, L997F, I1027T, F1052V, L1096R, I1131V, R1162L, N1303K); others affect amino acid residues conserved in 4/5 species (K68 E, R170H, M470V, V562L, S1235R), or in 3/5 species (R31C and G576A; Tucker et al. 1992). Login to comment
86 In addition to very common mutations, which are often associated with other mutations in the same gene, two sporadic mutations were found together in the same individual (G576A and R668C once; 3041-71 G/C and 4002 A/G twice) in three cases. Login to comment
96 Moreover, 1525-61 A/G (i 9) and 3601-65 C/A (i 18) were detected by SSCA performed in the Spanish sample only (14/82 and 12/80, respectively); these mutations were not identifiable by DGGE as used in the present work The totals are: a378; b362; c380; d356 genes eCertainly a CF-causing mutations fThe most common allele at this site is (TTGA)7 gThe most common allele at this site is T7 hThe frequency shown is that of the M allele Mutation Position North-Central Southern Spain Total East Italy Italy France 82 genes 100 genes 100 genes 100 genes 382 genes % 125 G/C 5`UTR 1 2 7 3 13 3.4 R31C 2 1 1 1 0 3 0.8 K68E 3 1 0 0 0 1 0.3 R75Q 3 1 1 2 0 4 1.0 G85Ee 3 0 1 0 0 1 0.3 406-6 T/C i 3 0 0 1 0 1 0.3 I148T 4 1 0 0 0 1 0.3 621+3 A/G i 4 0 1 0 0 1 0.3 R170H 5 1 0 0 0 1 0.3 875+40 A/G i 6a 11 5 5 2 23 6.0 (TTGA)6 f i 6a 17 11 7 13 48 12.6 1341+28 C/T i 8 1 0 0 0 1 0.3 IVS8-6g T5 i 8 8 2 4 3/78 17a 4.5 IVS8-6g T9 i 8 10 7 10 11/78 38a 10.0 M470Vh 10 42 30 39 27 138 36.1 I506V 10 1 0 0 0 1 0.3 ∆F508e 10 1 0 2 0 3 0.8 1716 G/A 10 2 1 0 5 8 2.1 V562L 12 0 0 1 0 1 0.3 G576A 12 1 0/80 1 0 2b 0.6 G622D 13 0 0/80 1 0 1b 0.3 R668C 13 1 0/80 1 0 2b 0.6 2082 C/T 13 1 0/80 0 0 1b 0.3 2377 C/T 13 0 0/80 0 1 1b 0.3 2694 T/G i 14a 33 23 33 14/80 103c 27.1 2752-15 C/G i 14b 0 3 0 0 3 0.8 3041-71 G/C i 15 0 1 2 0 3 0.8 L997F 17a 0 2 0 0 2 0.5 I1027T 17a 1 0 0 0 1 0.3 F1052V 17b 1 0 0 0 1 0.3 L1096R 17b 0 0 1 0 1 0.3 3417 A/T 17b 1 0 1 0 2 0.5 I1131V 18 0 1 0 0 1 0.3 R1162L 19 0 1 0 0 1 0.3 3690 A/G 19 0 0 0 1/80 1c 0.3 S1235R 19 1 0 0 0 1 0.3 4002 A/G 20 2 3 3 3/80 11c 2.9 4005+28insA i 20 0 1 0 0 0.3 4029 A/G 21 1 0 0 0 1 0.3 N1303Ke 21 1 0 0 0 1 0.3 4404 C/T 24 1 0 1 0 2 0.5 4521 G/A 24 21 16 14/80 15/76 66d 18.5 Total 165 113 137 98 513 encountered in the present survey are possible. Login to comment
115 The density of polymorphic sites, which is essentially the proportion of sites susceptible to evolving among the total number of sites (bp) of that gene, can be estimated by counting the number n of polymorphic sites existing in 177 Table 4 A list of the 13 ED-C mutations detected in this survey Mutation q±SE q-2.5SE 125 G/C 0.0340±0.0093 0.011 875+40 A/G 0.0602±0.0122 0.030 876-5 (GATT)6 0.1257±0.0170 0.083 IVS8 T5 0.0450±0.0107 0.018 IVS8 T9 0.1005±0.0155 0.062 IVS8 (TG)10 0.2900±0.0262 0.223 IVS8 (TG)12 0.0867±0.0162 0.046 1525-61 A/Ga 0.1750±0.0420 0.070 M470V 0.3613±0.0246 0.300 2694 T/G 0.2711±0.0228 0.214 3601-65 C/Aa 0.1500±0.0399 0.050 4002 A/G 0.0289±0.0086 0.007 4521 G/A 0.1854±0.0206 0.134 aSearched by SSCA in the sample of 40 Spanish individuals only: frequency and standard error are those of that sample Table 5 Distribution in the four subsamples of mutations found a few times but not classified Total number of Subsample times the mutation has been found NE Italy Central Southern Spain Italy France Twice G576A 1 - 1 - R668C 1 - 1 - L997F - 2 - - 3417 A/T 1 - 1 - 4404 C/T 1 - 1 - Three times R31C 1 1 1 - 2752-15 C/G - 3 - - 3041-71 G/C - 1 - Four times R75Q 1 1 2 - Eight times 1716 G/Aa 2 1 - 5 aGiven its frequency and distribution, this mutant will probably turn out to be a C mutant the stretch under study of N bp and dividing n by N. Usually, the number of sites identified as polymorphic sites is merely a minimum estimate of the total number n of polymorphic sites of the N stretch, because the number of polymorphic sites of the stretch that escaped detection remains unknown. Login to comment

PMID: 10875853 [PubMed] Casals T et al: "Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens."

No. Sentence Comment

72 Another four with2789ϩ5G→A 4 (3) 0 4 (2) D1270NϩR74W 3 (2) 0 3 (2) frequencies of 1-2% were 1816G/A, 4404C/T, 1001ϩ11C/T 1949del84 2 (1) 0 2 (1) and R668C. Login to comment

PMID: 10922395 [PubMed] Abramowicz MJ et al: "Fetal bowel hyperechogenicity may indicate mild atypical cystic fibrosis: a case associated with a complex CFTR allele."

No. Sentence Comment

18 CFTR gene studies were pursued using a DGGE scanning strategy,8 9 and the maternal CFTR allele was found to carry three missense mutations, D443Y (1459G>T, exon 9), G576A (1859G>C, exon 12), and R668C (2134C>T exon 13), which have each previously been reported in males with CBAVD.10-12 On further analysis, the complex mutated maternal allele was found in the younger boy. Login to comment
25 The two brothers and fetus are compound heterozygotes for the N1303K mutation and the complex CFTR allele D443Y-G576A-R668C. Login to comment
29 N1303K N D443Y G576A R668C N D443Y G576A R668C N1303K D443Y G576A R668C N1303K D443Y G576A R668C N1303K Electronic letter of 3 www.jmedgenet.com a regular basis and propose the following approach. Login to comment
39 D443Y, G576A, and R668C have been observed independently or in pairs, in patients with a CF related syndrome for whom the whole CFTR coding sequence has been analysed: D443Y, G576A, R668C, D443Y-G576A, D443Y-R668C in CBAVD patients10-12 and G576A-R668C in a patient with disseminated bronchiectasis, but with no other CF causing mutation found in trans.15 To our knowledge, the D443Y mutation was only observed in CBAVD patients.11 12 The G576A and R668C variations have both initially been described as polymorphisms since they were found on the non-CF chromosome of the mother of a CF child.8 However, they were later considered as putative mild mutations associated with a CBAVD phenotype when combined in trans with F508.16 17 These genotypes may possibly not be disease causing in women. Login to comment
45 In another fetus with FBH at 21 weeks` gestation, we found the genotype W846X/G576A-R668C. Login to comment
48 It is thus possible that, in our family, the D443Y variation worsens a very mild deleterious eVect of the G576A-R668C allele, or vice versa, accounting for the abnormal sweat test and, perhaps, the respiratory infections in the younger brother. Login to comment

PMID: 11175304 [PubMed] de Cid R et al: "CFTR and asthma in the French EGEA study."

No. Sentence Comment

1 Results regarding ∆F508 come from a Danish study conducted in about 9000 subjects from the general population.1 However, the hypothesis that ∆F508 heterozygosity in the CFTR gene could protect against asthma, was proposed earlier after a study conducted in obligate heterozygotes.3 Recently, a case control study based on 144 asthmatics recruited in emergency rooms in Barcelona and a first control group of 41 spouses of CF carriers showed an excess of heterozygotes for aminoacid variants in the asthmatics, R75Q, G576A, R668C and L997F being the most frequent. Login to comment
8 Due to the work load, only the four most common variants previously observed in asthmatics (R75Q, G576A, R668C and L997F), which accounted for 50% of mutations in asthmatics in the Barcelona study, were typed in the EGEA study as previously in the second control group in Barcelona, using the same techniques.2 The most common mutation in cystic fibrosis, ∆F508 was analysed by acrylamide gel electrophoresis, and the missense variant M470V8 was analysed by DGGE. Login to comment
11 Variant R668C11 was analyzed by SSC A. Prevalences in the whole sample of 480 subjects were 2.9%, 3.8%, 4.0%, 4.2% and 0.6% for heterozygosity for ∆F508, R75Q, G576A, R668C and L997F, respectively. Login to comment
18 Any variant (R75Q, R668C, G576A, L997F), carriers of M allele (M470V), or 5T/-, shows odds ratios lower than 1, which were not statistically significant, except for 5T/-. Login to comment
35 Although differences in population could explain the differences between asthmatics in Barcelona and in France, the most likely hypothesis is that the four variants which were unusually frequent in the asthmatics in the first study do not relate to asthma, since a similar distribution to that of Table 1 Comparison of cases and controls from the EGEA study Controls: no asthma P value Asthma cases Both parents: no asthma OR [95% CI] Number 247 174 Demographic and clinical characteristics Geographical origin within France Paris, % 24.9 25.8 0.98 North West, % 11.0 9.8 South West, % 5.3 4.6 North East, % 6.9 8.1 South East, % 51.8 51.7 Age, m±SD 30.2±17.9 34.7±16.1 0.01 [range] [7.0-68.8] [7.4-64.7] Sex, % males 57.1 49.4 0.12 Atopy (weal ≥ 3mm, any of 11 allergens), % 76.8 34.8 0.001 6.4 [4.2-9.7] IgE, IU/ml, GM 246 36 0.001 Hay fever or childhood eczema, % 61.4 30.5 0.001 3.6 [2.4-5.5] FEV1 % predicted, m±SD 0.88±0.19 1.04±0.15 0.001 FVC % predicted, m±SD 0.99±0.16 1.04±0.15 0.001 Methacholine challenge, numbera 113 127 PD20 ≤ 4mg, % 92.9 22.8 0.001 44.4 [22.4-87.8] CFTR data ∆F508, % 3.2 2.9 0.83 1.13 [0.36-3.52] R75Q, % 2.4 5.2 0.14 0.46 [0.16-1.28] G576A, % 3.6 4.0 0.84 0.90 [0.33-2.47] R668C, % 3.6 4.6 0.62 0.79 [0.30-2.07] L997F, % 0.4 0.6 1.0b R75Q or G576A or R668C or L997F, % 6.9 9.8 0.28 0.68 [0.34-1.37] M470V MM, % 18.2 17.2 MV, % 46.2 50.6 0.66 VV, % 35.6 32.2 IVS8-(T) n, 5T/-, % 6.9 12.6 0.05 0.51 [0.27-0.99] a FEV1 > 80% predicted and no contraindications. Login to comment

PMID: 11354633 [PubMed] Tzetis M et al: "CFTR gene mutations--including three novel nucleotide substitutions--and haplotype background in patients with asthma, disseminated bronchiectasis and chronic obstructive pulmonary disease."

No. Sentence Comment

48 on.ca) as disease-causing mutations, while 3 (R668C, R75Q, I1027T) have been listed as sequence polymorphisms. Login to comment
49 R75Q and R668C have been reported with high frequencies in patients with DB, asthma and congenital bilateral absence of vas deferens (CBAVD) (Pignatti et al. 1995; Pignatti et al. 1996; Girodon et al. 1997; Lazaro et al. 1999; Kanavakis et al. 1998). Login to comment
60 of CFTR gene IVS8-(T)n IVS8-(TG)m M470 V tested cases mutationa Asthma 20 1 L997F, T338Mb 9/7 10/12 M/V 1 Y301C 7/7 11/11 V/V 1 M1Rb, V11Ib 7/7 12/10 M/M 1 I148T/- 9/9 10/10 M/V 1 L997F/- 9/9 11/9 M/V 1 R297Q/- 5/5 13/11 M/M 1 R297Q/- 7/7 11/11 V/V 1 R75Q/- 7/7 11/11 V/V 1 A120T/ 5/7 11/11 V/V 1 -/- 7/7 11/12 M/V 1 -/- 7/9 11/11 M/M 2 -/- 7/7 12/10 M/V 7 -/- 7/7 11/11 V/V DB 19 1 F508del, I1027T 9/9 10/10 M/M 1 D565G, R668C 7/7 11/11 M/V 1 T896I/- 7/7 11/10 M/V 1 I148T/- 7/9 11/10 M/V 1 F508del/S977F 5/9 12/10 M/V 1 -/- 7/9 12/10 V/V 1 -/- 7/9 10/10 M/V 1 -/- 7/7 11/12 M/M 2 -/- 7/7 11/10 1 M/V, 1 V/V 2 -/- 7/7 12/10 1 V/V, 1 M/M 3 -/- 7/9 11/10 1 M/M, 2 V/V 4 -/- 7/7 11/11 1 V/V, 3 M/V COPD 12 1 F1052 V/- 7/7 11/10 M/V 1 S1235R/- 7/9 12/10 M/M 1 -/- 5/5 11/12 M/V 1 -/- 7/9 10/10 M/M 2 -/- 7/9 11/10 1 M/M,1 M/V 3 -/- 7/7 11/10 M/V 3 -/- 7/7 11/11 1 M/V, 2 M/M Controls 52 1 F508del/- 7/9 10/10 M/M 1 F1052 V/- 5/7 10/11 M/V 1 F1052 V/- 7/7 11/11 M/M 1 R668C, D565G/- 7/7 11/11 M/M 1 R688C, D565G/- 7/7 11/10 M/V 1 R75Q/- 7/7 11/11 V/V 1 R297Q/- 7/7 11/10 M/V 1 L997F/- 7/9 10/10 M/V 1 -/- 7/7 10/10 M/V 1 -/- 7/9 10/10 M/M 1 -/- 7/9 12/10 M/M 4 -/- 7/9 11/10 1 M/M, 1 V/V, M/V 15 -/- 7/7 11/10 13 M/V, 2 V/V 22 -/- 7/7 11/11 18 V/V, 3 M/V, 1 M/M been found that affect the same codon, of which M1 K affects the same nucleotide (T>A) (Cystic Fibrosis Genetic Analysis Consortium website). Login to comment
72 The proportion of CFTR alleles in each group is expressed as c/d (e), where c indicates the number of alleles with the genotype indicated at left, d indicates the number of total alleles examined in each group and e represents the percentage aMutation name according to the Cystic Fibrosis Genetic Analysis Consortium bNovel mutations, reported for the first time in this study Mutationa Control Pulmonary disease patients Greek CF population patients (PS; PI) (n=52) Asthma DB COPD (n=426) (n=20) (n=19) (n=12) R75Q (356 G/A, exon 3) 1 (0.96%) 1 (2.5%) - - 1 (0.1%) R668C (2134 C/T, exon 13) 2 (1.9%) - 1 (2.6%) - 1 (0.1%) L997F (3123 G>C, exon 17a) 1 (0.96%) 2 (5%) - - - F508del 1 (0.96%) - 2 (5.3%) - 465 (54.6%) D565G (A>G at 1825, exon 12) 2 (1.9%) - 1 (2.6%) - 1 (0.1%) F1052 V (T>G at 3286, exon 17b) 2 (1.9%) - - 1 (4.2%) 1 (0.1%) R297Q (G>A at 1022, exon 7) 1 (0.96%) 2 (5%) - - - Y301C (A>G at 1034, exon 7) - 1 (2.5%) - - - I148T (T>C at 575, exon 4) - 2 (5%) - - 1 (0.1%) T388Mb (C>T at 1295, exon 8) - 1 (2.5%) - - - M1Rb (T>G at 134, exon 1) - 1 (2.5%) - - - V11Ib (G>A at 163, exon 1) - 1 (2.5%) - - - I1027T (3212 T/C, exon 17a) - - 1 (2.6%) - 1 (0.1%) T896I (C>T at 2819, exon 15) - - 1 (2.6%) - - S977F (C>T at 3062, exon 16) - - 1 (2.6%) - - A120T (G>A at 490, exon 4) - 1 (2.5%) - - - S1235R (T>G at 3837, exon 19) - - - 1 (4.2%) - Table 3 Frequency of M470 and (TG)mTn alleles in pulmonary disease patients and controls (DB disseminated bronchiectasis, COPD chronic obstructive pulmonary disease, n number of cases, ND not detected) Clinical status Allele M470 TG11/T7 TG10/T7 TG12/T7 TG10/T9 TG11/T5 TG12/T5 TG13/T5 Asthmaa (n=20) 13 (32.5%) 23 (57.5%) 3 (7.5%) 5 (12.5%) 3 (7.5%) 2 (5%) ND 1 (2.5%) DB (n=19) 17 (44.7) 18 (47.4%) 6 (15.8%) 4 (10.5%) 9 (23.7%) ND 1 (2.6%) ND COPD (n=12) 17 (70.8) 12 (50%) 5 (20.8%) 1 (4.2%) 4 (16.7%) 1 (4.2%) 1 (4.2%) ND Controls (n=52) 37 (35.5%) 71 (68.%) 23 (22.1%) 1 (0.96%) 6 (5.8%) 1 (0.96%) ND ND aAlleles TG11/T9 (2) and TG9/T9 (1) also detected alleles, P<0.01) were both found more frequently in patients with COPD. Login to comment
81 Two patients had two mutations each (F508del and I1027T; D565G and R668C). Login to comment
84 It is interesting that this CBAVD patient also carried R668C, had a negative sweat chloride test, but no pulmonary symptoms. Login to comment

PMID: 11788090 [PubMed] Strandvik B et al: "Spectrum of mutations in the CFTR gene of patients with classical and atypical forms of cystic fibrosis from southwestern Sweden: identification of 12 novel mutations."

No. Sentence Comment

27 MUTATIONS IDENTIFIED IN 258 CHROMOSOMES IN THE CF POPULATION ATTENDING THE SOUTH-WESTERN SWEDISH CF CENTRE Location in the Frequency of Mutation gene, exon Number of mutations mutation (%) Homozygotes Heterozygotes DF508 10 161 62.4 56 49 394delTT 3 13 5.0 3 7 R117C 4 7 2.7 7 3659delC 19 5 1.9 5 E60X 3 4 1.6 4 1112delT 7 4 1.6 1 2 R764X 13 4 1.6 1 2 621 1 1G ® T 4 3 1.2 3 G551D 11 2 0.8 2 I506L 10 2 0.8 2 N1088D (R75Q) 17b 2 0.8 2 Q1238X 19 2 0.8 2 R117H (IVS8-5T) 4 2 0.8 2 V603F (IVS8-5T) 13 2 0.8 2 1716G ® A 10 2 0.8 2 R75Q 3 2 0.8 2 R533X 11 1 0.4 1 2329A ® G Promoter 1 0.4 1 297-3 C ® A 2 1 0.4 1 Y161D 4 1 0.4 1 994del9 Exon/intron 6b 1 0.4 1 1154insTC 7 1 0.4 1 W361R 7 1 0.4 1 T338I 7 1 0.4 1 1249-5A ® G Intron 7 1 0.4 1 1717-2A ® G Intron 10 1 0.4 1 R560T 11 1 0.4 1 E1401X 23 1 0.4 1 3126del4 17a 1 0.4 1 S945L 15 1 0.4 1 R668C 13 1 0.4 1 2622 1 2del6 Intron 13 1 0.4 1 R1162Q Exon 19 1 0.4 1 3849 1 10kbC ® T Intron 19 1 0.4 1 R74W Exon 3 1 0.4 1 2363C ® T Promoter 1 0.4 1 IVS8-5Ta Intron 8 1 0.4 1 Unidentified 20 7.8 Total 258 100 61 116 The new mutations are displayed in bold. Login to comment

PMID: 12070257 [PubMed] Scotet V et al: "Prenatal detection of cystic fibrosis by ultrasonography: a retrospective study of more than 346 000 pregnancies."

No. Sentence Comment

241 However, they based their comparison on an expected carrier rate in the general population which appears to be overestimated.1 The CFTR mutations identified in fetuses with echogenic bowel that have been reported so far are associated with pancreatic insufficiency (for example, ∆F508, G542X, G551D, Table 2 Ability of the ultrasound examination to detect cystic fibrosis Cystic fibrosis TotalYes No Utrasound examination Abnormal 14 128 142 Normal 112 346 300 346 412 Total 126 346 428 346 554 2183AA→G, ∆F311).9 13 27 43 To our knowledge, only one mutation associated with a mild phenotype (R117H)13 and one mild complex CFTR allele (D443Y-G576A-R668C)44 have been identified in two of the CF affected fetuses. Login to comment

PMID: 12116247 [PubMed] Muller F et al: "Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases."

No. Sentence Comment

71 In the last case (21) the fetus carried the nonsense mutation W846X (detected in the first step using DGGE), associated with the complex allele G576A-R668C. Login to comment
73 Fetuses Carrying Two CFTR Mutations Cases CFTR Gene Mutations Ultrasound Findings Outcome 1-9 DF508/DF508 Hyperechogenic bowel TOP 10,11 DF508/DF508 Hyperechogenic bowel þ dilated loop TOP 12 DF508/DF508 Hyperechogenic bowel þ dilated loop þ gall bladder not seen TOP 13 DF508/DF508 Hyperechogenic bowel þ gall bladder not seen TOP 14 DF508/DF508 Intestinal dilated loops (absent at 22 wks) Birth, CF-affected, meconium ileus at birth 15 DF508/W1282X Hyperechogenic bowel (absent at 22 wks) TOP 16 DF508/G542X Hyperechogenic bowel þ dilated loop TOP 17 DF508/1078delT Hyperechogenic bowel þ dilated loop (absent at 22 wks) Birth, CF-affected,* meconium ileus at birth 18 DF508/O220X Hyperechogenic bowel þ dilated loop (present at 33 wks) Birth, CF-affected,* meconium ileus at birth 19 1078delT/394delTT Hyperechogenic bowel TOP 20** CFTRdele19/CFTRdele19 Hyperechogenic bowel (present at 33 wks) Birth, CF-affected, absence of meconium ileus at birth 21 W846X/G576A-R668C Hyperechogenic bowel Birth, potential absence of vas deferens TOP ¼ termination of pregnancy; Wks ¼ weeks of amenorrhea. Login to comment

PMID: 12200467 [PubMed] Vrettou C et al: "Multiplex sequence variation detection throughout the CFTR gene appropriate for preimplantation genetic diagnosis in populations with heterogeneity of cystic fibrosis mutations."

No. Sentence Comment

24 cells PCR ADO/total polymorphism (length bp) amplified product (%) cells (%) Patient 1 F508del 25 (196) 10 50 47 (94.0) 0/47 (0) 621 ϩ 1G→T 23 (192) 4 48 (96.0) 1/48 (2.1) Patient 2 N1303K 25 (196) 21 85 80 (94.1) 3/80 (3.8) 2789 ϩ 5G→A 18 (182) 14b 85 (100) 2/85 (2.4) Patient 3 E822X 17 (180) 13 part b 80 72 (90.0) 1/72 (1.4) F1052V 18 (182) 17b 75 (93.8) 2/75 (2.6) Heterozygotea 1719-9T→C 17 (180) 11 75 75 (100.0) 0/75 (0) R668C 13 part a Normal allele 18 (182) 74 (98.7) 1/74 (1.4) Microsatellite 290 268 (92.4) 29/268 (10.8) IVS8CA aIndividual heterozygote for D565G mutation in exon 12 (not included in assay) had two polymorphisms in cis to D565G (1719-9T→C in exon 11 and R668C in exon 13 part a), which were also in cis with 17 CA repeats in IVS8. Login to comment

PMID: 12719375 [PubMed] Pagani F et al: "New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12."

No. Sentence Comment

41 The missense D565G mutation was detected in seven Greek subjects, always in cis with the common polymorphism R668C (2134C/T) in exon 13 (Table 1). Login to comment
43 The patient carrying the G576A missense mutation was affected by testicular azoospermia and in this case the G576A allele was also in cis with the R668C polymorphism. Login to comment
44 To distinguish between the transcripts produced from the normal and mutant alleles we took advantage of the presence of the R668C polymorphism in exon 13 in cis with both mutations, and designed allele-specific primers. Login to comment
46 Two PCR`s were set up for the nasal epithelial cell cDNA derived from each of the D565G and G576A heterozygotes and from heterozygous controls for R668C, using the common F3 forward primer in exon 11 and each of the two allele specific primers of exon 13 (Fig. 1A). Login to comment
61 Allele-specific PCR transcript analysis F3/668R F3/668C Subjects with D565G mutation 89.7Æ 5.9 40Æ 8.3a Subject with G576A mutation 88Æ 3 22Æ 4b Normal controls (heterozygotes for polymorphism R668C) 91.7Æ 5.1 89.3Æ 8.1 Data from six subjects with the D565G mutation, one patient with the G576A mutation and four controls are calculated from the experimental proportions of CFTR exon 12 inclusion adjusted according to the graph shown in Figure 1C. Login to comment
77 The specificity of the 668R and 668C primers was evaluated by amplification experiments in homozygous R668C individuals. Login to comment
187 MATERIALS AND METHODS Patients and DNA mutation analysis Nasal epithelial cells were collected from six individuals carriers of mutation D565G (A>G at 1826 in CFTR cDNA), from one CBAVD patient with G576A and from four non-CF control individuals heterozygotes for the polymorphism R668C. Login to comment
193 The phase of linkage for missense mutations D565G and G556A and polymorphism R668C was deduced from family studies and confirmed by sequencing of allele specific cDNAs. Login to comment
226 All patients are heterozygous for the R668C allele. Login to comment

PMID: 12923859 [PubMed] Simon-Bouy B et al: "Hyperechogenic fetal bowel: a large French collaborative study of 682 cases."

No. Sentence Comment

55 In addition, one fetus presented with two CFTR mutations (W846X associated with the complex allele G576A-R668C) involved in congenital bilateral agenesis of the vas deferens. Login to comment

PMID: 12940920 [PubMed] Rowntree RK et al: "The phenotypic consequences of CFTR mutations."

No. Sentence Comment

184 The complex allele described contained three missense mutations, D443Y, G576A and R668C (Abramowicz et al. 2000). Login to comment
186 The complex allele G576A-R668C had been reported in an individual with a normal sweat test, although the affected members of the family exhibited a mild CF phenotype. Login to comment

PMID: 15097853 [PubMed] Casals T et al: "Different CFTR mutational spectrum in alcoholic and idiopathic chronic pancreatitis?"

No. Sentence Comment

56 Also, 2 missense mutations/variants, the R668C and L997F were detected in both CP groups. Login to comment
57 The R668C was found isolated in 1 ACP patient and as the complex allele D443Y+G576A+R668C (common in CBAVD) in 1 ICP patient. Login to comment
63 Time Years BMI Alcohol Alcohol Time Years Tobacco Pancreatic Features Hepatobiliary Disease CFTR Genotype Sweat Test mmol/L FEV1/FVC % Predicted Male Fertility Alcoholic Chronic Pancreatitis (n = 15) 1 M/52 15 24.5 110g/d 27 yes AP, P, Ps, DM, PI Chronic hepatitisa F508del/S1235R 18 105/107 yes 2 M/72 15 23.4 85g/d 22 yes AP, P, C, PS no F508del/1716G/A 72 90/104 yes 3 M/53 10 21.9 135g/d 20 yes P, C, DM, PI no F508del/- 54 71/89 yes 4 M/64 18 20.7 250g/d 27 yes AP, P, C, Ps, DM, PI cirrhosis, lithiasis W1282X/- 68 71/78 unproved 5 M/44 13 22.0 95g/d 6 yes AP, P, C, Ps, DM, PI lithiasis R170C/- 16 105/111 yes 6 M/62 12 22.1 >60g/d >5 yes AP, P, C, Ps, DM, PS no R258G/- 82 73/82 yes 7 M/38 9 18.0 210g/d 15 yes AP, P, C, Ps, PS no M281T/- 62 132/126 yes 8 M/40 11 - >60g/d >5 yes AP, P, C, Ps, PS lithiasis R297Q/- 46 103/99 yes 9 M/42 2 21.4 150g/d 20 yes AP, P, C, Ps, PS no 1716G/A/- 19 93/102 yes 10 M/44 3 22.2 95g/d 22 yes AP, P, DM, PS no R668C/- 58 105/102 yes 11 M/59 6 21.8 90g/d 18 yes PS lithiasis L997F/- 85 69/84 nd 12 M/72 16 - >60g/d >5 no P, C, DM, PI lithiasis R1162L/- - - yes 13 M/35 8 21.0 90g/d 7 yes AP, P, C, PS no 5T-12TG-V470/- 13 106/114 unproved 14 M/60 14 28.0 80g/d 20 no AP, P, C, Ps, DM, PI no 5T-11TG/- 28 80/77 yes 15 M/65 12 24.4 100g/d 23 yes AP, P, C, DM, PS no 5T-11TG/ 40 86/110 yes Idiopathic Chronic Pancreatitis (n = 12) 16 M/21 5 - no - yes AP, P, PS no 1716G/A/R170H 40 normal yes 17 M/59 4 24.2 no - no PS chronic hepatitisb 1716G/A/- 40 146/128 yes 18 M/63 14 21.4 no - no DM, PI no 1716G/A/- 34 144/126 yes 19 M/70 18 19.9 no - yes AP, P, DM, PI chronic hepatitisa 1716G/A/- 60 36/47 yes 20 M/65 1 27.7 no - yes P, Ps, DM, PI no 1716G/A/- 38 79/78 yes 21 M/76 8 24.1 no - no AP, P, DM, PS no 1716G/A/- 60 81/109 yes 22 M/25 2 25.0 no - yes AP, P, PS no 1716G/A/- 48 94/86 nd 23 F/42 10 22.6 no - yes P, C, PS lithiasis P205S/- 72 111/109 - 24 F/81 21 34.6 no - no P, C, DM, PI lithiasis D443Y+G+R*/- 42 121/108 - 25 F/72 8 23.3 no - yes AP, C, PS no L997F/- 40 100/93 - 26 M/9 2 19.2 no - no AP, P, PS no 5T-11TG/- 30 101/110 nd 27 M/63 6 - no - no C, DM, PI cirrhosis 5T-11TG/- - - yes a C virus hepatitis. Login to comment

PMID: 15126740 [PubMed] Coste A et al: "Atypical sinusitis in adults must lead to looking for cystic fibrosis and primary ciliary dyskinesia."

No. Sentence Comment

85 Patients CFTR Gene Mutation(s) Sweat Test (mmol/L) CFTR 1 ⌬F508* 3849 ؉ 10kbC3T* 97 CFTR 2 ⌬F508* 3272-26A3G NA CFTR 3 2143delT S1235R NA CFTR 4 R74W-D1270N - NA CFTR 5 G576A-R668C - NA CFTR 6 IVS8-5T - NA CFTR 7 IVS8-5T - NA CFTR 8 R170C - 32 CFTR 9 ⌬F508* - NA CFTR 10 IVS8-5T - 44 CFTR 11 G1069R - 52 CFTR 12 IVS8-5T - 36 CFTR 13 IVS8-5T - NA CFTR 14 G551D* - NA CFTR 15 G542X* - Ͻ40 CFTR 16 F1074L - NA *Mutations detected with the CF-oligonulcleotide ligation assay kit. Login to comment

PMID: 15151509 [PubMed] Casals T et al: "Bronchiectasis in adult patients: an expression of heterozygosity for CFTR gene mutations?"

No. Sentence Comment

73 Exceptions are the missense mutations G576A and R668C which occur on the same allele (26). Login to comment
81 Table2.ClinicalfeaturesandCFTRgenotypesfoundin20adultpatientswithbronchiectasis SampleSex/age Ageonset (years) FEV1/FVC (%predicted) Bacterial colonization Sweattest (mEq/l) Lobes affected Clinical features FirstCFTR change Second CFTRchangeM470V 1M/41520/43P30a >4-F508delL997FM/V 2F/231785/89P,S46a >4SN,ABPA,PNF508del-M/M 3F/24160/74P,S49a >4SN,PNF508del-M/V 4M/55-87/84S32a 2-F508del-M/V 5c F/372991/93S41a >4PNF508del-M/V 6F/333286/84No51a 2-G542X-M/M 7F/306101/112No56a >4-2789þ5G>A5T-12TGM/V 8F/3815106/104No29a 2OtitisS1235R-M/V 9F/34Birth75/100H20a >4SNV562L5T-11TGM/V 10d F/36530/51P20a >4SN,PNG1237S-M/V 11d M/401473/92H26a 3SN,PN,OZG1237S-M/V 12F/23541/47S23a >4HemoptysisR347HR75QV/V 13F/68548/52No34a >4PNY1014C5T-12TGV/V 14M/643088/84H39a 2-R75Q-M/V 15M/40Childhood56/79No33b >4SN,asthmaV754M-M/M 16M/474594/108No19a 2SN,PNQ179K-M/V 17M/23Childhood38/34No28a 2SN,PN5T-12TG5T-11TGM/V 18F/695068/89S52a 4DiabetesG576A,R668C-M/V 19F/47Childhood16/18P64b >4-G576A,R668C-M/V 20F/38672/88No39b >4SN,ABPA,asthma1716G/A-M/M M,male;F,female;FEV1,forcedexpiratoryvolumein1s(%ofpredictedvalueforheight);FVC,forcedvitalcapacity(%ofpredictedvalueforheight);P,Pseudomonas aeruginosa;H,Haemophilusinfluenza;S,Staphylococcusaureus;SN,sinusitis;ABPA,allergicbronchopulmonaryaspergillosis;PN,pneumonia;OZ,oligozoospermia. Login to comment
107 However, a recent study (28) has showed that the G576A change leads to exon 12 skipping and an increase of aberrant transcripts when the R668C change in exon 13 is also present. Login to comment

PMID: 15333598 [PubMed] Grangeia A et al: "Characterization of cystic fibrosis conductance transmembrane regulator gene mutations and IVS8 poly(T) variants in Portuguese patients with congenital absence of the vas deferens."

No. Sentence Comment

92 The frequency of the other mutations was: four of 62 (6.5%) for R334W, two of 62 (3.2%) for R117H, P205S and G576A, and one of 62 (1.6%) for D614G, V562I, R668C, 2789-5G ! Login to comment
105 A/S1235R 1 1 - 5/7 F508del/- 6 - 6 5/9 (£6) I507del/- 1 - 1 7/9 G576A-R668C/- 1 - 1 5/7 P205S/- 1 - 1 5/5 R334W/- 1 - 1 7/7 G576A/- 1 - 1 7/7 3272-26A ! Login to comment

PMID: 15520400 [PubMed] Niel F et al: "Rapid detection of CFTR gene rearrangements impacts on genetic counselling in cystic fibrosis."

No. Sentence Comment

136 The subjects were divided into three groups according to the results of a previous screening: (i) 43 CF patients who fulfilled the diagnostic criteria of CF15 and who carried a CF mutation, and seven parents of deceased CF patients, a CF mutation having already been identified in the other parent (50 unidentified CF alleles); (ii) 12 CF patients with no identified CF mutation (24 unidentified CF alleles); and (iii) 16 patients apparently homozygous for a CFTR mutation and who had CF (F508del 2n = 6-, 2104insA22109del10, S945L, 3120+1GRA, N1303K) or a CFTR related disease, that is, isolated CBAVD (D110H, R117H, L997F, R74W-D1270N) or DB (R334W, R668C- G576A-D443Y) (0-16 unidentified CF alleles). Login to comment

PMID: 15536480 [PubMed] Modiano G et al: "A large-scale study of the random variability of a coding sequence: a study on the CFTR gene."

No. Sentence Comment

33 In the Tajima`s test,19 the null hypothesis of neutrality is rejected if a statistically significant difference between p Common and rare nonsynonymous and synonymous cSNSs G Modiano et al European Journal of Human Genetics Table 1 List of the 61 cSNSsa encountered in the present survey The random samples of genes (and the technique utilized) cSNS variants found NE Italy (DGGE) Central Italy (DGGE) Southern France (DGGE) Northern France (DHPLC) Spain (SSCA) Czechia (DGGE) Hb Â 104 Exon Exon Length (bp) Ref. no. SNS SASc 1st 100d 2nd 500 1st 100d 2nde 1st 100d 2nd 500 1st 100 2nde 82d 72 Abs. Freq. Total sample size q Â 104 se Â 104 NSf Sf 1g 53 0 0 0 0 0/452 0 924 2 111 1 223C4T R31C 1 1 1/500 1 1 0 0/450 0 5 (11) 1 932 (2 432) 45.23 13.61 90 2 224G4T R31L 0 0 0/500 0 0 0 1/450 0 1 1 932 5.17 5.17 10 3 257C4T S42F 0 0 1/500 0 0 0 0/450 0 1 1 932 5.17 5.17 10 3 109 4 334A4G K68E 1 0 0 0/498 0 0 0 0/452 0 0 1 2 504 3.99 3.99 8 5 352C4T R74W 0 0 0 0/498 0 0 0 1/452 0 0 1 2 504 3.99 3.99 8 6 356G4A R75Q 1 7 1 7/498 2 9 2 9/452 0 2 40 (40) 2 504 (2 544) 157.23 24.66 310 7 386G4A G85E 0 0 1 1/498 0 0 0 0/452 0 0 2 2 504 7.99 5.65 16 4 216 8 482G4A R117H 0 0 0 0/292 0 2 0 1/456 0 0 3 2 302 13.03 7.52 26 9 528T4G I132M 0 0 0 0/292 0 0 0 1/456 0 0 1 2 302 4.34 4.34 8 10 575T4C I148T 1 2 0 1/292 0 0 0 1/456 0 1 6 2 302 26.06 10.63 52 5 90 11 640C4T R170C 0 0 0 0/6 0 0 1/448 0 1 1 436 6.96 6.96 14 12 641G4A R170H 1 1 0 0/6 0 0 2/448 0 4 (4) 1 436 (1 930) 20.73 10.35 41 6a 164 0 0 0/6 0 0 0/432 0 0 992 6b 126 0 0 0/6 0 0 0/454 0 942 7 247 0 0 0/6 0 0 0/796 0 1 284 8 93 13 1281G4A L383 0 0 0 0/6 0 0 1/456 0 0 1 1 516 6.60 6.60 13 9 183 14 1402G4A G424S 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 15 1459G4T D443Y 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 10 192 16 1540A4G M470Vh 42 197 30 37/96 39 199 (i) (i) 27 571(736) 1 484 (1 912) 3849.37 111.28 4 735 17 1598C4A S489X 0 0 0 0/96 0 0 0 1/796 0 1 2 374 4.21 4.21 8 18 1648A4G I506V 1 0 0 0/96 0 0 0 0/796 0 1 2 374 4.21 4.21 8 19 1655T4G F508C 0 1 0 0/96 0 0 0 1/796 0 2 2 038 8.42 5.96 17 20 1716G4A Q528 2 16 1 0/96 0 19 i I 5 43 (58) 1 478 (2 024) 286.56 37.08 557 11 95 21 1756G4T G542X 0 2 0 0/134 0 0 0/796 0 0 2 1 984 10.08 7.12 20 22 1764T4G G544 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 23 1784G4A G551D 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 12 87 24 1816G4A V562I 0 0 0 0 1 0 0/450 0 0 1 (1) 2 004 (2 504) 3.99 3.99 8 25 1816G4C V562L 0 0 0 1 0 0 1/450 0 0 2 (3) 2 004 (2 504) 11.98 6.91 24 26 1859G4C G576A 1 2 0 1 11 0 8/450 0 0 23 (27) 2 004 (2 538) 106.38 20.36 213 13 724j 449 27 1997G4A G622D 0 0 0/80 0/96 1 0 0 0/444 0 1 2 002 5.00 5.00 10 28 2082C4T F650 1 0 0/80 0/20 0 0 0 0/444 0 1 (1) 1 926 (2 412) 4.15 4.15 8 29 2134C4T R668C 1 2 0/80 0/96 1 11 0 12/444 0 27(32) 2 002 (2 558) 125.10 21.98 247 275 30 2377C4T L748 0 0 0/6 0 1 1 388 25.77 25.77 52 14a 129 31 2670G4A W846X 0 0 0/6 0 1 0/452 0/80 0 1 1 010 9.90 9.90 20 32 2694T4G T854 33 23 0/6 33 38 149/452 14/80 11 301 1 010 2980.20 143.92 4 184 33 2695G4A V855I 0 0 0/6 0 0 1/452 0/80 0 1 1 010 9.90 9.90 20 14b 38 0 0 0 0/520 0 0 0 0/446 0 2 448 15 251 34 2816G4C S895T 0 0 0/6 0 0 2/436 0 0 2 996 20.08 14.18 40 35 2831A4C N900T 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 36 2988G4C M952I 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 37 3030G4A T966 (2)k (1)k 0 6/436 0 6 (25)k 618 (1814)k 137.82 27.37 272 38 3032T4C L967S 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 16 80 0 0 0/498 0 0 0/450 0 0 1 502 17a 151 39 3123G4C L997F 0 2 2 1/494 0 7 1 4/454 0 0 17 2 502 67.95 16.42 135 40 3157G4A A1009T 0 2 0 0/494 0 0 0 0/454 0 0 2 2 502 7.99 5.65 16 41 3212T4C I1027T 1 0 0 0/494 0 0 0 0/454 0 0 1 2 502 4.00 4.00 8 17b 228 42 3286T4G F1052V 1 1 0 1/194 0 0 0 0/452 0 0 3 (3) 2 200 (2 240) 13.39 7.73 27 43 3337G4A G1069R 0 1 0 0/194 0 0 0 0/452 0 0 1 2 200 4.55 4.55 9 CommonandrarenonsynonymousandsynonymouscSNSs GModianoetal 186 EuropeanJournalofHumanGenetics 44 3345G4T Q1071H 0 0 0 0/194 0 1 0 0/452 0 0 1 2 200 4.55 4.55 9 45 3417A4T T1995 1 3 0 0/194 1 1 0 0/452 0 0 6 (8) 2 200 (2 506) 31.92 11.27 64 46 3419T4G L1096R 0 0 0 0/194 1 0 0 0/452 0 0 1 2 200 4.55 4.55 9 47 3477C4A T1115 0 0 0 0/194 0 0 0 1/452 0 0 1 2 200 4.55 4.55 9 18 101 48 3523A4G I1131V 0 0 1 0/10 0 0 0/448 0 0 1 (2) 1 512 (1 908) 10.48 7.07 21 49 3586G4C D1152H 0 0 0 0/10 0 0 1/448 0 0 1 1 512 6.61 6.61 13 19 249 50 3617G4T R1162L 0 0 1 1/494 0 0/260 0 0/454 0 0 2 2 262 8.84 6.25 18 51 3690A4G Q1186 0 0 0 0/494 0 0/260 0 0/454 1 0 1 2 262 4.42 4.42 9 52 3813A4G L1227 0 1 0 0/494 0 0/260 0 0/454 0 0 1 2 262 4.42 4.42 9 53 3837T4G S1235R 1 1 0 1/494 0 4/260 0 7/454 0 1 15 (15) 2 262 (2 310) 69.94 16.71 140 20 156 54 4002A4G P1290 2 3 0/6 3 5 18/454 3/80 2 36 1 012 357.73 58.22 690 21 90 55 4009G4A V1293I 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 56 4029A4G T1299 1 0 0/6 0 1/300 0 1/456 0 0 3 (8) 1 316 (2 330) 34.33 12.12 69 57 4041C4G N1303K 1 0 0/6 0 0/300 0 0/456 0 0 1 1 316 7.60 7.60 15 58 4085T4C V1318A 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 22 173 0 0 0/18 0 0 0/450 0 0 1 022 23 106 0 0 0 0/6 0 0 0/448 0 1 436 24l 198+3 59 4404C4T Y1424 1 0 0/6 1 2 5/420 0 2 11 (32) 980 (2 516) 127.19 22.34 251 60m 4521G4A Q1463 (21) (16) (3/32) (14/80) (30) (94/420) 15/76 (17) 15 (227) 76 (1052) 2142.86 131.07 3 367 61 4563T4C D1477 0 0 0/6 0 1 0/420 0 0 1 980 10.20 10.20 20 Totals 6 525 9 584 16 109 The bracketed figures include also the RFLP analysis data (see Materials and methods); the NE Italy, Central Italy, Southern and Northern France are each subdivided into two samples where the 1st is made up of 100 genes. Login to comment

PMID: 15705292 [PubMed] Claustres M et al: "Molecular pathology of the CFTR locus in male infertility."

No. Sentence Comment

385 (2003a) analysed the splicing pattern resulting from several variants in CFTR exon 12, including G576A (G>C at nucleotide 1859 in exon 12), which is associated in cis with R668C (C>T at nucleotide 2134 in exon 1.^). Login to comment

PMID: 15987793 [PubMed] Weiss FU et al: "Complete cystic fibrosis transmembrane conductance regulator gene sequencing in patients with idiopathic chronic pancreatitis and controls."

No. Sentence Comment

233 CFTR mutations in idiopathic pancreatitis www.gutjnl.com Three of the four compound heterozygous ICP patients carried one severe DF508 mutation (genotypes: DF508/ R117H, DF508/A1087P, DF508/D1152H) and one carried two mild mutations (S1235R/R668C). Login to comment
256 The reason why numbers for compound heterozygous ICP patients in these studies are diverse (4/67 = 6% in our study) may be due to differences Table 1 CFTR and SPINK1 sequence variations identified in 30 of the 67 ICP patients PatientSex CFTR mutation T allele TG repeats PSTI mutation 1 M DF508/R117H 7/7 9/10 -/- 2 W DF508/A1087P 7/9 10/11 -/- 3 M DF508/D1152H 7/9 10/10 -/- 4 M S1235R/R668C 7/7 11/12 -/- 5 M 2184insA/- 7/7 10/12 -/- 6 M R31C/- 7/7 10/11 -/- 7 M R75Q/- 7/7 11/11 -/- 8 M R347P/- 7/7 11/12 -/- 9 M S1235R/- 7/7 11/12 -/- 10 W S1235R/- 7/7 11/12 -/- 11 M G576A/- 7/7 10/10 -/- 12 W M348V/- 7/9 10/10 -/- 13 M V754M/- 7/7 10/11 -/- 14 M -/- 5/7 11/12 -/- 15 W -/- 5/7 11/12 -/- 16 M -/- 5/7 11/12 -/- 17 W -/- 5/9 11/12 -/- 18 M -/- 5/7 11/12 -/- 19 M -/- 5/7 10/10 -/- 20 W -/- 5/7 10/10 -/- 21 W -/- 5/7 11/12 N34S/- 22 W -/- 7/7 10/11 N34S/- 23 M -/- 7/9 10/11 N34S/- 24 M -/- 7/7 11/11 N34S/- 25 M -/- 7/7 11/11 N34S/- 26 W -/- 7/7 11/11 N34S/- 27 M -/- 7/7 11/11 N34S/- 28 W -/- 7/7 10/11 N34S/- 29 W -/- 7/7 11/11 P55S/- 30 W -/- 7/7 11/11 IVS3+2TC/- Table 2 CFTR sequence variations identified in 11 of 60 healthy controls Control group Number DF508/- 3 R117H/- 2 I148T/- 1 L997F/- 1 5T/12TG 1 5T/11TG 3 in patient recruitment, the catchment populations, or the stringency with which cystic fibrosis patients were excluded. Login to comment

PMID: 16088537 [PubMed] Luisetti M et al: "Genetics of idiopathic disseminated bronchiectasis."

No. Sentence Comment

42 Greek M/F 11/12 5/16 na Mean age (yrs) 53 Ϯ 15 53 Ϯ 14 na CFTR gene 1 G576A-R668C/L997F 1 ⌬F508/D192N 1 ⌬F508,I1027T mutation 1 ⌬F508/L997F 1 ⌬I507/3849 + 10kb C → T 1 D565G, R668C 1 ⌬F508/- 1 ⌬F508/3849 + 10kb C → T 1 T896I/- 1 R1066C/- 1 H949Y/T1220I 1 I148T/- 1 3667ins4/- 1 ⌬F508/- 1 ⌬F508/S977F 1 R75Q/- 1 2183AA→G 1 M1137V/- 1 L997F/- IVS8-5T 5 5/7 1 5/9 1 5/5 CFTR, cystic fibrosis transmembrane conductance regulator; na, not available. Login to comment
46 The mutations found are listed by the CF Genetic Analysis Consortium as CF mutations (CFGAC),14 with the exception of G576A and R668C, which are not likely to cause CF14 and have been found in patients affected by congenital bilateral absence of the vas deferens (CBAVD). Login to comment

PMID: 16189704 [PubMed] McGinniss MJ et al: "Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples."

No. Sentence Comment

57 Subject 1 had a complex allele ([p.G576A; p.R668C]) which had been previously described in a patient with disseminated bronchiectasis (Pignatti et al. 1995). Login to comment

PMID: 16251901 [PubMed] Pompei F et al: "Haplotype block structure study of the CFTR gene. Most variants are associated with the M470 allele in several European populations."

No. Sentence Comment

30 The T2A rate was much lower than 1 Frequencies of the CFTR variants within the M or the V alleles exon or intron VARIANT SITES in the M genes (MM subjects) in the V genes (VV subjects) A 5' UTR 125 g/c 8/144 (0.056) 3/356 (0.008) -80 1 2 R31C 5/226 (0.004) 1/576 (0.002) -56 in M genes in V genes 6 2 R75Q 1/226 (0.004) 15/576 (0.026) -51 M V (ttga)n 0.461 0.017 7 3 G85E 0/226 (0) 1/576 (0.002) -51 2.214 0.362 (tg)n 0.616 0.114 B i 3 406-6 t/c 0/226 (0) 6/576 (0.010) -29 (t)n 0.499 0.036 8 4 R117H 2/226 (0.009) 0/576 (0) -29 10 4 I148T 3/224 (0.013) 0/576 (0) -29 C i 4 621+3 a/g 1/224 (0.004) 0/576 (0) -29 12 5 R170H 1/158 (0.006) 0/402 (0) -26 D i 6a 875+40 a/g 6/36 (0.167)c 0/118 (0)c -25 i 6b (ttga)6 13/36 (0.361) 1/118 (0.008) -23 E i 6b 1001+11 c/t 5/60 (0.083) 0/166 (0) -23 F i 8 1341+28 c/t 1/152 (0.007) 0/464 (0) -18 i 8 (tg)10 39/76 (0.513) 5/218 (0.023) -11 i 8 (tg)11 21/76 (0.276) 205/218 (0.940) -11 i 8 (tg)12 16/76 (0.211) 8/218 (0.037) -11 i 8 t5 4/76 (0.053) 2/218 (0.009) -11 i 8 t7 48/76 (0.632) 214/218 (0.982) -11 i 8 t9 24/76 (0.316) 2/218 (0.009) -11 16 10 M470V H ex 10 F508del 3/226 (0.013) 0/572 (0) 0 19 10 F508C 0/226 (0) 1/572 (0.002) 0 20 10 1716g/a 15/226 (0.066) 0/572 (0) 0 21 11 G542X 1/158 (0.006) 0/400 (0) +28 24 12 V562I 1/226 (0.004) 0/576 (0) +30 25 12 V562L 1/226 (0.004) 0/576 (0) +30 26 12 G576A 3/226 (0.013) 0/576 (0) +30 28 13 2082c/t 1/104 (0.010) 0/226 (0) +32 29 13 R668C 3/224 (0.013) 0/562 (0) +32 32 14a 2694t/g 45/70 (0.643) 9/208 (0.043) +35 I i 14a 2752-15 c/g 0/226 (0) 5/576 (0.009) +44 37 15 3030g/a 1/158 (0.006) 7/402 (0.017) +44 O i 15 3041-71 g/c 5/226 (0.022) 0/576 (0) +47 39 17a L997F 1/226 (0.004) 4/576 (0.007) +51 40 17a A1009T 0/226 (0) 1/572 (0.002) +51 42 17b F1052V 1/226 (0.004) 0/572 (0) +52 43 17b G1069R 1/226 (0.004) 0/572 (0) +52 44 17b Q1071H 1/226 (0.004) 0/572 (0) +52 45 17b 3417a/t 0/226 (0) 4/572 (0.007) +52 46 17b L1096R 1/226 (0.004) 0/572 (0) +52 52 19 3813a/g 0/118 (0) 1/484 (0.002) +68 53 19 S1235R 3/100 (0.030) 0/294 (0) +68 54 20 4002a/g 5/56 (0.089) 1/168 (0.006) +83 q in the M alleles q in the V alleles 56 21 4029a/g 0/194 (0) 3/506 (0.006) +93 57 21 N1303K 1/92 (0.011) 0/272 (0) +93 59 24 4404c/t 3/226 (0.013) 14/576 (0.024) +107 60 24 4521g/a 21/56 (0.375) 2/172 (0.012) +107 "slow evolution" markers "fast evolution" markers (i.e. STRs) H is the sum of the degrees of heterozygosity of all the markers Ref.No.a ABSOLUTE AND RELATIVE FREQUENCIES distance from the M470V siteb (Kb) H associated with the…. Login to comment

PMID: 16786510 [PubMed] Niel F et al: "A new large CFTR rearrangement illustrates the importance of searching for complex alleles."

No. Sentence Comment

101 [Gly576Ala; Arg668Cys] (Grangeia et al., personal communication). Login to comment

PMID: 17003641 [PubMed] Keiles S et al: "Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis."

No. Sentence Comment

54 Patients With More Than 1 CFTR Mutation CFTR Mutation 1 CFTR Mutation 2 CFTR Mutation 3 No. of Patients deltaF508 5T 3 deltaF508 D1152H 1 deltaF508 deltaF508 1 deltaF508 F575Y 1 deltaF508 K598E 1 deltaF508 T164S 1 deltaF508 R74W D1270N 1 deltaF508 Q1476X 1 deltaF508 L997F 1 R553X D1152H 1 R553X G1069R 1 2789+5 G9A 2183 AA9G 1 3849+10kb C9T L1260P 1 711+3 A to G I1139V 1 1341+1 G9A G194R 5T 1 621+25 A9G 3500-19 C9T 1 R74W V855I 1 G542X R117H 1 G551D F311L 1 G576A R668C 2 K710X L997F 1 L997F L320V 1 G1069R 5T 1 1818+18 G9A 5T 1 F1074L 5T 1 F834L 5T 1 R74Q R297Q 1 R74Q R297Q 5T 1 R785Q 5T 1 R117H 5T 3 deltaF508 I1027T 1 Total patients 36 MutationsinboldfacewouldnothavebeendetectedbytheAmericanCollegeofObstetrics and Gynecology (ACOG)/American College of Medical Genetics (ACMG) mutation panel. Login to comment
71 Patients With 1 CFTR Mutation CFTR Mutation 1 No. of Patients 1717-1 G9A 1 2789+5 G9A 1 3849+10kb C9T 2 3849+45 G9A 1 621+3 A9G 2 A1364V 1 A349V 1 A455E 1 D1152H 1 D1445N 1 deltaF508 16 E217G 1 F1286C 1 F316L 1 G542X 1 G551D 1 I148T 1 I807M 1 L206W 1 L967S 2 L997F 2 P55S 1 Q179K 1 Q220X 1 R117H 3 R1453W 1 R297Q 1 R31C 1 R668C 2 S1235R 1 S573C 1 S945L 1 V562A 1 V754M 2 Y1092X 1 Total patients 58 MutationsinboldfacewouldnothavebeendetectedbytheACOG/ACMGmutationpanel. Login to comment

PMID: 17035430 [PubMed] Ziedalski TM et al: "Prospective analysis of cystic fibrosis transmembrane regulator mutations in adults with bronchiectasis or pulmonary nontuberculous mycobacterial infection."

No. Sentence Comment

11 Other known CFTR mutations identified were V456A, G542X, R668C, I1027T, D1152, R1162L, W1282X, and L183I. Login to comment
113 In contrast to Table 3-Subjects With Normal Sweat Chloride Concentrations (< 40 mEq/dL)* Patient No. Age, yr Sex Bronch NTM† Other Infection‡ CFTR Mutations M470V Alleles IVS8 PolyT Sweat Chloride, mEq/dL 19 40 F Y Mab 1 7T/7T 19 20 41 F Y MAC 1 7T/7T 20 21 74 F Y MAC, Mgo Asp, Noc ⌬F508 1 7T/9T 22 22 28 M Y MAC L183I 1 7T/7T 23 23 49 F Y MAC 1 7T/7T 25 24 58 M Y MAC, Mfo 1 5T/7T 25 25 76 F Y MAC SA A394V 2 5T/9T 26 26 79 F Y MAC 1 7T/7T 27 27 58 F Y MAC R75Q 1 7T/7T 28 28 78 F Y MAC PA 1 7T/9T 31 29 64 F Y MAC 1 5T/9T 31 30 57 F Y MAC, Mxe R75Q 2 7T/7T 34 31 81 F Y MAC, Mmu R668C 1 7T/7T 34 32 82 F Y N PA F650L 1 5T/9T 33 33 69 F Y MAC, Mch, Mab PA ⌬F508 0 7T/9T 35 34 81 F Y MAC C1344S 2 7T/7T 38 35 72 F Y MAC R75Q 2 7T/7T 38 36 55 M Y N ⌬F508 1 7T/7T 21 37 61 F Y N 0 7T/9T 20 38 42 F Y N 1 9T/9T 21 39 50 M Y N PA, SA, Asp 1 5T/7T 22 40 71 M Y N 2 7T/7T 23 41 83 F Y N 2 7T/7T 23 42 46 M Y N 2 7T/7T 25 43 49 F Y N R75Q 2 7T/7T 33 44 48 F Y N PA R75Q 2 9T/9T 35 45 76 F Y N R1162L 1 7T/7T 35 46 67 M Y N A209S 0 9T/9T 36 47 46 F Y N 1 7T/7T 36 48 63 F N MAC 1 9T/9T § 49 60 F N MAC 1 7T/7T 31 50 40 F Y Mab 1 7T/7T 19 *See Tables 1 and 2 for expansion of abbreviations. Login to comment

PMID: 17329263 [PubMed] Ratbi I et al: "Detection of cystic fibrosis transmembrane conductance regulator (CFTR) gene rearrangements enriches the mutation spectrum in congenital bilateral absence of the vas deferens and impacts on genetic counselling."

No. Sentence Comment

69 Frequent cystic fibrosis transmembrane conductance regulator (CFTR) defects found in congenital bilateral absence of the vas deferens (CBAVD) patients (above 1% among the identified alleles) Mutation No. of alleles % of the 390 identified alleles F508dela 119 30.5 IVS8(T)5a,b 107 27.4 (TG)12(T)5 82 (TG)13(T)5 16 (TG)11(T)5b 9 R117Ha 25 6.4 R668C 9 2.3 [D443Y;G576A;R668C] 6 [G576A;R668C] 2 R668C 1 L206W 7 1.8 D1152H 6 1.5 W1282Xa 5 1.3 [V562I;(TG)11(T)5] 5 1.3 [R74W;D1270 N] 4 1.0 [R74W;D1270 N] 3 [R74W;V201M;D1270 N] 1 Q1352H(G . Login to comment
85 1 [R668C] þ [?] Login to comment

PMID: 17413420 [PubMed] Grangeia A et al: "Molecular characterization of the cystic fibrosis transmembrane conductance regulator gene in congenital absence of the vas deferens."

No. Sentence Comment

85 Three mutations were found as complex alleles (two or three sequence alterations associated in cis on the same allele), each in two patients, G576A-R668C, D443Y-G576A-R668C, and S1235R-T5 (one patient with T5 in homozygosity) (Table 2). Login to comment
97 The allelic frequency of the other mutations was 4.4% for R117H, G576A, and R668C, 3.3% for S1235R and 3272-26A¡G, and 2.2% for P205S, L206W, D443Y, G542X, D614G, and N1301K, whereas the remaining 12 mutations were present in single patients (Table 3). Login to comment
101 The missense M470V polymorphism was evaluated in all 45 pa- tientswithCAVD(Table2).TheallelicfrequencyoftheM470variant Table 2 CFTR genotypes identified in patients with congenital absence of the vas deferens CFTR mutation genotypes [(TG)mTn] genotype M470V Patients N % DeltaF508 (TG)10T9 (TG)12T5 M V 11 24.4 DeltaF508 (TG)10T9 (TG)11T5 M M 1 2.2 DeltaF508 R117H (TG)10T9 (TG)10T7 M M 2 4.4 G542X (TG)10T9 (TG)12T5 M V 2a 4.4 DeltaF508 R334W (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 D443Y-G576A-R668C (TG)10T9 (TG)10T7 M M 1 2.2 DeltaF508 D614G (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 E831X (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 L1227S (TG)10T9 (TG)11T7 M M 1 2.2 DeltaF508 E1401K (TG)10T9 (TG)11T7 M V 1 2.2 I507del D614G (TG)11T7 (TG)10T7 M V 1 2.2 N1303K L206W (TG)10T9 (TG)9T9 M M 1 2.2 R117H P205S (TG)11T7 (TG)10T7 M V 1 2.2 R117H R334W (TG)10T7 (TG)11T7 M V 1 2.2 R334W P439S (TG)11T7 (TG)11T7 M V 1 2.2 R334W R334Wb (TG)11T7 (TG)11T7 V V 1 2.2 R334W V562I (TG)11T7 (TG)11T5 V M 1 2.2 D443Y-G576A-R668C 3272-26A¡G (TG)10T7 (TG)10T7 M M 1 2.2 G576A-R668C V754Mb (TG)10T7 (TG)11T7 M M 1 2.2 S1235R S1235Rb (TG)13T5 (TG)13T5 M M 1 2.2 2789ϩ5G¡A S1235Rb (TG)10T7 (TG)13T5 M M 1 2.2 3272-26A¡G P1290S (TG)11T7 (TG)10T7 M V 1 2.2 P205S (TG)11T7 (TG)12T5 V V 1 2.2 G576A-R668C b (TG)10T7 (TG)11T5 M M 1 2.2 V1108L b (TG)11T7 (TG)11T5 V M 1 2.2 N1303K (TG)10T9 (TG)12T5 M V 1 2.2 3272-26A¡G b (TG)10T7 (TG)12T5 M V 1 2.2 CFTRdele2,3 b (TG)11T7 (TG)13T5 V M 1 2.2 b (TG)11T5 (TG)12T5 M V 1 2.2 b (TG)13T5 (TG)12T5 M V 1 2.2 DeltaF508 - (TG)10T9 (TG)11T7 M V 1a 2.2 L206W -b (TG)9T9 (TG)11T7 M V 1 2.2 R258G -b (TG)11T7 (TG)11T7 V V 1 2.2 a CUAVD. Login to comment
142 In fact, they occur in highly conserved regions of the CFTR protein, which share 100% amino acid sequence homology between species48 and affect the NBD1, NBD2, and transmembrane regions of the protein, which are known to regulate chloride conductance and permeability.49-51 P439S was previously reported in a child with CF with pancreatic insufficiency and mild lung disease, in association with the P439S/R688C genotype.52 The E1401K mutation occurs at a position in which other mutations, E1401X and E1401A, have been described in patients with CF with pancreatic insufficiency.8 Some difficulties in defining CF or CAVD-causing mutations were observed with some missense mutations.6,27 G576A and R668C have been found independently, in pairs, or combined with the D443Y mutation on the same chromosome in patients withaCF-relatedsyndrome.Inaccordancewithpreviousstudies, we expected that G576A and R668C were located in cis in two patients and combined with D443Y in the same chromosome in two patients.6,9,12 Although initially described as polymorphisms,27 they were later considered mild mutations associated with the CBAVD phenotype when combined in trans with the severedeltaF508mutation.53 However,ourpresentresultssuggest they might also cause the CAVD phenotype when associated with other mild CFTR mutations, because three of four patients carry- ingthesecomplexallelesharboredamildorverymildmutationin the other chromosome (D443Y-G576A-R668C/3272-26A¡G, Table 5 Comparative analysis of CFTR mutation allelic frequencies (%) in patients with congenital absence of the vas deferens Countries Patients T5 allele DeltaF508 R334W R117H References Argentina 36 NA 20.8 NA 5.6 43 Austria 22 NA 13.6 NA 9.1 44 Italy 12 8.3 29.2 NA 4.2 39 The Netherlands 21 9.5 19.0 NA 21.4 38 Germany 106 12.3 26.4 0.5 11.3 30 Greece 14 14.3 14.3 NA NA 32 France 800 16.3 21.8 NA 4.4 6 United States 92 17.9 21.2 NA 2.2 41 Canada 74 18.2 16.9 1.4 6.1 5 Turkey 51 19.6 2.9 NA NA 35 Brazil 17 20.6 11.7 NA 2.9 34 Spain 134 20.9 16.0 0.4 3.0 33 Iran 113 25.7 12.4 0.9 3.5 37 Egypt 16 43.7 6.2 NA NA 40 Taiwan 27 44.4 NA NA NA 42 Portugal 45 31.1 23.3 6.7 4.4 13, 36, PS NA, not available; PS, present study. Login to comment
143 G576A-R668C/V754M, G576A-R668C/T5), and only one case was associated with a severe mutation (DeltaF508del/D443Y-G576A-R668C). Login to comment

PMID: 17890437 [PubMed] Montgomery J et al: "Scanning the cystic fibrosis transmembrane conductance regulator gene using high-resolution DNA melting analysis."

No. Sentence Comment

98 Allele fraction (%) 1 125GϾC 3.8 3 356GϾA R75Q 3.5 4 605GϾC S158T Ͻ0.4b,c 6b 1001 ϩ 11CϾT 13.1 10 1540AϾG M470V 30.0d 1716GϾA 1.5 12 1859GϾC G576A 1.5 13 2134CϾT R668C 1.5 14a 2694TϾG 26.2 14b 2752 - 6TϾC 0.4 15 3032TϾC L967S 0.8 17b 3417AϾT T109S 1.5 19 3601 - 17TϾC 0.4 20 3891GϾA Ͻ0.4b,c 4002AϾG 1.5 21 4029AϾG 0.4 23 4294CϾG L1388V 0.4b 4316GϾA C1395Y 0.4b 4374 ϩ 13AϾG 0.4 24 4404CϾT 0.8 4521GϾA 20.8 a All variants were identified by scanning random panels and confirmed by sequencing. Login to comment

PMID: 18685558 [PubMed] Dequeker E et al: "Best practice guidelines for molecular genetic diagnosis of cystic fibrosis and CFTR-related disorders--updated European recommendations."

No. Sentence Comment

144 A (T)5 variant can either be associated with (TG)11, (TG)12, (TG)13, and rarely (TG)15 repeats.74 When (T)5 is found in diagnostic testing, for example, for CBAVD or atypical presentation, determination of Table 4 Classification of CFTR mutations with regard to their potential for causing disease Mutation group Examples CF-causing F508del Mainly nonsense, frameshift, splicing (invariant dinucleotide): G542X, R553X, W1282X, 2183AA4G, 3659delC, 1717-1G4A, 3120+1G4A Missense that severely affects CFTR synthesis or function: G551D, N1303K, R347P 2789+5G4A, 3849+10kbC4T, 3272-26A4G, L206Wa , D1152Ha , (TG)13(T)5a CFTR-related disorders associated L206Wa , D1152Ha , (TG)13(T)5a [R117H;(T)7], (TG)12(T)5, L997F, V562I, [R668C;G576A;D443Y], [R74W;D1270N] (TG)11(T)5b , S1235Rb No clinical consequences 875+40A4G, M470V (1540A4G), I506V (1648A4G), F508C (1655T4G), 1716G4A, 2694T4G, 4002A4G, 2752-15G4C (TG)11(T)5b , S1235Rb Unproven or uncertain clinical relevance Mainly missense mutations G622D, R170H, V938G, I125T Putative splice mutations: 406-6T4C, 2752-26A4G, 3601-17T4C Only a fraction of mutations and patients have been characterized in detail and, with the exception of frequent mutations, only small numbers of patients have been available for the study of most mutations. Login to comment

PMID: 18716917 [PubMed] George Priya Doss C et al: "A novel computational and structural analysis of nsSNPs in CFTR gene."

No. Sentence Comment

125 The nsSNPs which were predicted to be Table 1 List of nsSNPs that were predicted to be deleterious by SIFT and PolyPhen SNPs ID Alleles AA change Tolerance index PSIC rs1800072 G/A V11C 1.00 0.150 rs1800073 C/T R31C 0.18 2.288 rs1800074 A/T D44V 0.01 2.532 rs1800076 G/A R75Q 0.03 1.754 rs1800078 T/C L138P 0.01 2.192 rs35516286 T/C I148T 0.41 1.743 rs1800079 G/A R170H 0.05 1.968 rs1800080 A/G S182G 0.03 1.699 rs1800086 C/G T351S 0.30 1.600 rs1800087 A/C Q353H 0.03 2.093 rs4727853 C/A N417K 1.00 0.015 rs11531593 C/A F433L 0.65 0.694 rs1800089 C/T L467F 0.15 1.568 rs213950 G/A V470M 0.17 1.432 rs1800092 C/A/G I506M 0.00 1.574 rs1801178 A/G I507V 0.38 0.314 rs1800093 T/G F508C 0.00 3.031 rs35032490 A/G K532E 1.00 1.525 rs1800097 G/A V562I 0.13 0.345 rs41290377 G/C G576A 0.33 1.262 rs766874 C/T S605F 0.03 2.147 rs1800099 A/G S654G 0.03 1.611 rs1800100 C/T R668C 0.01 2.654 rs1800101 T/C F693L 0.61 0.895 rs1800103 A/G I807M 0.01 1.554 rs1800106 T/C Y903H 0.52 0.183 rs1800107 G/T S909I 0.10 1.624 rs1800110 T/C L967S 0.07 1.683 rs1800111 G/C L997F 0.24 1.000 rs1800112 T/C I1027T 0.03 1.860 rs1800114 C/T A1067V 0.04 1.542 rs36210737 T/A M1101K 0.05 2.637 rs35813506 G/A R1102K 0.52 1.589 rs1800120 G/T R1162L 0.00 2.038 rs1800123 C/T T1220I 0.22 0.059 rs34911792 T/G S1235R 0.45 1.483 rs11971167 G/A D1270N 0.12 1.739 rs4148725 C/T R1453W 0.00 2.513 Highly deleterious by SIFT and damaging by PolyPhen are indicated as bold deleterious in causing an effect in the structure and function of the protein by SIFT, PolyPhen and Pupasuite correlated well with experimental studies (Tsui 1992; Ghanem et al. 1994; Bienvenu et al. 1998) (Table 3). Login to comment

PMID: 18769034 [PubMed] Grangeia A et al: "Molecular and functional characterization of CBAVD-causing mutations located in CFTR nucleotide-binding domains."

No. Sentence Comment

216 Mutation P439S was previously reported in a 10-year old Hispanic boy with the R668C mutation in the other chromosome and with somewhat atypical features of CF such as a sweat Cl- level of 59 mmol/L, mild lung disease and pancreatic insufficiency [45]. Login to comment

PMID: 18951463 [PubMed] Krasnov KV et al: "Localization studies of rare missense mutations in cystic fibrosis transmembrane conductance regulator (CFTR) facilitate interpretation of genotype-phenotype relationships."

No. Sentence Comment

140 As for the remaining R1070W patients (8/24 with detailed clinical information), five individuals carried a CFTR mutation associated with pancreatic insufficiency (2869insG (c.2737insG, p.Tyr913fs); G542X (c.1624G4 T, p.Gly542X); R668C-K710X (c. Login to comment
142 [Arg668Cys,Lys710X]); N1303 K (c.3909C4G, p.Asn1303Lys); and S1235R (c.3705T4G, p.Ser1235Arg). Login to comment
144 The one remaining individual with the R1070W/R668C-K710X genotype had pancreatic-insufficient CF. Login to comment

PMID: 19318346 [PubMed] Goubau C et al: "Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis."

No. Sentence Comment

60 Table 2 CFTR mutations in the patient subgroups CF-PS CFTR dysfunction CF unlikely Genotype Subjects (n) Genotype Subjects (n) Genotype Subjects (n) F508del*/Not found 12 F508del*/3849+10 kb(C.T){ 11 Not found/Not found 39 Not found/Not found 10 F508del*/R117H{ 7 F508del*/Not found 4 F508del*/3849+10 kb(C.T){ 7 F508del*/Not found 7 IVS8-5T{/Not found 1 F508del*/R347P{ 5 Not found/Not found 5 S1235E/E528E 1 F508del*/R117H{ 4 F508del*/D1152H{ 4 No mutation analysis 1 F508del*/2789+5G.A{ 4 F508del*/IVS8-5T{ 4 Total 46 F508del*/S945L* 3 F508del*/S945L* 2 2789+5G.A{/Not found 3 W1282X*/IVS8-5T{ 2 F508del*/3272-26 A.G{ 2 F508del*/R1070W{ 1 F508del*/A455E{ 2 F508del*/L159S 1 F508del*/711+5G.A 2 F508del*/T1246I 1 F508del*/2789+5G.A 2 F508del*/L165S 1 G542X*/R334W{ 2 W1282X*/D1152H{ 1 F508del*/R334W{ 2 R1162X*/D1152H{ 1 R347P{/Not found 2 R347Hu/D1152H{ 1 F508del*/2116delCTAA 1 R553X*/R117H{ 1 F508del*/IVS8-5T{ 1 3659delC*/R117H{ 1 F508del*/D1152H{ 1 3849+10kb(C.T){/G551R 1 F508del*/711+3A.G 1 R1162X*/3849+10 kb(C.T){ 1 F508del*/L206W{ 1 2789+5G.A{/Not found 1 F508del*/I336K{ 1 G542X*/T854A 1 F508del*/G970D 1 R553X*/Q1463H 1 F508del*/L159S 1 S1235R/R668C 1 F508del*/R751L 1 2789+5G.A{/S977F 1 F508del*/E656X 1 No mutation analysis 1 F508del*/4015delA 1 Total 59 F508del*/Y913S 1 F508del*/L165S 1 F508del*/2143delT 1 G551D*/I336K{ 1 G551D*/3272-26A.G{ 1 G551D*/711+3A.G 1 R553X*/4005+2T.C 1 R553X*/E92K{ 1 G542X*/L206W{ 1 W1282X*/I336K 1 R1162X*/3849+10 kb(C.T){ 1 R1162X*/2789+5G.A{ 1 574delA*/3141del9 1 9890X/I105N 1 R334W{/R1070Q{ 1 3272-26A.G{/4218insT 1 3272-26A.G{/L165S 1 711+3A.G/G1244E 1 R352Q/1812-1G.A 1 F1052V/IVS8-5T{ 1 R74W/D1270N 1 1898-3G.A/1898-3G.A 1 1717-1G.A*/R334W{ 1 3659delC*/Not found 1 394delTT/Not found 1 R1162X*/Not found 1 R553X*/Not found 1 R117H{/Not found 1 G85E*/Not found 1 3849+10k(C.T){/Not found 1 Total 103 *Mutation class I, II or III. Login to comment

PMID: 19812525 [PubMed] de Cid R et al: "Independent contribution of common CFTR variants to chronic pancreatitis."

No. Sentence Comment

38 Scanning Methodology Applied in CFTR Gene Analysis Amplicon Name Fragment Size, bp Control Set (n = 93) Patient Set 1 (n = 68) Patient Set 2 (n = 68) Control Sequence Exon 1 192 SSCP/HD SSCP/HD dHPLC 125G9C Exon 2 334 SSCP/HD SSCP/HD dHPLC 296+3insT Exon 3 309 DGGE DGGE dHPLC G85V Exon 4 436 SSCP/HD SSCP/HD dHPLC R117H Exon 5 466 DGGE DGGE dHPLC R170H Exon 6a 345 SSCP/HD SSCP/HD dHPLC L206W Exon 6b 331 SSCP/HD SSCP/HD SSCP/HD TTGA 6/7 Exon 7 410 SSCP/HD SSCP/HD dHPLC R334W Exon 8 328 DGGE DGGE dHPLC 1341+28C9T Exon 9 375 DGGE DGGE DGGE 7T/9T Exon 10 493 SSCP/HD SSCP/HD SSCP/HD F508del; 1540A/A Exon 11 322 DGGE DGGE dHPLC S549R Exon 12 426 DGGE DGGE dHPLC G576A Exon 13a 532 SSCP/HD SSCP/HD dHPLC R668C Exon 13b 498 SSCP/HD SSCP/HD dHPLC I807M Exon 14a 284 DGGE DGGE DGGE 2694T9G Exon 14b 211 DGGE DGGE dHPLC 2789+5G9A Exon 15 487 DGGE DGGE dHPLC D924N Exon 16 294 SSCP/HD SSCP/HD dHPLC 3041-71G9C Exon 17a 294 SSCP/HD SSCP/HD dHPLC L997F Exon 17b 463 DGGE DGGE dHPLC 3272-26A9G Exon 18 451 DGGE DGGE dHPLC N1148K Exon 19 588 SSCP/HD SSCP/HD SSCP/HD 3601-65C9A Exon 20 471 DGGE DGGE dHPLC W1282X Exon 21 477 DGGE DGGE DGGE 4029G9A Exon 22 339 SSCP/HD SSCP/HD dHPLC Q1352H Exon 23 249 DGGE DGGE dHPLC 4374+13A9G Exon 24 362 SSCP/HD SSCP/HD SSCP/HD 4521G9A Control set, general population series analyzed; patient set 1, previous patient series reported in 2004; and patient set 2, new patient series analyzed in this study. Login to comment
74 To simplify, as previously mentioned, the 4 CFTR-related disorderYassociated mutations, 5T-12TG, L997F, R297Q, and D443Y-G576A-R668C, have been grouped together with the CF-causing mutations in front of other CFTR mutations without or unknown clinical relevance13 (Table 3). Login to comment
81 CFTR Genotypes in Chronic Pancreatitis Patients and General Population Pt/Phenotype CFTR Genotype Pt/Phenotype CFTR Genotype 1/ACP F508del† , I1027T/j 19/ACP* R668C/j 2/ACP* F508del† /j 20/ACP D836Y/j 3/ACP F508del† , I1027T/Y1014C 21/ACP* L997F† /j 4/ACP F508del† /1716G9A 22/ACP* R1162L/j 5/ACP* F508del† /1716G9A 23/ACP 5T-11TG/j 6/ACP* F508del† /S1235R 24/ACP 5T-11TG/j 7/ACP G542X† /j 25/ACP 5T-11TG/j 8/ACP* W1282X† /j 26/ACP* 5T-11TG/j 9/ACP 5T-12TG† /5T-11TG 27/ACP* 5T-11TG/j 10/ACP* 5T-12TG† /j 28/ACP 1716G9A/4374+13A9G 11/ACP R75Q/j 29/ACP 1716G9A/j 12/ACP R75Q/j 30/ACP 1716G9A/j 13/ACP Y122C/Y122C 31/ACP 1716G9A/j 14/ACP* R170C/j 32/ACP 1716G9A/j 15/ACP* R258G/j 33/ACP* 1716G9A/j 16/ACP* M281T/j 34/ACP 2377C9T/j 17/ACP* R297Q† /- 35/ACP* 2377C9T/j 18/ACP T351S/- 36/ACP 3499+37G9A/j 1/ICP F508del† /- 10/ICP* 1716G9A/j 2/ICP D443Y,G576A,R668C† /j 11/ICP* 1716G9A/j 3/ICP* D443Y,G576A,R668C† /j 12/ICP 1716G9A/j 4/ICP* P205S† /j 13/ICP* 1716G9A/j 5/ICP* L997F† /j 14/ICP* 1716G9A/j 6/ICP* R170H/1716G9A 15/ICP* 1716G9A/j 7/ICP 109A9G/j 16/ICP* 1716G9A/j 8/ICP* 5T-11TG/j 17/ICP 1716G9A/j 9/ICP* 5T-11TG/j 1/GP 5T-12TG† /j 8/GP 1716G9A/j 2/GP 5T-12TG† /j 9/GP 1716G9A/j 3/GP A534E† /j 10/GP 1716G/A/j 4/GP 5T-11TG/V562I 11/GP 1716G9A/j 5/GP 5T-11TG/j 12/GP 1716G9A/j 6/GP 5T-11TG/j 13/GP 3690A9G/j 7/GP 1716G9A/j 14/GP 3690A9G/j Corresponding mutation nomenclature (Human Genome Variation Society and Cystic Fibrosis Mutation Data Base): c.1584G9A (1716G9A), c.1210-7_1210-6delTT (5T), 1210-34_1210-13TG (11TG), g.-23A9G (109A9G), c.4242+13A9G (4374+13A9G), c.2245C9T (2377C9T), c.3367+ 37G9A (3499+37G9A), and c.3558A9G (3690A9G). Login to comment
82 *Patients previously reported.12 † CF-causing mutations and mutations associated to CFTR-related disorders (5T-12TG, L997F, R297Q, and D443Y-G576A-R668C). Login to comment

PMID: 20059485 [PubMed] Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"

No. Sentence Comment

64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

PMID: 20167849 [PubMed] Bienvenu T et al: "Cystic fibrosis transmembrane conductance regulator channel dysfunction in non-cystic fibrosis bronchiectasis."

No. Sentence Comment

82 GENOTYPE AND PHENOTYPE OF PATIENTS WITH DIFFUSE BRONCHIECTASIS BEARING TWO CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR MUTATIONS Patient No. Age (yr) Sex (M/F) CFTR Mutations Sweat Cl2 (mmol/L) Basal PD (mV) NPD Index Age at Onset (yr) FEV1 (% pred) Bacteria Colonization 1 55 F F508del/D1152H 19 219 1.00 54 99 Sa 2 71 F F508del/G576A-R668C 29 223 0.44 70 114 None 3 24 M G542X/3849110kbCT 52 224 1.22 10 78 Pa 4 41 F 394delTT/D1152H 19 225 0.30 41 89 Sa 5 31 M 3849110kbC.T/3849110kbC.T 35 230 0.64 2 30 Sa/Pa 6 74 F G542X/S912L 40 233 0.19 60 106 None 7 50 M W1282X/D1152H 35 236 1.00 10 32 Pa 8 42 F F508del/D1152H 13 240 0.68 30 32 Pa 9 56 F F508del/IVS8-5T 30 242 0.70 10 70 None 10 45 F 394delTT/D1152H 25 242 0.71 18 62 Sa/Pa 11 74 F W1282X/D1152H 25 244 0.66 12 56 Pa 12 23 F S1206X/D1152H 19 244 0.68 13 107 None 13 41 F R553X/R851L-T351S 31 248 0.50 35 72 Pa 14 58 M F508del/R117H-7T 46 251 0.61 45 35 Sa/Pa 15 53 F F508del/R347H 49 258 0.63 40 77 Pa Definition of abbreviations: Cl2 5 chloride; F 5 female; M 5 male; NPD index 5 nasal potential difference index 5 e(response to øCl2 and iso/response to amil); a cut off . Login to comment

PMID: 20416310 [PubMed] Ooi CY et al: "Genetic testing in pancreatitis."

No. Sentence Comment

53 Interpretation of Mutations Requires an Understanding of Their Functional Consequences Mutation group Reported mutations Complex allele: These mutations are recognized to occur on a single allele R117H ϩ T G576A ϩ R668C F508del ϩ I1027T Benign sequence alterations: These mutations have no known clinical consequence R74Q R297Q R74W 621 * 25 AϾG 3500-19 CϾT T164S C855I I1139V CFTR-related disorder associated: These mutations have been described in individuals with CF-like single organ disease (such as pancreatitis, sinopulmonary disease, or obstructive azoospermia), but do not fulfill the diagnostic criteria for CF 5T R117H D1270N L320V Q1352H 1818-18 GϾA S1235R CF causing F508del Q1476X R553X K710X G542X G551D F311L 2789-5 GϾA 2183AAϾG 711ϩ3 AϾG 3849ϩ10kb CϾT 1341ϩ1GϾA D1152Ha F1074La R553X Unknown clinical consequence F575Y L1260P G194R G1069R L997F K598E F834L R785Q To illustrate this point, mutations identified by extensive mutation testing in a cohort of patients with recurrent acute or chronic pancre- atitis14 are listed according to their clinical consequences (based on current consensus guidelines13 and functional and/or clinical reports; available: http://www.genet.sickkids.on.ca). Login to comment

PMID: 20538955 [PubMed] Sermet-Gaudelus I et al: "Clinical phenotype and genotype of children with borderline sweat test and abnormal nasal epithelial chloride transport."

No. Sentence Comment

162 CLINICAL CHARACTERISTICS OF CHILDREN WITH EQUIVOCAL DIAGNOSES AND NASAL POTENTIAL DIFFERENCE DIAGNOSTIC SCORE <0.27 Pt Mutation Age (yr) NPD Score Sweat Cl2 Chronic CF Pulmonary Disease CF Pathogens Airway Obstruction CF Lung Imaging FEV1 (%) BMI Others 1 F508del/S977F A-D 8 0.181 43 RLRTI, chronic productive cough S. aureus No Bronchiectasis 80 14.5 No Bronchial thickening Atelectasis 2 0/0 4 0.121 43 No S. aureus Yes Air trapping NA 13 Pancreatic extracts 0-0 Bronchial thickening 3 0/0 15 20.032 46 RLRTI S. aureus, P. aeruginosa Yes Air trapping 74 14 Polyposis 0-0 Bronchiectasis 4 F508del/0 2 20.249 57 RLRTI P. aeruginosa Yes Air trapping NA 16 No A-0 5 N1303K/(TG12)T5 11.8 20.263 47 RLRTI S. aureus, P. aeruginosa No Bronchial thickening ND 20 No A-B 6 F508del/L206W 5.9 20.278 40 RLRTI S. aureus No Bronchial thickening 115 22 Chronic pancreatitis A-AB 7 R668C/0 15 20.403 40 RLRTI None Yes Bronchiectasis 112 20 No B-0 Air trapping 8 F508del/L997F A-B 1 20.594 38 RLRTI, chronic productive cough P. aeruginosa No Bronchial thickening NA 16 CF hepatopathy 9 G576A;R668C/S1235R 8 20.659 31 0 None Wheezing Normal 100 20 No B-B 10 G542X/0 5 20.718 49 RLRTI, chronic productive cough S. aureus No Bronchial thickening NA 18 No A-0 11 0/0 7 20.742 37 RLRTI None No Normal 106 18 No 0-0 12 F508del/D110E 16 20.777 50 No S. aureus No No 100 21 No A-AB 13 F508del/R1070W 7 21.006 40 RLRTI S. aureus Wheezing Bronchial thickening 110 14 No A-AB 14 F508del-L467F/0 12 21.897 55 RLRTI, chronic productive cough S. aureus No Bronchiectasis 109 17 Pansinusitis A-0 15 F508del/H1054D 9 22.327 59 RLRTI, chronic productive cough S. aureus No Bronchial thickening 100 20 DIOS A-D Definition of abbreviations: A, B, AB, and D: A 5 CF-causing mutation; B 5 mutation that results in a CFTR-RD (clinical entities associated with CFTR mutations that do not meet the current diagnostic criteria for CF); AB 5 wide-spectrum mutation that may belong to either group A or group B; D 5 mutation of uncertain clinical relevance; BMI 5 body mass index; CF 5 cystic fibrosis; CFTR 5 gene encoding cystic fibrosis transmembrane conductance regulator; DIOS 5 distal intestinal obstructive syndrome; NA 5 not applicable; ND 5 not determined; NPD 5 nasal potential difference; P. aeruginosa 5 Pseudomonas aeruginosa; Pt 5 patient; RLRTI 5 recurrent lower respiratory tract infection; S. aureus 5 Staphylococcus aureus. Login to comment

PMID: 20706124 [PubMed] Lucarelli M et al: "A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation."

No. Sentence Comment

103 In vivo findings and, in some cases, in vitro functional characterizations have been reported for [F508C; S1251N],38 [R347H; D979A],39,40 [R74W; D1270N],41 [G628R; S1235R],42,43 [M470V; S1235R],42 [S912L; G1244V],44 [R117H; (TG)mTn],45-47 [R117C; (TG)mTn],46 [S1235R; (TG)mT5],48 [G576A; R668C],10,49 [V562I; A1006E],49 [R352W; P750L],49 [1198_1203del TGGGCT; 1204GϾA],49 [V754M; CFTRdele3_10,14b_16],50 and [F508del; I1027T].51 These complex alleles have been found in patients with either CF or CFTR-RD, although more often in the former. Login to comment

PMID: 20717170 [PubMed] Rene C et al: "p.Ser1235Arg should no longer be considered as a cystic fibrosis mutation: results from a large collaborative study."

No. Sentence Comment

79 In the last case, the fetus carried the complex allele (p.Gly576Ala; p.Arg668Cys), considered as a mild mutation involved in CBAVD or disseminated bronchiectasis phenotypes in adults.29-31 Although the fetus presented hyperechogenic fetal bowel, the parents were reassured regarding the risk of classical CF. Login to comment
95 of subjects Allele 1 Allele 2 p.Ser1235Arg;p.Arg785X p.Phe508del Severe CF 2 p.Ser1235Arg;p.Arg785X NAa Severe CF 1 p.Ser1235Arg;875+1G4A (c.743+1C4A) 3629delT (c.3497delT) Severe CF 1 p.Ser1235Arg;p.Arg785X p.Gly542X Severe CF 1 p.Ser1235Arg;(TG)13(T)5 p.Gly551Asp Mild CF 1 p.Ser1235Arg;(TG)13(T)5 p.Phe508del CBAVD 6 p.Ser1235Arg;(TG)13(T)5 p.Arg1070Trp CBAVD 1 p.Ser1235Arg;(TG)13(T)5 p.Arg117His; (T)7 CBAVD 1 p.Ser1235Arg p.Phe508del CBAVD 1 p.Ser1235Arg - CBAVD 1 p.Ser1235Arg;(TG)13(T)5 p.Phe508del CUAVD 1 Suspicion CF/mild phenotype: p.Ser1235Arg - Genital symptoms 5 p.Ser1235Arg - Respiratory symptoms 16 p.Ser1235Arg;(TG)13(T)5 p.Phe508del Respiratory symptoms 2 p.Ser1235Arg 406-6T4C (c.274-6T4C) Respiratory symptoms 1 p.Ser1235Arg p.Tyr1092X Respiratory symptoms 1 p.Ser1235Arg p.Glu831X Respiratory symptoms 1 p.Ser1235Arg p.Gln493X Respiratory symptoms 1 p.Ser1235Arg p.Ile507del Respiratory symptoms 1 p.Ser1235Arg - Digestive symptoms 13 p.Ser1235Arg p.Gly542X Digestive symptoms 1 p.Ser1235Arg - Hyperechogenic fetal bowel 5 p.Ser1235Arg p.Arg668Cys; p.Arg576Ala Hyperechogenic fetal bowel 1 p.Ser1235Arg p.Val920Met Hyperechogenic fetal bowel 1 p.Ser1235Arg p.Phe508del Hyperechogenic fetal bowel 1 aNA: not available; we could only test the mother and a healthy sister (the patient was deceased and the father`s DNA was not available). Login to comment

PMID: 20977904 [PubMed] Schneider A et al: "Combined bicarbonate conductance-impairing variants in CFTR and SPINK1 variants are associated with chronic pancreatitis in patients without cystic fibrosis."

No. Sentence Comment

123 Total CFTR Sequencing Results of Healthy Controls CFTR mutations SPINK1 mutations 1 -/- N34S/- 2 1584GtoA/-a N34S/- 3 F508del/-a -/- 4 F508del/-a -/- 5 G576AϩR668C/- -/- 6 IVS8 T5-TG12/-a -/- 7 IVS8 T5/TG12/- -/- 8 R75Q/-a -/- 9 R75Q/-a -/- 10 R75Q/-a -/- 11 R75Q/-a -/- 12 R75Q/-a -/- 13 R75Q/-a -/- 14 R75Q/-a -/- 15 R75Q/-a -/- 16 R75Q/-a -/- 17 9CtoT/- -/- 18 C76W/-a -/- 19 T1086A/- -/- 20 R668C/- -/- 21 N1432K/- -/- 22 I148T/- -/- 23 2657ϩ22GtoA/- -/- 24-95 -/- -/- NOTE. Login to comment
92 Two peculiar mutations that occurred in both populations, c.1584GtoA (1716GtoA legacy name) and p.R75Q, have been generally regarded as benign sequence variations28 (www.genet.sickkids. on.ca) but repeatedly show association to CF-related diseases, pancreatitis,29-31 and some patients with atypical CF.32 Two individual nonsynonymous sequence changes, p.R668C and p.I148T, were identified with CFTR full sequencing in one control each but without additional mutations found in cis (p.D443Y ϩ p.G576A and c.3067del6 [ie, 3199del6], respectively). Login to comment
136 CFTR Mutation Class Types and Corresponding Disease Severity CFTR mutation Exon CF mutation class Disease association % Carriers, case (n) % Carriers, controls (n) p.R75Q 3 "CP" 16.2 (80) 5.3 (525) c.1584GtoA (p.E528E) 10 "CP" 8.7 (80) 3.3 (150) p.F508del 10 II CF severe 8.7 (80) 2.3 (525) p.R560T 11 II CF severe 3.4 (29) 0 (95) IVS8 T5/TG12or13 i8 V CF mild 5.0 (80) 2.7 (150) p.F508C 10 CF mild 1.2 (80) 0 (150) p.I807M 13 CF mild 3.4 (29) 0 (95) p.D443YϩG576AϩR668Ca 9;12;13 CF mild 3.4 (29) 0 (95) p.G576AϩR668Ca 12;13 CF mild 0 (29) 1 (95) p.M952T 15 CF mild 3.4 (29) 0 (95) p.R668C 13 Other 0 (29) 1 (95) c.3139ϩ42AtoT i17a Other 3.4 (29) 0 (95) p.N1432K 24 Other 0 (29) 1 (95) c.-9CtoT 1 Other 0 (29) 1 (95) p.C76W 3 Other 0 (80) 0.7 (150) p.I148T 4 Other 0 (29) 1 (95) c.2657ϩ22GtoA i14b Other 0 (29) 1 (95) p.T1086A 17b Other 0 (29) 1 (95) NOTE. Login to comment

PMID: 9620832 [PubMed] Kanavakis E et al: "Cystic fibrosis mutation screening in CBAVD patients and men with obstructive azoospermia or severe oligozoospermia."

No. Sentence Comment

64 Cystic fibrosis transmembrane conductance regulator (CFTR), PolyT genotypes and clinical data of men with congenital bilateral absence of the vas deferens (CBAVD, n ϭ 14), obstructive azoospermia (ObsA, n ϭ 10) and oligozoospermia (n ϭ 3) Patients Sweat chloride CFTR IVS8-polyT Other clinical (mEq/l) mutations alleles features Two mutations detected MS1 (CBAVD) 107.7 ∆F508/M1I 5T/9T Recurrent bronchitis MS6 (CBAVD) 74.5 ∆F508/711ϩ3AϾG 9T/7T Chronic cough MS19 (CBAVD) 51 W496X/F1052V 9T/9T MS24 (CBAVD) Ͻ40 D565G/R668C 7T/7T One mutation detected MS5 (CBAVD) Ͻ40 3272-26AϾG/- 7T/7T MS12 (CBAVD) Ͻ40 ∆F508/- 9T/7T MS14 (CBAVD) Ͻ40 ∆F508/- 9T/5T MS15 (CBAVD) 57.7 L732X/- 7T/5T Dehydration/recurrent bronchitis MS16 (CBAVD) Ͻ40 711ϩ3AϾG/- 7T/5T MS20 (CBAVD) Ͻ40 4010delTAT/- 7T/7T MS18 (ObsA) 48 ∆F508/- 5T/9T MS11 (ObsA) Ͻ40 R75Q/- 7T/7T MS23 (ObsA) Ͻ40 2790-8CϾG/- 7T/7T No mutation detected MS7 (CBAVD) Ͻ40 -/- 7T/7T MS10 (CBAVD) Ͻ40 -/- 7T/7T MS21 (CBAVD) Ͻ40 -/- 7T/9T MS28 (CBAVD) Ͻ40 -/- 7T/7T MS2 (ObsA) 54.2 -/- 7T/7T MS8 (ObsA) Ͻ40 -/- 7T/7T MS17 (ObsA) 50 -/- 7T/7T MS22 (ObsA) Ͻ40 -/- 7T/9T MS25 (ObsA) Ͻ40 -/- 7T/7T MS26 (ObsA) Ͻ40 - / - 7T/7T MS27 (ObsA) Ͻ40 -/- 7T/7T MS3 (oligozoospermia) 50 -/- 7T/7T MS4 (oligozoospermia) Ͻ40 -/- 7T/7T MS13 (oligozoospermia) Ͻ40 -/- 7T/7T Table II. Login to comment
81 No mutation, except for ∆F508, was prevalent in individuals in this study and all of the mutations found in the CBAVD patients, except for the novel D565G and mutation R668C, have also been found in Greek CF patients (Tzetis et al., 1977). Login to comment
85 R668C was initially reported as a polymorphism but has since been reported as a mutation in cases of disseminated bronchiectasis (DB) and in CBAVD (Chillon et al., 1995; Pignatti et al., 1996). Login to comment

PMID: 9921909 [PubMed] Bombieri C et al: "Complete mutational screening of the CFTR gene in 120 patients with pulmonary disease."

No. Sentence Comment

62 Five mutations (G576A, R668C, R74W, R31C, and I506V) are not thought to be the cause of CF (CFGAC website): three of them (G576A, R668C, and R74W) have been found in CBAVD patients (Anguiano et al. 1992; Chillon et al. 1995; Mercier et al. 1995; Verlingue et al. 1996), R31C was described in a DBE patient (Girodon et al. 1997), and I506V was found in the normal allele in the father of a CF child (Ghanem et al. 1994). Login to comment
67 Two compound heterozygotes were observed: G576A-R668C/L997F, and ∆F508/L997F. Login to comment
88 of cases CFTR gene PolyTb status tested mutationa DBE 23 1 G576A-R668C/L997F 7/9 1 ∆F508/L997F 9/9 1 ∆F508/- 7/9 1 R1066C/- 5/7 1 3667ins4/- 5/7 1 R75Q/- 7/7 1 M1137V/- 7/7 1 -/- 5/5 3 -/- 5/7 10 -/- 7/7 2 -/- 7/9 CB 27 1 P111L/- 7/7 1 R117H/- 7/7 1 E585X/- 7/7 1 P1072L/- 7/7 1 -/- 5/7 15 -/- 7/7 6 -/- 7/9 1 -/- 9/9 E 25 1 R668C/- 7/7 6 -/- 5/7 16 -/- 7/7 6 -/- 7/9 S 8 1 E826K/- 7/7 1 ∆F508/- 7/9 1 4382delA/- 7/7 1 L997F/- 7/9 1 V754M/- 7/9 3 -/- 7/7 LC 26 1 I148T/- 5/7 1 D1270N-R74W 5/7 1 D651N/- 7/7 1 Y301C/- 7/7 1 -/- 5/7 16 -/- 7/7 5 -/- 7/9 TB 4 1 -/- 5/7 1 -/- 7/7 2 -/- 7/9 Pneumonia 5 4 -/- 7/7 1 -/- 5/7 Pnx 2 2 -/- 7/7 Controls 68 1 L997F/- 7/9 1 R31C/- 7/7 1 I506V/- 5/7 1 -/- 5/7 1 -/- 5/9 23 -/- 7/7 4 -/- 7/9 1 -/- 9/9 2 ? Login to comment

PMID: 16128988 [PubMed] Larriba S et al: "Molecular evaluation of CFTR sequence variants in male infertility of testicular origin."

No. Sentence Comment

51 CFTR analysis We identified 14 different, potential disease-causing CFTR sequence variants, 11 of them are translated into missense amino acid changes (p.R75Q, p.P111L, p.R117H, p.I148T, p.R334W, p.M348K, p.G576A, p.R668C, p.D1270N, p.S1235R and p.S1426F), one deletion (p.F508del) and two alleles affecting exon splicing [IVS8-6(5T), c.1716G>A] in 30 of 83 infertile patients (Table 1) giving a frequency of 36.1%. Login to comment
53 Thirteen CFTR gene sequence variants [p.R75Q, p.I148T, p.T351S, p.F508del, p.G576A, p.R668C, p.E725K, p.V754M, p.D836Y, p.L997F, p.S1235R, IVS8-6(5T) and c.1716G>A] were determined in 11 F1 and 15 F2 individuals (Table 1) giving a frequency of 29.9%. Login to comment
72 Description of genetic abnormalities and other risk factors of infertile and fertile CFTR carrier individuals No. Phenotype CFTR genotype Associated factors Testicular histologya b c Infertile individuals 1 NOb (SO) p.R75Q No Severe hypospermatogenesis 2 NOb (SO) p.R75Q No nd 3 NOb (A) p.P111L AZFb,c del Sertoli cell only 4 NOb (A) p.R117H AZFc del Severe hypospermatogenesis 5 NOb (SO) p.I148T No Severe hypospermatogenesis 6 NOb (A) p.R334W No Primary spermatocyte arrest 7 NOb (SO) p.M348K UV grade III Primary spermatocyte arrest 8 NOb (A) p.F508del No Sertoli cell only 9 NOb (A) p.F508del No Primary spermatocyte arrest 10 NOb (A) p.G576A, p.R668C No Severe hypospermatogenesis, Leydig cell hyperplasia 11 NOb (SO) p.G576A, p.R668C No Primary spermatocyte arrest (unilateral) 12 NOb (SO) p.G576A, p.R668C No Severe hypospermatogenesis 13 NOb (A) p.R668C UC Sertoli cell-only (incomplete) 14 NOb (SO) p.D1270N No nd 15 NOb (SO) p.S1235R No Severe hypospermatogenesis 16 NOb (SO) p.S1426F* UC Sertoli cell only 17 NOb (A) (T)5-(TG)12 No Severe hypospermatogenesis, Sertoli cell only (80%) 18 NOb (A) (T)5-(TG)12 No Sertoli cell only 19 NOb (SO) (T)5-(TG)11 UV grade III Bilateral moderate hypospermatogenesis 20 NOb (SO) (T)5-(TG)11 UV grade II Severe hypospermatogenesis 21 NOb (A) (T)5-(TG)11 No nd 22 NOb (SO) c.1716 G>A Dysplasia SV Severe hypospermatogenesis, Sertoli cell only (95%) 23 NOb (A) c.1716 G>A No nd 24 NOb (A) c.1716 G>A No Primary spermatocyte arrest (bilateral) 25 NOb (SO) c.1716 G>A No Sertoli cell only (95%) 26 NOb (SO) c.1716 G>A No Severe hypospermatogenesis 27 NOb (SO) c.1716 G>A UV grade III Severe hypospermatogenesis 28 NOb (SO) c.1716 G>A No nd 29 NOb (SO) c.1716 G>A No nd 30 NOb (SO) c.1716 G>A AZFc del Severe hypospermatogenesis Fertile individuals 1 F1 p.R75Q No nd 2 F1 p.F508del No nd 3 F1 p.F508del No nd 4 F1 p.G576A, p.R668C/ c.1716 G>A No nd 5 F1 p.D836Y No nd 6 F1 p.S1235R/c.1716 G>A No nd 7 F1 c.1716 G>A No nd 8 F1 c.1716 G>A No nd 9 F1 c.1716 G>A No nd 10 F1 c.1716 G>A No nd 11 F1 c.1716 G>A No nd 12 F2 p.R75Q No nd the expected CF carrier frequency in the local population (Van der Ven et al., 1996; Larriba et al., 2001; Dohle et al., 2002) or with the general population (Jakubiczka et al., 1999; Pallares-Ruiz et al., 1999; Ravnik-Glavac et al., 2001) and not normospermic fertile individuals, the latter considered as adequate controls. Login to comment
78 Some variants affect normal mRNA splicing leading to skipping of exon 9 [IVS8-6(5T) (Chu et al., 1993)], exon 10 [c.1716G>A (p.E528E) (Dork et al., 1997)] and exon 12 [p.G576A and p.R668C (Pagani et al., 2003]. Login to comment

PMID: 17331079 [PubMed] Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."

No. Sentence Comment

52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment
67 Seven other complex alleles were observed: [c.296 + 3insT; p.V754M], [p.F508del; p.I1027T], [p.S549R; -102T > A], [p.G576A; p.R668C], [p.R1070W; p.R668C], [p.D1270N; p.R74W] and [p.T1299I; p.I148T]. Login to comment

PMID: 22678879 [PubMed] El-Seedy A et al: "CFTR mutation combinations producing frequent complex alleles with different clinical and functional outcomes."

No. Sentence Comment

2 To elucidate the clinical significance of complex alleles involving p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys, we performed a collaborative genotype-phenotype correlation study, collected epidemiological data, and investigated structure-function relationships for single and natural complex mutants, p.[Gly576Ala;Arg668Cys], p.[Gly149Arg; Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala; Arg668Cys]. Login to comment
5 Functional studies performed on all single and natural complex mutants showed that (1) p.Gly149Arg results in a severe misprocessing defect; (2) p.Asp443Tyr moderately alters CFTR maturation; and (3) p.Gly576Ala, a known splicing mutant, and p.Arg668Cys mildly alter CFTR chloride conductance. Login to comment
6 Overall, the results consistently show the contribution of p.Gly149Arg to the CF phenotype, and suggest that p.[Arg668Cys], p.[Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys] are associated with CFTR-related disorders. Login to comment
20 Although some variants have been considered neutral because they were identified in the non-CF allele of the parents of CF patients, they seem to be involved in moderate forms or syndromes of late onset, as reported for c.2002C>T, p.Arg668Cys (R668C) and c.1727G>C, p.Gly576Ala (G576A) [Fanen et al., 1992]. Login to comment
24 We thus implemented a collaborative study through the FrenchCFLaboratoryNetworktocollectallpatientsandindividuals carrying p.Asp443Tyr, p.Gly576Ala, p.Arg668Cys, and p.Gly149Arg, either in isolation or in complex alleles, and gathered epidemiological data on these mutations from the general population of France. Login to comment
26 Materials and Methods Patients and Healthy Individuals Patients and healthy individuals known to the French CF Laboratory Network before 1st January 2009, who were heterozygous for the p.Asp443Tyr, p.Gly576Ala, p.Arg668Cys, and p.Gly149Arg mutations, either in isolation or in a complex allele, were included. Login to comment
31 Epidemiological Study in the French General Population The allelic prevalences of the p.Asp443Tyr, p.Gly576Ala, p.Arg668Cys, and p.Gly149Arg mutations, either in isolation or in a complex allele, were determined by allele counting in a sample of healthy adult individuals from the French general population. Login to comment
44 Specific substitutions observed either in isolation (p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys) or in different combinations in patients were introduced into the WT CFTR plasmid using the Gene tailor site-directed mutagenesis kit (Invitrogen) and the designed primers (available upon request), in accordance with the manufacturer`s protocol (Fig. 1). Login to comment
91 Results Phenotype of Patients Carrying p.Asp443Tyr, p.Gly576Ala, p.Arg668Cys, and/or p.Gly149Arg in Various Combinations A total of 153 patients and healthy individuals carrying at least one of the alleles p.Asp443Tyr, p.Gly576Ala, p.Arg668Cys, and/or p.Gly149Arg, either in isolation or in a complex allele, were identified (Table 1). Login to comment
95 Phenotype and Genotype Data of Patients Carrying At Least One of the CFTR Gene Mutations p.Gly549Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys Phenotype CFTR genotype No. Login to comment
100 P, PI 27 y 50 p.Arg668Cys c.1766+73T>G 1 CF? Login to comment
103 P NA 40-59 p.Arg668Cys NI 1 DB PI 78 y 41 c. Login to comment
104 [2002C>T;3718-2477C>T] (3849+10kbC>T) p.Glu92Asn 2 DB 60 y, 71 y NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 DB Pa infections 20 y 67 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.[Gly576Ala;Arg668Cys] 1 DB 17 y <40 p.[Gly576Ala;Arg668Cys] NI 1 DB 26 y 23-71 p.[Gly576Ala;Arg668Cys] p.Leu997Phe 1 DB Pa infections 72 y 34-60 p.[Gly576Ala;Arg668Cys] NI 1 DB Azoospermia NA NA p.Arg668Cys NI 1 DB 66 y 80-87 p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.262_263delTT (394delTT) 1 CSD ENT 19 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 CSD Bronchitis 48 y NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 CSD Sinusitis, bronchiolitis 72 y NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 CSD Nasal polyposis 18 y >60 c. Login to comment
105 [2002C>T;3718-2477C>T] p.Gln689X 2 CSD Nasal polyposis 14 y,16 y NA, 29 p.[Gly576Ala;Arg668Cys] NI 3 IP 35-39 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 IP Bronchitis 49 y NA p.[Gly576Ala;Arg668Cys] p.PheF508del 1 IP 42 y NA p.[Gly576Ala;Arg668Cys] p.Arg668Cys 1 IP NA NA p.[Gly576Ala;Arg668Cys] c.1210_34TG[12]T[5] 4 IP 19-69 y NA p.[Gly576Ala;Arg668Cys] NI 1 Cholestasis 60 y NA p.[Gly576Ala;Arg668Cys] c.1584G>A 33 CBAVD 27-50 y 9-82 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 2 CBAVD 30 y,36 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.2051_2052delAAinsG 1 CBAVD 34 y 72 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Trp1282X 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 CBAVD 35 y 65-66 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Ser549Asn 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.3605delA 1 CBAVD 30 y 41-69 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gln1411X 1 CBAVD 31 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg347His 3 CBAVD 29 y, 34 y, NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gly542X 1 CBAVD 35 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.946delT 1 CBAVD 26 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.4242_4242+1delGGinsT 1 CBAVD 41 y 31 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg117His 1 CBAVD 32 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr338Ile 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Glu379Lys 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Met1137Val 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr1246Ile 2 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 CBAVD 34 NA p.[Gly576Ala;Arg668Cys] p.Asn1303Lys 8 CBAVD 30-42 y NA p.[Gly576Ala;Arg668Cys] NI 1 CBAVD 27 y NA p.Arg668Cys p.Phe508del 1 CBAVD 30 y NA p.Arg668Cys NI 1 CUAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 CUAVD NA NA p.[Gly576Ala;Arg668Cys] NI 1 CUAVD Renal agenesis NA NA p.[Gly576Ala;Arg668Cys] NI 1 Hypofertility (not CBAVD) CF carrier`s partner NA NA p.[Gly576Ala;Arg668Cys] p.Asp1152His 1 FBA Mild CF considered possible, 2 older brothers with the same genotype, one with a very mild phenotype, the other being asymptomatic 22 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 FBA TOP for de novo chromosomal translocation; not CF 21 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg31Cys 1 FBA Not CF at birth 28 wg <30 p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Unknown outcome 23 wg NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Not CF at birth 21 wg <30 p.[Gly576Ala;Arg668Cys] p.Trp846X (Continued) Table 1. Login to comment
107 of patients Main diagnosis Additional information Age at diagnosis Sweat test (Cl-,mmol/L) Allele 1 Allele 2 1 FBA Fetal death 20 wg NA p.[Gly576Ala;Arg668Cys] p.Ser1235Arg 1 FBA Unknown outcome p.Arg668Cys p.Phe508del 1 FBA Not CF at birth 38 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 FBA Not CF at birth 28 wg NA p.[Gly576Ala;Arg668Cys] NI 1 Healthy CF patient`s mother NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 Healthy Newborn, elevated IRT but normal ST (not CF) Birth <30 p.[Gly576Ala;Arg668Cys] p.Phe508del 1 Healthy Mother of a CF fetus (p.[Phe508del]+ [phe508del]) NA NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 Healthy Mother of a fetus with FBA but not affected with CF NA NA p.[Gly576Ala;Arg668Cys] p.Phe508del 2 Healthy Mother of a fetus with FBA but not affected with CF NA NA p.[Gly576Ala;Arg668Cys] NI 1 Healthy CF patient`s mother 59 y NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 Healthy CF patient`s mother NA NA p.[Gly576Ala;Arg668Cys] p.[Ser912Leu;Asn1303Lys] 1 Healthy CF patient`s mother 32 y NA p.[Gly576Ala;Arg668Cys] p.Leu137Arg 1 Healthy CF carrier`s partner NA NA p.[Gly576Ala;Arg668Cys] c. Login to comment
108 [3705T>G;1210-13T[5]] 1 Healthy CF carrier`s partner NA NA p.[Ser519Gly;Gly576Ala;Arg668Cys] NI 2 Healthy CF carrier`s partner 37 y, NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 20 Healthy CF carrier`s partner 24-42 y NA p.[Gly576Ala;Arg668Cys] NI 1 Healthy CF carrier`s partner 32 y NA p.Gly576Ala NI 1 Healthy CF patient`s mother 37 y NA p.Arg668Cys p.Arg792X 1 Healthy CF relative (p.Gly745X) 22 y NA p.Arg668Cys NI 1 Healthy General population NA NA p.[Gly576Ala;Arg668Cys] NI CF, cystic fibrosis; CF?, suspicion of cystic fibrosis; CBAVD, congenital bilateral absence of vas deferens; CSD, chronic sinus disease; DB, disseminated bronchiectasis; ENT, ear, nose, and throat symptoms; FBA, fetal bowel anomaly; GI, gastrointestinal symptoms; IP, idiopathic pancreatitis; IRT, immunoreactive trypsinemia; m, months; NA, not available; NI, not identified; P, pulmonary symptoms; Pa: Pseudomonas aeruginosa; PI, pancreatic insufficiency; wg, weeks of gestation; ST, sweat test; TOP, termination of pregnancy; y, years. Login to comment
113 The most frequent phenotype associated with combinations of p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys was CBAVD. Login to comment
120 Of the 37 healthy individuals, seven had a severe CF mutation in trans; one carried the triple mutant p.[Asp443Tyr;Gly576Ala;Arg668Cys]; five carried the double mutant p.[Gly576Ala;Arg668Cys]; and one carried p.Arg668Cys in isolation. Login to comment
121 These observations in patients carrying varied combinations of p.Arg668Cys, p.Gly576Ala, p.Asp443Tyr in trans with a classical CF mutation argue against as considering them as CF defects, but as CFTR-RD-associated mutations. Login to comment
122 Epidemiological Data from the French General Population Of the 1,423 healthy individuals screened, 26 were heterozygous for p.[Gly576Ala;Arg668Cys] (allelic frequency 0.91%, 95% CI 0.60-1.33%); four for p.[Asp443Tyr;Gly576Ala;Arg668Cys] (allelic frequency 0.14%, 95% CI 0.04-0.36%); two for p.Arg668Cys; two for p.Gly576Ala (allelic frequency for each 0.07%, 95% CI 0.0080.25%); and one for p.[Ser519Gly;Gly576Ala;Arg668Cys] (allelic frequency 0.04%, 95% CI 0.0009-0.20%). Login to comment
125 Processing of CFTR Mutants To evaluate the contribution of each mutation to the phenotype, we first studied the maturation of CFTR in HeLa cells that had been transiently transfected with cDNA encoding the WT and mutated CFTR proteins p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys in different combinations. Login to comment
132 A: Western blot analysis of the CFTR expression: 1, WT; 2, p.Gly576Ala; 3, p.Arg668Cys; 4, p.[Gly576Arg;Arg668Cys]; 5, p.[Asp443Tyr;Gly576Ala;Arg668Cys]; 6, pTracer; 7, p.Asp443Tyr. Login to comment
140 The relative amount of fully glycosylated protein (band C) did not differ between p.Gly576Ala, p.Arg668Cys, or p.[Gly576Ala; Arg668Cys] and WT CFTR. Login to comment
146 As shown in Figure 3, p.Gly576Ala, p.Arg668Cys, p.Asp443Tyr, p.[Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys] were targeted to the plasma membrane (Figs. 3B-F). Login to comment
151 Functional Analysis of Chloride Channel Function in CFTR Mutants To determine the impact of p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys in single, double, or triple mutants on CFTR chloride channel function, we expressed full-length WT and mutant proteins in HeLa cells, and measured chloride channel activity using single-cell fluorescence imaging and the potential-sensitive probe DiSBAC2(3)(Molecular Probes). Login to comment
152 The CFTR Cl- channel conductance was detected at the plasma membrane in WT CFTR and mutants containing p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys, whereas no conductance was observed in cells transfected with either GFP negative control or p.Phe508del protein (Figs. 4A and 4B). Login to comment
155 In contrast, p.Gly576Ala and p.Arg668Cys mutants exhibited a slight but significant reduction of levels of CFTR conductance (P < 0.05) (Fig. 4B). Login to comment
160 Discussion In the present study, we investigated genotype-phenotype correlations and the in vitro consequences of CFTR mutations: four in isolation (i.e., p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys) and three complex alleles observed in patients or healthy individuals (i.e., p.[Gly576Ala;Arg668Cys], p.[Asp443Tyr;Gly576Ala;Arg668Cys], and the rarer p.[Gly149Arg; Gly576Ala;Arg668Cys]). Login to comment
165 A: Wild-type CFTR; B: p.Gly576Ala; C: p.Arg668Cys; D: p.Asp443Tyr; E: p.[Gly576Ala;Arg668Cys], F: p.[Asp443Tyr;Gly576Ala;Arg668Cys] are targeted at least to the plasma membrane. Login to comment
173 In contrast, genotypes combining mutants other than p.Gly149Arg, namely p.Arg668Cys, p.[Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys], in trans with a CF mutation, were not observed in patients with classical CF, although they were observed in patients with moderate phenotypes, in particular CBAVD. Login to comment
175 This observation is also consistent with the results of the functional studies, which demonstrated residual CFTR function, with p.Asp443Tyr having an effect on protein maturation, and p.Gly576Ala and p.Arg668Cys having an effect on Cl- channel activity. Login to comment
179 These results have substantial implications for diagnostic and genetic counseling, as they classify p.[Gly149Arg;Gly576Ala;Arg668Cys] or p.Gly149Arg (even if no CF patient was detected with only this mutation) as a CF-causing mutation, and p.Arg668Cys, p.[Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys] as CFTR-RD mutations. Login to comment
190 Statistical significance was set at *** P < 0.001; ** P < 0.01; * P < 0.05; ns, nonsignificant difference (P > 0.05).B-D:Histogramsreportthemeansoftherelativefluorescencecollectedfromseparateexperiments.B:HeLacellstransfectedwithWTCFTRas positive control, p.F508del or GFP as a negative controls, and CFTR mutants as p.Asp443Tyr, p.Gly576Ala, p.Arg668Cys. Login to comment

PMID: 22427236 [PubMed] Rosendahl J et al: "CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?"

No. Sentence Comment

140 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p¼0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts. Login to comment
135 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p&#bc;0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts. Login to comment

PMID: 21931512 [PubMed] Polizzi A et al: "Genotype-phenotype correlation in cystic fibrosis patients bearing [H939R;H949L] allele."

No. Sentence Comment

56 During our screening analysis we also found thirteen males affected by congenital bilateral absence of vas deferens (CBAVD) bearing the intron 8 (IVS-8) variants TG13-T5 and TG12-T5 in compound heterozygosity with associated CF-causing mutations, and 2 sisters (of 7 and 9 years old respectively) carrying the [R668C;G576A] complex allele in compound heterozygosity with F508del CF mutation, showing a borderline sweat chloride test, recurrent asthmatic bronchitis and pancreatic sufficiency. Login to comment
75 We also found in our CF population subjects carrying the variant tracts TG13-T5 and TG12-T5, which have been already described in males with CBAVD in the literature (Castellani et al., 2008; Dequeker et al., 2009), and the [R668C;G576A] complex allele. Login to comment
76 The R668C in exon 13 is considered a polymorphism (Pignatti et al., 1994) while the G576A, in CFTR exon 12, seems to induce a variable extent of exon skipping that leads to reduced levels of normal CFTR transcripts (Pagani et al., 2003). Login to comment

PMID: 18573697 [PubMed] Bustamante-Aragones A et al: "New strategy for the prenatal detection/exclusion of paternal cystic fibrosis mutations in maternal plasma."

No. Sentence Comment

45 In the three pregnancies, both parents were carriers of a different CF mutation in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene and, in addition, the paternal mutation was distinct in each case as follows: p.Arg668Cys (case 1) and p.Lys710ter (case 2), both located in exon 3 of the CFTR gene, and p.Tyr1092ter (case 3) located in exon 17b of the CFTR gene (Table 1). Login to comment
64 Table 1 Description of the parental mutations and their location in the CFTR gene for each case Case Maternal mutation Paternal mutation (PT) base change Location of PT in CFTR gene PCR primers SNaPshot primer 1 p.Phe508del p.Arg668Cys C⇒T Exon 13 Forward: 5'- TGATTCTTTCGACCAATTTAGTG-3' Reverse: 5'- ATCTGGTACTAAGGACAG-3' 5'-AATTCAATCCTAACTGAGACCTTACAC-3' 2 p.Val542ter p.Lys710ter A ⇒ T Exon 13 5'-TTCTCAATCCAATCAACTCTATACGA-3' 3 c.3849+ 10 kb CNT p.Tyr1092ter C ⇒ A Exon 17b Forward: 5'- GGAGTCCAATTTTCACTCATCTTGT-3' Reverse: 5'- CCTGTTGTTAAAATGGAAATGAAGG-3' 5'-ACATACTGCCAACTGGTTCTTGTA-3' Primer sequences used for amplification are also listed. Login to comment

PMID: 18687795 [PubMed] Audrezet MP et al: "Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene."

No. Sentence Comment

51 Sequences of the Primers Used for CFTR Analysis by HRM, GC Size, Amplicon Length, Number of Positive Controls Validated for Each Exon, and Positive Controls for Routine Analysis Exon Primer Sequences GC length Amplicon length (bp) Introns Number of heterozygous- positive controls Number of homozygous- positive controls Recommended control 1 LSCFE1Fmod 5Ј-CCGCCGCCGTTGAGCGGCAGGCACC-3Ј 8 200 bp 74 4 125GϾC LSCFE1Rmod 5Ј-CCGCCGCCGGCACGTGTCTTT CCGAAGCT-3Ј 8 19 M1I 2 2i5b 5Ј-CAAATCTGTATGGAGACC-3Ј 0 194 bp 39 5 R31C 2i3Љ 5Ј-CAACTAAACAATGTACATGAAC-3Ј 0 4 296ϩ1GϾT 3 LSCFe3Fmod LSCFe3Rmod 5Ј-CGCCGTTAAGGGAAATAGGACAA CTAAAATA-3Ј 5 276 bp 44 10 2 R75Q 5Ј-CCGCCGATTCACCAGATTTCGTAGTC-3Ј 6 66 G85V 4 LSCFe4FmodC 5Ј-CCGCCGCCGCCCGTGTTGAAATT CTCAGGGT-3Ј 12 361 bp 52 14 1 R117H LSCFe4RmodC 5Ј-CCGCCGCCCACATGTACGATAC AGAATATATGTGCC-3Ј 9 26 574delA 5 LSCFE5Fmod 5Ј-CCGCCGGTTGAAATTATCTAACTTTCC-3Ј 6 201 bp 13 8 624delT LSCFE5Rmod 5Ј-CCGAACTCCGCCTTTCCAGTTGT-3Ј 3 48 711ϩ1GϾT 6a LSCF6aFmod2 5Ј-CCGCCGGGGTGGAAGAT ACAATGACACCTG-3Ј 5 317 bp 25 8 C225X LSCF6aRmod2 5Ј-CCGCCGCCGCGATGCATAGAG CAGTCCTGGTT-3Ј 11 66 L206W 6b LSCFE6bFmod 5Ј-CGCGCCGCCGGATTTAC AGAGATCAGAGAG-3Ј 10 239 bp 0 2 1 R258G LSCFE6Brmod 5Ј-CCGCCGCCGAGGTGGA GTCTACCATGA-3Ј 8 66 1001ϩ11CϾT 7 LSCFE7Fmod2 5Ј-CCGCCGCCCTCTCCCTGAATTT TATTGTTATTGTTT-3Ј 13 326 bp 7 11 1078delT LSCFE7Rmod2 5Ј-CCCGCCGCCCTATAATGCAG CATTATGGT-3Ј 10 7 1248ϩ1GϾT 8 LSCFE8Fmod 5Ј-CCGGAATGCATTAATGCTAT TCTGATTC-3Ј 4 199 bp 32 7 W401X LSCFE8Rmod 5Ј-CCCGCAGTTAGGTGTTTAG AGCAAACAA-3Ј 4 18 1249-5AϾG 9 LSCFe9Fmod2 5Ј-CCGCCGCCGGGAATTATTTGAGAA AGCAAAACA-3Ј 8 279 bp 0 3 D443Y LSCFe9Rmod2 5Ј-CCGCCGCGAAAATACCTTCCAG CACTACAAACTAGAAA-3Ј 8 57 A455E 10 LSCF10FmodD 5Ј-CGCCGTTATGGGAGAACTGG AGCCTTCAGAG-3Ј 5 275 bp 0 15 1 F508del LSCF10RmodD 5Ј-CCGCAGACTAACCGATTGAAT ATGGAGCC-3Ј 4 68 E528E 11 h11i5 5Ј-TGCCTTTCAAATTCAGATTGAGC-3Ј 0 197 bp 42 13 2 G542X 11i3ter 5Ј-ACAGCAAATGCTTGCTAGACC-3Ј 0 17 G551D 12 LSCFE12Fmod 5Ј-CGCGTCATCTACACTAGATGACCAG-3Ј 4 244 bp 43 15 G576A 1898 ϩ 1GϾALSCFE12Rmod 5Ј-CCGGAGGTAAAATGCAATCTATGATG-3Ј 3 63 13 LSCF13AFmod 5Ј-CCGCCGCCGGAGACATATTG CAATAAAGTAT-3Ј 9 38 20 I601F LSCF13ARmod 5Ј-GCCTGTCCAGGAGACAGGA GCATCTC-3Ј 2 R668C LSCF13BFmod 5Ј-CCGCCGCAATCCTAACTGAG ACCTTACACCG-3Ј 2 R668C LSCF13BRmod 5Ј-CCGCCGATCAGGTTCAGGA CAGACTGC-3Ј 3 346 bp 2184insA LSCF13CFmod 5Ј-CCGCGGTGATCAGCACTGGCCC-3Ј 6 301 bp 77 L749L LSCF13CRmod 5Ј-CCGCGCGCGCGGCCAGTTTCTTG AGATAACCTTCT-3Ј 13 259 bp V754M LSCF13DFmod 5Ј-CGTGTCACTGGCCCCTCAGGC-3Ј 1 221 bp I807M LSCF13DRmof 5Ј-CCGCCGCCGCTAATCCTATGA TTTTAGTAAAT-3Ј 9 220 bp 2622ϩ1GϾA LSCf13FFmod 5Ј-CGCGGTGCAGAAAGAAGAAAT TCAATCCTAACTG-3Ј 4 R668C LSCF13FRmod 5Ј-CCGCCGTGCCATTCATTTGT AAGGGAGTCT-3Ј 6 2184insA 14a LSCF14aFmodB 5Ј-CCGACCACAATGGTGGCAT GAAACTG-3Ј 3 239 bp 35 7 1 T854T LSCF14aRmodB 5Ј-CCGCCGACTTTAAATCCAGTAAT ACTTTACAATAGAACA-3Ј 6 7 W846X 14b LSCF14bFmod 5Ј-CCGGAGGAATAGGTGAAGAT-3Ј 2 179 bp 38 4 2752-5GϾT LSCF14bRmodb 5Ј-CCGTACATACAAACATAGTGGATT-3Ј 3 59 2789ϩ5GϾT 15 LSCFE15Fmod 5Ј-CGCGCCGTGTATTGGAAA TTCAGTAAGTAACTTTGG-3Ј 7 412 bp 33 16 T908S LSCFE15Rmod 5Ј-CCGCAGCCAGCACTGCCAT TAGAAA-3Ј 4 68 S945L (table continues) phisms that we have chosen to exclude. Login to comment
171 Results of CFTR Analysis by HRM on 136 Samples of Patients with Idiopathic Chronic Pancreatitis (ICP) Exon Number of positive samples Mutations identified Variants identified New positive controls 1 14 14 125GϾC 2 1 1 R31C 3 9 1 G85E 7 R75Q 1 R74W 4 4 1 R117G 1 I148T R117G 1 R117H 1 A120T 5 1 1 L188P L188P 6a 5 1 V201M 1 A221A A221A 3 875ϩ40 AϾG 6b 27 1 M284T 26 1001ϩ11CϾT M284T 7 1 1 L320V L320V 8 0 0 9 1 1 D443Y 10 16 8 F508del 8 E528E 11 1 1 G542X 12 6 4 G576A 1 Y577Y L568F 1 L568F 13 7 1 S737F 4 R668C S737F 1 V754M L644L 1 L644L 14a 53 52 T854T T854TϩI853I 1 T854TϩI853I 14b 0 0 15 3 1 L967S T908S 1 T908S 1 S945L 16 0 0 17a 10 7 L997F 1 3271ϩ18CϾT 3271 ϩ 3AϾG 1 3271 ϩ 3 AϾG 1 Y1014C 17b 3 1 L1096L L1096L 1 H1054DϩG1069R 1 3272-33AϾG H1054DϩG1069R 3272-33AϾG 18 2 1 D1152H E1124del 1 E1124del 19 5 5 S1235R poly 20 7 1 W1282X 5 P1290P 1 D1270N 21 2 1 N1303K 1 T1299T 22 0 0 23 1 0 4374ϩ13 AϾG 24 43 40 Q1463Q 2 Y1424Y 1 Q1463QϩY1024Y ing domain of a gene brings an excellent sensitivity for heterozygote detection that is very close to 100%. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment

PMID: 15858154 [PubMed] Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."

No. Sentence Comment

102 Novel Variants Detected in 257 Hispanic Patients Patient Novel variant 1 Other variants Age and symptoms 1 1429del7bp G542X Newborn with intestinal blockage 2 S573C None 9 years old, pancreatitis, limited clinical history 3 Y913X deltaF508/I1027T 1 month old, vomiting, weight loss, diarrhea 4 E588V deltaF508/R1438W Identified one time in a family, family studies revealed deltaF508 and R1438W are in cis 5 E588V G542X Newborn with pneumonia and sweat chloride of 59 mmol/L 6 P439S R668C 10 years old with mild CF symptoms; another patient with CBAVD has P439S/R334W 7 T604S deltaF508 1 month old 8 874insTACA deltaF508 Newborn with meconium ileus and IUGR 9 2585delT deltaF508/I1027T 13 years old with CF 10 1811 ϩ 1 G to A None 44 years old with positive sweat chloride; also seen in 5-year-old CF patient with 3821delT mutation 11 I285F None 1 year old with chronic respiratory problems, also carries a silent mutation at A455 12 P1372L None 1 month old, rule out CF 13 3271 ϩ 8 A to G None 16 years old, borderline sweat test 14 1341 ϩ 80 G to A None Recurrent sinusitis 15 1525 - 42 G to A None Two patients, one 9 years old with FTT, and one 18 months old with chronic lung disease, pulmonary hypotension, hypoxia CBAVD, congenital bilateral absence of the vas deference; IUGR, intrauterine growth retardation. Login to comment
103 Table 1. Continued Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) R1070W 1 0.55 0.19 R1158X 1 0.55 0.19 R1438W 1 0.55 0.19 R334W 2 1.09 0.39 R352W 1 0.55 0.19 R553X 2 1.09 0.39 R668C 2 1.09 0.39 R74W 3 1.64 0.58 R75X 3 1.64 0.58 S1235R 2 1.09 0.39 S492F 2 1.09 0.39 S549N 1 0.55 0.19 S573CS573C 1 0.55 0.19 S945L 1 0.55 0.19 T351S 1 0.55 0.19 T501A 2 1.09 0.39 T604ST604S 1 0.55 0.19 V11I 1 0.55 0.19 V201 mol/L 1 0.55 0.19 V232D 2 1.09 0.39 V754 mol/L 1 0.55 0.19 W1089X 2 1.09 0.39 W1098C 1 0.55 0.19 W1204X 4 2.19 0.78 Y563N 1 0.55 0.19 Y913XY913X 1 0.55 0.19 85 different mutations 183 100.00 35.60 Novel variants are in boldface, mutations on the ACMG/ACOG panel are italicized. Login to comment
119 The other mutation in this child is R668C in exon 13. Login to comment
165 Due to ascertainment bias, six mutations not included in the recommended panel occurred with a relative frequency greater than 1%: E60X, G576A, I1027T, P67L, R668C, and S1235R. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment

PMID: 15463919 [PubMed] Amaral MD et al: "Quantitative methods for the analysis of CFTR transcripts/splicing variants."

No. Sentence Comment

74 Example: E822X Nasal epithelial cells are collected as described [6] from individuals with mutation E822X (G>T at 2596), non-CF controls and heterozygotes for the polymorphism R668C, and mRNA extracted. Login to comment

PMID: 12127423 [PubMed] Girodon E et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene defects in patients with primary sclerosing cholangitis."

No. Sentence Comment

78 Four additional subjects (3.5%) carried one of the following mild defects: R117H, R347H, R74W-D1270N and R668C-G576A. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

113 Eleven mutations were reported as ''complex alleles,`` particularly in chromosomes carrying the 5T allele, although several changes (G576A, R668C, A1067T) are considered as neutral polymorphisms (CFGAC). Login to comment

PMID: 10649490 [PubMed] Girodon-Boulandet E et al: "Screening practices for mutations in the CFTR gene ABCC7."

No. Sentence Comment

74 However, it still fails to cover several mutations frequent in certain geographical areas, such as 394delTT, 405+1G>A, 2143delT, 1677delTA, Y1092X, R1066C, 3272- 26A>G and 1811+1.6kbA>G, and other mutations frequent in CBAVD patients, such as IVS8-5T, D443Y, R668C and D1152H. Login to comment

PMID: 10445602 [PubMed] Puechal X et al: "Increased frequency of cystic fibrosis deltaF508 mutation in bronchiectasis associated with rheumatoid arthritis."

No. Sentence Comment

83 mmol.L-1 mV gene mutation 1 F 67 51 Yes II II 0401/1401 51 20 P. aeruginosa 48 -24 DF508/- 2{ F 52 29 Yes IV IV 0406/0416 35 50 P. aeruginosa ND -31 DF508/- 3 F 35 16 II II 0311/1302 4 82 H. influenzae 18 -21 DF508/- 4 F 52 42 II II 03011/1001 4 79 ND 55 -21.0 DF508/- 5 F 56 48 II III 0101/0401 12 90 Normal flora 40 -15.3 R668C/- 6 F 59 49 III III 0401/0405 4 14 P. aeruginosa 57 ND S1235R/- 7 F 55 53 II I 0101/1001 2 92 Normal flora 42 -17.3 -/- 8 F 55 46 III III 0101/1302 3 83 Normal flora 60 -18.7 -/- 9{ F 66 20 III IV 0101/0401 4 78 P. mirabilis 35 -15.8 -/- 10 M 71 61 II III 0701/1001 67 60 Normal flora 34 -19.2 V562I/- 11 M 59 34 II III 0101/0408 53 94 H. influenzae 62 -20.8 -/- 12 F 56 30 Yes III III 0101/0311 10 89 Normal flora 53 -11.1 -/- 13 F 46 43 Yes II III 0101/0405 9 73 H. influenzae 29 -21.3 -/- 14 F 47 41 II III 03011/0401 9 80 Normal flora 86 -16.5 -/- 15 F 54 44 II II 0401/0401 1 67 Normal flora 50 -13 -/- 16 F 59 37 III III 0101/0401 3 53 H. influenzae 70 -16.8 -/- 17 F 49 47 I I 03011/1401 10 58 H. parainfluenzae 79 -18.5 -/- 18{ F 65 37 Yes III III 03011/1501 56 43 Normal flora 35 -33.8 -/- 19 F 65 54 Yes II III 0101/1101 10 91 ND 64 -9.6 -/- 20 F 70 55 III III 0101/0401 4 80 Normal flora 38 -13.5 -/- 21 F 69 53 IV IV 0101/1501 4 35 P. aeruginosa 35 ND -/- 22 M 66 63 II II 0401/1104 63 97 Normal flora 36 -20.2 -/- 23 F 61 56 I I 03011/0701 4 76 Flavobacterium spp. Login to comment
119 In the RA+DB group three other mutations were found (R668C in patient 5, S1235R in patient 6 and V5621 in patient 10). Login to comment
164 Although the V562I and S1235R mutations have been described in CF patients, the putative detrimental effect of these mutations is disputable. Login to comment
165 The R668C mutation was first described as a DNA polymorphism [28]. Login to comment
118 In the RA+DB group three other mutations were found (R668C in patient 5, S1235R in patient 6 and V5621 in patient 10). Login to comment

PMID: 10571949 [PubMed] Lazaro C et al: "Missense mutations in the cystic fibrosis gene in adult patients with asthma."

No. Sentence Comment

61 Missense mutations R75Q, G576A, and L997F were analyzed in the extended sample of individuals from the general population by conventional restriction analysis; mutation R668C was analyzed by SSCA. Login to comment
73 Among the six subjects with two CFTR mutations (Table 1), three presented mutations R668C and G576A. Login to comment
75 However, some studies have detected that mutations R668C and G576A are associated on the same chromosome [Dörk et al., 1997] and it is likely that they correspond to the same CFTR allele. Login to comment
77 Overall, four of the 15 missense mutations (R75Q, G576A, R668C, and L997F) were detected in 57% of the 21 asthma patients. Login to comment
79 With the exception of mutation L997F (2.1% in asthma patients), which was not found in control group 2, the other three mutations were found in these samples with the following frequencies: R75Q (1.6% general population individuals vs. 2.8% asthma patients); G576A (2.7% general population individuals vs. 2.1% asthma patients) and R668C (4.3% general population individuals vs. 3.5% asthma patients). Login to comment
84 Characteristics of Asthmatic Patients With CFTR Mutations CFTR Age IgE Skin Patients genotype1 M470V2 PolyT3 Sex Years BHR4 IU/ml5 test6 SB221 R74W,V8551 M/V 7/7 M 67 - 329 + SB36 R75Q / - M/V 7/7 F 61 + 59 + SB47 R75Q / - M/V 7/9 M 67 NA 42 NA SB131 R75Q / - M/V 7/7 F 69 + 41 - SB296 R75Q / - M/V 7/9 F 45 + 96 - SB251 I148T / - M/V 7/9 F 70 - 25 - SB212 A534Q / - M/M 7/7 F 46 + 69 + SB125 R668C,G576A N/V 7/7 M 62 + 21 - SB154 R668C,G576A M/V 7/7 M 65 + 93 + SB231 R668C,G576A M/V 7/7 F 45 + 158 + SB112 R668C / - M/V 7/7 M 64 + 1350 + SB304 R668C,T582R M/V 7/7 F 78 - 7 - SB56 T896I / - M/V 7/7 M 72 + 77 - SB117 L997F / - V/V 7/9 F 81 NA 6 NA SB143 L997F/L997F V/V 7/7 F 39 NA 129 NA SB173 L997F / - M/V 7/9 F 67 + 127 - SB148 M1028R / - M/V 7/7 F 48 + 23 - SB32 R1066C / - M/V 7/7 F 69 - 9 - SB69 T1142I / - M/M 7/9 M 65 - 158 + SB92 R116L / - M/V 7/7 M 78 NA 64 NA SB53 T1220I / - M/M 7/9 F 60 + 62 + SB40 ∆F508 / - M/M 79 F 62 + 34 + SB9 - / - M/M 5/9 F 61 - 169 - SB20 - / - M/V 5/5 F 57 - 245 + SB116 - / - V/V 5/7 F 33 NA 41 NA SB118 - / - M/V 5/9 M 83 + 63 - SB140 - / - V/V 5/7 F 72 NA 35 NA SB142 - / - M/V 5/7 F 59 + 108 + SB201 - / - M/V 5/7 M 27 - 297 + SB205 - / - M/V 5/7 F 56 - 20 - SB284 - / - M/V 5/7 F 71 - 40 NA SB316 - / - M/V 5/7 F 78 NA 20 - 1 The CFTR genotype was studied by DGGE/SSCP analysis of all CFTR exons and intronic flanking sequences. Login to comment
93 Characteristics of 15 Amino Acid Variants/Mutants in the CFTR Gene Detected in 21 Patients With Asthma Other Evolutive Conservative Other mutations Mutation1 Reference2 Exon Domain3 Patients4 phenotypes5 conservation6 change7 at same position R74W Claustres et al., 1993 3 IC1 1 CF-PS/CBAVD b, m, r, s NC - R75Q Zielenski et al., 1991 3 IC2 4 CF-PS/DB/CBAVD/ b, d, m, r, s, x NC R75X (CF) CF Parents R75L (CBAVD) I148T Bozon et al., 1994 4 IC2 1 CF-PS b, d, m, r, s, x NC I148N (CF) A534Q This report 11 NBF1 1 - b, m NC A534E (CF) G576A Fanen et al., 1992 12 NBF1 3 CF-PS/CBAVD b, m, r, s NC G576X (CF) T582R Casals et al., 1997 12 NBF1 1 CF-PS b, d, m, r, s, x NC T582I (CF) R668C Fanen et al., 1992 13 R 5 DB/CF-PS/CBAVD/ b, d, m, r, s, x NC - CF Parents V855I This report 14a IC6 1 - b, r, s C - T896I This report 15 EC4 1 - b, d, m, r, s NC - L997F Fanen et al., 1992 17a TM9 3 DB/CF-PS/CBAVD/ b, d, m, r, s, x C - non-CF M1028R This report 17a TM10 1 - d NC M1028I (CF) T2066C Fanen et al., 1992 17b IC8 1 DB/CF-PI b, d, m, r, s, x NC R1066S (CF) R1066L (CF) R1066H (CF/CBAVD) T1142I This report 18 TM12 1 - b, d, m, r, s, x NC - R1162L Fanen et al., 1992 19 IC9 1 non-CF b, d, m, r, s, x NC R1162X (CF) T1220I Ghanem et al., 1994 19 NBF2 1 DB/non-CF b, d NC - 1 Mutation name according to the Cystic Fibrosis Genetic Analysis Consortium. Login to comment

PMID: 9272157 [PubMed] Dork T et al: "Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens."

No. Sentence Comment

91 R. Knowles, Q1352H by T. Nukiwa and K. Seyama are indicated g Missense substitutions R933S and R75Q occurred together in a ∆F508 heterozygous patient h Q1352H is associated with 5T and R297W, respectively i Missense substiutions G576A and R668C are linked on the same allele in both CBAVD patients sence of the vas deferens (CUAVD) and one heterozygote with CBAVD. Login to comment
113 The membrane topology of the CFTR protein was adapted from the original report and has been confirmed in vitro by glycosylation site mutagenesis (Riordan et al. 1989; Chang et al. 1994) double mutant allele G576A and R668C, have previously been reported to be benign but no other mutation could be detected on these alleles in our patients after scanning the whole coding region, except for one case where the R75Q and R933S mutations were found together in a ∆F508 heterozygote. Login to comment
130 The missense substitutions G576A and R668C occurred in cis on the same allele in two of our CBAVD males and in three further patients with very mild CF (data not shown); it is thus difficult to decide whether one or both of these changes are required to predispose towards mild disease (Anguiano et al. 1992; Fanen et al. 1992; Chillón et al. 1995). Login to comment
134 The Q1352H mutation may be insufficient to cause CBAVD but the additional occurrence of one "5T" 370 Variant Allele frequency n (% of chromosomes) Random donors Non-CF CBAVD CF 125G→C 15/178 (8.5%) n.d. 2/212 (0.9%) 1/1000 (0.1%)a R75Q 4/188 (2.2%) 3/130 (2.1%) 2/212 (0.9%)b 1/1000 (0.1%) 5T 9/186 (4.8%) 2/65 (2.9%) 26/212 (12.3%)c 3/1000 (0.3%) F508C 0/188 n.d. 3/212 (1.4%) 2/1000 (0.2%)d 1716G→A 5/188 (2.6%) 3/212 (1.5%) 3/212 (1.4%) 2/1000 (0.2%)e G576A-R668C 0/188 n.d. 2/212 (0.9%)f 3/1000 (0.3%)f Table 2 Frequency distribution of CFTR variants in different subgroups of individuals. Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment
188 The two linked missense substitutions G576A and R668C, for example, have previously been classified as polymorphisms on normal chromosomes (Fanen et al. 1992), as polymorphisms on CBAVD alleles (Osborne et al. 1993; Culard et al. 1994) or as separate disease-causing mutations in CBAVD (Anguiano et al. 1992; Chillón et al. 1995; Mercier et al. 1995). Login to comment

PMID: 7475569 [PubMed] Dork T et al: "Severity of disease in cystic fibrosis."

No. Sentence Comment

47 "We found that two of our patients carry an additional sequence substitution, R668C in exon 13 of the CFTR gene, in association with 3849+10 kb C->T on the same allele. Login to comment
48 Since missense mutation R668C also occurs in CBAVD patients,` it may lead to more severe disease in 3849+10 kb C-7 T patients with the double mutant allele, through further impairment of residual CFTR function resulting from normally spliced transcript. Login to comment

PMID: 7739684 [PubMed] Chillon M et al: "Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens."

No. Sentence Comment

74 OF PATIENTS POLYT GENOTYPE† #2c;F508/R668C ⌬F508/D1152H ⌬F508/D1270N ⌬F508/R75L ⌬F508/R117H ⌬F508/L206W ⌬F508/R258G ⌬F508/S1235R ⌬;F508/R347H ⌬F508/R347H R117H/G1349D R117H/712-1G→T G149R/R668C R347H/R1066H R553X/R668C R1070W/2869insG ⌬F508/- G542X/- W1282X/- R334W/- K1060T/- R1162X/- N1303K/- A800G/- ⌬F508/- ⌬F508/- ⌬F508/- ⌬E115/- R117H/- R347H/- G542X/- R553X/- 1677delTA/- 2184delA/- 2789ϩ5G→Α/- S1235R/- W1282X/- -/- -/- -/- -/- 2 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 22 4 3 1 1 1 1 1 7 1 1 1 1 2 1 1 1 1 1 1 1 3 3 1 19 9T/7T 9T/7T 9T/7T 9T/7T 9T/7T 9T/9T 9T/7T 9T/7T 9T/7T 9T/9T 7T/7T 7T/9T 9T/7T 9T/7T 7T/7T 7T/7T 9T/5T 9T/5T 7T/5T 7T/5T 7T/5T 7T/5T 9T/5T 5T/5T 9T/7T 9T/9T 7T/7T 7T/7T 7T/7T 9T/7T 9T/7T 7T/7T 7T/7T 7T/7T 7T/7T 7T/9T 7T/7T 9T/5T 7T/5T 5T/5T 7T/7T -/- 3 7T/9T *Data were obtained from the Spanish population analyzed in this study. Login to comment

PMID: 7543317 [PubMed] Pignatti PF et al: "Increased incidence of cystic fibrosis gene mutations in adults with disseminated bronchiectasis."

No. Sentence Comment

5 Moreover, three rare CFTR gene DNA polymorphisms (G576A, R668C, and 2736 A-*G), not deemed to be the cause of CF, were found in two patients, one of which was a compound heterozygote with R1066C. Login to comment
53 Clinical data and CFTR genotypes of patients with bronchiectasis CFTR genotype sex (yr) age age of onset smoke FEV1 FVC sweat mM 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 A F508/U U/U R1066C/2736A->G R75Q/U MI137V/U U/U U/U U/U U/U 3667 ins 4/U U/U U/U G576A-R668C/L997F U/U U/U U/U F F F M F F M M M F M F F M M F 52 70 23 79 55 52 57 42 43 52 21 66 38 59 49 70 3 56 20 50 18 16 16 8 2 6 5 8 20 8 10 42 no no no yes no no no no no no no no ex ex no no 40 80 85 n.d. 54 49 n.d. 59 83 40 91 62 105 36 49 55 45 88 83 n.d. 54 59 n.d. 59 93 47 105 77 99 46 64 64 40 19 6 70 45 28 n.d. 54 n.d. neg 30 neg 58 neg 20 28 # = patient number; FEV1 = forced expiratory volume in I second (% of predicted value); FVC = forced vital capacity (% of predicted value); sweat = sweat test (sodium concentration); U = unknown mutation or no mutation; ex = ex smoker; neg = negative test, no value recorded (cut off value = 80 mM Na); n.d. = not done. Login to comment
62 Polymorphisms G576A (1859G->C) and R668C (2134C->T) have been detected in patient #13. Login to comment
63 G576A and R668C are syntenic, as determined by segregation analysis in her two children. Login to comment
64 G576A and R668C were first described as DNA polymorphisms in CF chromosomes (20). Login to comment
66 R668C was detected also in a 76-year-old male with emphysema. Login to comment

PMID: 7529962 [PubMed] Mercier B et al: "Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients."

No. Sentence Comment

65 In addition, we identified the following missense mutations: four R668C, one A800G, one (G628R + S1235R, borne on the same chromosome), one (R74W + D1270N, borne on the same chromosome), six R117H, one F1052V, one R117C, one S1235R, one G149R, one R258G, two R347H, one R1066H, one R75L, and one E193K. Login to comment
77 of Patients Genotypea 1 AF508 + (G628R + S1235R) 1 AF508 + (R74W + D1270N) 2 AF508 + R668C 4 AF508 + R117H 1 AF508 + R258G 1 AF508 + R75L 1 E193K + N1303K 1 R347H + R1066H 1 R117C + W1282X 1 R553X + R668C 1 G149R + R668C 1 R117H+R117H 18 AF508/unidentified 4 W1282X/unidentified 1 G542X/unidentified 1 N1303K/unidentified 1 S1235R/unidentified 1 R347H/unidentified 1 A800G/unidentified 1 F1052V/unidentified 23 unidentified/unidentified a In parentheses are the two mutations located on the same haplotype. Login to comment

PMID: 8825494 [PubMed] Zielenski J et al: "Cystic fibrosis: genotypic and phenotypic variations."

No. Sentence Comment

593 Not surprisingly, Rl17H is associated with CF only when the allele also contains Table 2 Examples of complex alleles in the CfTR gene Principal Second site mutationa Location alteration Location Reference R75X exon 3 125G --.. C promoter 57 405 + IG --.. A intron 3 3030G --.. A exon 15 57 R1l7H exon 4 129G --.. C promoter 203 RI17H exon 4 IVS8 : 5T or 7T intron 8 101 R297Q exon 7 IVS8 : 5T or 7T intron 8 60 aF508 exon 10 R553Q exon II 59 aF508 exon 10 1I027T exon I7a 57 8F508 exon 10 deletion of D7S8 500 kb 3' of 186 CfTR S549N exon II R75Q exon 3 205a L619S exon 13 1716G � A exon 10 57 G628R (G � C) exon 13 SI235R exon 19 47 2184insA exon 13 IVS:5T exon 9 J Zielenski, J Bal, 0 Markiewicz, L-C Tsui, unpublished data A800G exon 13 IVS8 : 5T or 7T intran 8 31 S912L exon 15 GI244V exon 20 149 GlO69R exon 17b L88X exon 3 149 3732deiA exon 19 Kl200E exon 19 70 3849 + IOkbC � intron 19 R668C exon 13 57 T SI251N exon 20 F508C exon 10 94 The status of principal mutation may not be clear in every case; e.g. G628R(G --> C) vs S1235R. Login to comment

PMID: 7525450 [PubMed] Dork T et al: "Detection of more than 50 different CFTR mutations in a large group of German cystic fibrosis patients."

No. Sentence Comment

120 There are, however, only six additional CFTR mutations with a frequency of approximately 1% or more of the CF chromosomes; two nonsense mutations, G542X and R553X, and the missense mutations G551D and NI303K were predominantly seen in severely affected patients, whereas the transmembrane missense mutation R347P and the splice mutation 3849 + 10 kB C---~T Table 2 Rare sequence variants in the CFTR promoter and coding region Sequence variant Nucleotide change Location Frequency Associated mutatiow' Reference 125 G--+C G--~C at 125 Promoter 1 (0.1%) R75X F508C T--~G at 1655 Exon 10 2 (0.3%) S1251N 1716 G---)A G---~Aat 1716 Exon 10 1 (0.1%) L619S R553Q G-~A at 1790 Exon I 1 I (0.1%) * R668C C--~T at 2134 Exon 13 1 (0.1%) 3849+10 kB C--eT 3030 G---~A G--+A at 3030 Exon 15 1 (0.1%) 405+1 G--~A I1027 T T--~C at 3212 Exon 17a 2 (0.3%) * 3417 A-+T A--->Tat 3417 Exon 17b 1 (0.1%) Unknown 4002 A--eG A--~G at 4002 Exon 20 2 (0.3%) Unknown Cutting et al. (1992) Kobayashi et al. (1990) Kerem et al. (1990) D6rk et al. ( 1991) Fanen et al. (1992) Chillon et al. (1992) Fanen et al. (1992) This study Ferec et al. (1992) ~'Marked (*) sequence variations were present on AF508 chromosomes were the most frequent in pancreas-sufficient patients. Login to comment

PMID: 7505689 [PubMed] Cheadle JP et al: "Direct sequencing of the complete CFTR gene: the molecular characterisation of 99.5% of CF chromosomes in Wales."

No. Sentence Comment

112 Interestingly no missense mutations were identified in the R-domain, however we found the non-conservative substitution R668C (in exon 13) on a normal chromosome, implicating that it is benign, as reported by Fanen et al. (17). Login to comment

PMID: 23503723 [PubMed] Zhou L et al: "Symmetric snapback primers for scanning and genotyping of the cystic fibrosis transmembrane conductance regulator gene."

No. Sentence Comment

126 d One sample had 2 rare variants (R668C and S686Y) that required sequencing but were in the same amplicon. Login to comment
134 For example, by directing snapback primers to genotype an additional 2 synonymous variants (p.Y1424Y and p.T966T) and a syntenic pair of variants (p.G576A and p.R668C) that constitute a complex allele (26, 27), the sequencing required for the patients we have analyzed could be reduced by an additional factor of 2 (see Table 5 in the online Data Supplement). Login to comment

PMID: 23891399 [PubMed] Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."

No. Sentence Comment

44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
71 This was expected, as the CFTR mutations tested include known or putative CF-causing mutations, as well as CFTR mutations associated with varying clinical consequences (e.g., R668C, F1052V, D1152H) or complex CFTR alleles that may modify disease severity (e.g., S1235R) (www.CFTR2.org) [8,16]. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment
116 Other examples of complex CFTR alleles include the number of TG repeats in intron 8 along with the 5T CFTR mutation (e.g., TG11-5T, TG12-5T, TG13-5T), R668C-G576A-D443Y, and R74W-D1270N [8,16]. Login to comment

PMID: 23974870 [PubMed] Sosnay PR et al: "Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene."

No. Sentence Comment

137 In addition to these ten variants, c.1210-12(7) (legacy name 7T) had already been reported to be non-penetrant48 and was identified as a second variant in numerous fathers, and a twelfth variant, p.Ile1027Thr, was deemed 159 variants ࣙ0.01% frequency in CFTR2 127 variants meet clinical and functional criteria Clinical and functional analysis 13 variants meet neither criteria 14 variants 5 variants 7 variants 6 variants Evidence of non-penetrance No evidence of non-penetrance 19 variants meet clinical or functional criteria 127 variants are CF causing 12 variants are non CF causing 20 variants are indeterminate p.Arg117HisߤC p.Arg75Gln p.Gly576Alaߤ p.Arg668Cys ߤ p.Met470Val C p.IIe1027Thr ߤC p.Val754Met ߤC p.IIe148Thr ߤC p.Arg31Cys C p.Ser1235Arg ߤ p.Leu997Phe ߤ p.Arg1162Leu p.Leu227Arg F p.Gln525* F p.Leu558SerC p.Asp614Gly C c.2657+2_2657+3insA C c.1418delG F c.1210-12(7) ߤ p.Arg1070Gln C p.Asp1270Asn ߤC p.[Gln359Lys; Thr360Lys] p.Gly1069Argߤ p.Asp1152His p.Phe1052Val c.1210-12(5) p.Arg74Trpߤ p.IIe1234Val ߤC p.Arg1070Trp ߤF p.Ser977Phe F p.Asp579Gly C p.Tyr569Asp F Penetrance analysis Figure 4ߒ Assignment of disease liability to the 159 most frequent CFTR variants using three criteria. Login to comment
174 bIn both the 1000 Genomes Project and in this study, this variant is always seen in cis with p.Arg668Cys. Login to comment

PMID: 24586523 [PubMed] Zietkiewicz E et al: "CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients."

No. Sentence Comment

53 Another substitution, G576A (SVM +1.73), was found in three patients, in cis with a deleterious R668C allele (SVM -1.61); the latter was also present without G576A, in two patients (in one with c.1585-1G.A in trans). Login to comment
54 In the UMD-CFTR database (www.umd.be/CFTR), G576A and R668C have been reported in cis; in the CFTR2 database both mutations are described as having ''varying consequences``. Login to comment
55 Three of our patients carrying R668C were PI, and two appeared PS; PS/PI status was independent on the presence of G576A. Login to comment
56 We considered R668C a pathogenic mutation, and G576A - an associated element of a compound allele. Login to comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L). Login to comment
86 The most frequent non-IL alleles identified in this study (i.e. c.2052_2053insA; c.3468+2_3468+3insT; IVS9 T5_TG12-13; R668C; G314R) should be included in the PL population screening panel. Login to comment
101 The more recent estimates provide much lower values, ranging from 1:5000 [14], 1:6000 cited in WHO 2002 report [15] to 1:7500 for Southeastern Poland estimated for a 1-year period of Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 15 17 L967S 0.27 c.2900T.C 3032T.C 1 CFMDB; rs1800110 unknown 18 21 D1152H 0.50 c.3454G.C 3586G.C 1 CFMDB; rs75541969 F508del Sequence changes considered as lacking pathogenic effect 4 4 I148T 2.04 c.443T.U 575T.U 4 IL19e unknown 13 14 I752V 0.35 c.2254A.G 2386A.G 1 Novelf F508 15 17 S912L 2.12 c.2735C.T 2867C.T 1 CFMDBg ; rs121909034 F508 Legend: a IL19 i 17 - mutations included in the INNOLiPA tests (see below); CFMDB - non-INNOLiPA mutations present in the CTFR mutation database; novel - mutations first reported in this study; b in three chromosomes R668C with G576A in trans; c F508del, c.1585-1G.A, G542X, N1303K or c.579+3A.G; d F508del, G542X, R553X or N1303K; e not pathogenic if not in cis with c.3067-72del6 (l.n.3199del6); f not pathogenic - see explanation the text; g not pathogenic if not in cis with G1244V. Login to comment
137 Mutations a Poland Czechs Slovakia c Germany Lithuania W. Ukraine E. Hungary Romania c Bulgaria Serbia Greece Number of chromosomes 1476 1200 856 700 98 264 80 256 208 352 874 F508del 54.54 b 67.42 d 66.80 d 72.00 d 52.0 54.17 70.00 56.3 65.38 d 72.28 d 53.40 exon2,3del21kb (l.n.CFTRdele2,3_21kb) 4.47 5.75 2.26 1.2 f 2.0 4.17 5.00 1.6 NA 0 e 0.34 e c.3717+12191C.T (l.n.3849+10kbC.T) 3.93 1.67 e 4.28 1.00 e NA 0.76 0 0.4 e 1.44 0 e 0.11 e c.2012delT (l.n.2143delT) 1.83 0.92 1.10 0.71 0 1.14 0 0 e 0 0 e 0 e c.1585-1G.A (l.n.1717-1G.A) 1.83 0.33 e NA 0.86 0 0.38 1.25 0.4 0 0 e 0 e G542X 1.69 2.00 4.06 d 1.43 0 2.65 3.75 3.9 3.37 2.57 3.90 d R347P 1.57 0.92 1.10 1.57 0 0 1.25 NA 1.44 0 e 0.11 e N1303K 1.22 2.42 2.03 2.29 2.0 4.92 d 5.00 0.8 6.73 d 0 2.63 c.2052-2053insA (l.n.2184insA) 1.02 0.42 1.58 0.57 0 7.20 d 5.00 d 0 0.48 0.28 0 e R553X 0.95 0.50 0.90 2.29 4.2 d 0.38 0 NA 0 0 0 c.3468+223insT (l.n.3600+2insT) 0.75 0.25 NA 0 e 0 NA 0 NA 0 0 0 e c.2051-2052AA.G (l.n.2183AA.G) 0.68 0.08 NA 0.57 0 0.38 0 0.8 0 0 1.38 W1282X 0.61 0.58 0.50 0.71 1.0 2.27 0 2.3 d 0.96 0 0.67 c.3140-26A.G (l.n.3272-26A.G) 0.61 0.67 0.50 0.86 0 0.76 0 0.4 0 0 0.81 l.n.IVS8 T 5 _TG 12-13 0.54 NA NA NA 0 NA NA NA NA 0 NA R334W 0.41 0.25 NA 0.29 0 0.76 0 0.4 0 0.28 0.81 c.1766+1G.A (l.n.1898+1G.A) 0.41 1.42 d 0.50 0 0 1.14 0 NA 0 0 0.11 c.489+1G.T (l.n.621+1G.T) 0.34 0.42 NA 0.14 0 0.76 0 0.8 0 2.86 d 5.72 d R117H 0.34 NA NA 0.29 0 0 0 0.4 0 0 0.23 G551D 0.34 2.91 d 0.50 1.00 0 0 0 0 0 0 0.34 G314R 0.37 0 NA 0 0 0 0 NA 0 0 0 R668C 0.34 0 NA 0 0 0 0 NA 0 0 0 c.3528delC (l.n.3659delC) 0.27 0.17 NA 0.57 0 0 0 NA 0 0 0 c.164+1G.A (l.n.296+1G.A) 0.20 0.08 NA 0 0 0 0 NA 0 0 0 R851X 0.20 0.08 NA 0 0 0 0 NA 0 0 0 I336K 0.14 0.58 NA 0.45 0 0 0 NA 0 0 0 R1158X 0.14 0.08 NA 0 0 0 0 NA 0 0 1.03 E92K 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 R153I 0.14 0 NA 0 0 0 0 NA 0 0 0 c.579+3A.G (l.n.711+3A.G) 0.14 0.17 NA 0 0 0 0 NA 0 0 0.69 c.2589-2599del11bp (l.n.2721- 31del11bp) 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 I507del 0.14 0.08 NA 0.15 0 0 0 0 0 0.28 0.69 R117C 0.14 0.08 NA 0.15 0 0 0 NA 0 0 0.23 of mutation panels [20]), listed in Table 4, were compared to those reported for several Central and Southeastern European countries [21-29]. Login to comment

PMID: 24631642 [PubMed] Fanen P et al: "Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies."

No. Sentence Comment

70 Group A Group B Group C Group D Classic-CF CF-causing mutations Non-classic CF CFTR-related disorder associated mutations No clinical consequence Unknown clinical relevance All mutations in Table 2 and 711 + 3A > G*, R117H-T5*, D1152H*, L206W*, TG13-T5* TG13-T5a , R117H-T5a , D1152Ha , L206Wa , L997F, M952I, D565Ga , TG11-T5b , R117H-T7b , D443Y-G576A-R668C, R74W-D1270N, R75Qb TG11-T5b , R117H-T7b , R75Qb , 875 + 40A/G, M470V, T854T, P1290P, I807M, I521F, R74W, F508C, I506V, I148T All mutations (mostly missense) not yet analyzed or undergoing functional analysis a Mutations that may belong either to Group A or to Group B. b Mutations that may belong either to Group B or to Group C. Login to comment

PMID: 24727426 [PubMed] Wang Y et al: "Understanding how cystic fibrosis mutations disrupt CFTR function: from single molecules to animal models."

No. Sentence Comment

1987 Encouragingly, the data suggest that ivacaftor potentiates multiple gating mutants located in different parts of CFTR structure including R117H (M2), R668C (RD) and A1067T (ICL4) (Yu et al., 2012; Van Goor et al., 2014). Login to comment

PMID: 25033378 [PubMed] LaRusch J et al: "Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis."

No. Sentence Comment

95 CFTR variant %Cases %Uctrls OR p-value %Cases w/N34S OR w/N34S p-value w/N34S CF/BD or BD/BD 2.5 0.1 31.9 ,0.0001 5.5 7.46 0.12 All CF 8.7 3.3 2.76 ,0.0001 16.4 5.65 ,0.0001 F508del CF 6.9 3.1 2.32 ,0.0001 14.5 5.13 ,0.0001 IVS8T5** CF 9.9 8.2 1.24 0.079 10.9 1.37 0.47 2789+5G.A CF 0.3 0.0 0.028 0.0 3849+10kbC.T CF 0.3 0.0 0.028 0.0 N1303K CF 0.3 0.0 0.027 0.0 621+1G.T CF 0.1 0.0 0.13 1.8 ,0.0001 2184delA CF 0.1 0.0 0.13 0.0 3120+1G.A CF 0.1 0.0 0.13 0.0 G551D CF 0.2 0.1 2.50 0.20 0.0 0.00 0.83 W1282X CF 0.2 0.1 2.50 0.20 0.0 0.00 0.83 G542X CF 0.2 0.0 0.059 0.0 R1162X CF 0.1 0.0 0.13 0.0 2183AA.G CF 0.0 0.1 0.17 0.0 0.00 0.83 All BD 14.2 9.8 1.50 0.002 25.5 4.63 ,0.0001 R75Q BD 6.3 6.2 1.02 0.30 16.4 2.97 0.003 S1235R BD 2.4 1.4 1.69 0.052 1.8 1.30 0.80 R117H CF/BD 2.3 0.7 3.49 0.0007 5.5 8.74 0.0002 L967S BD 1.1 0.2 6.87 0.002 1.8 11.17 0.014 L997F BD 0.8 1.0 0.82 0.26 1.8 1.84 0.55 D1152H BD 0.4 0.0 0.014 0.0 D1270N BD 0.3 0.2 1.25 0.29 0.0 0.00 0.71 R170H BD 0.3 0.0 0.028 0.0 R74Q BD 0.3 0.1 3.02 0.17 1.8 21.15 0.002 Other M470V 76.1 74.2 1.11 0.14 70.9 0.85 0.59 T854T 57.3 57.8 0.98 0.29 45.5 0.61 0.071 Q1463Q 39.6 39.5 1.01 0.30 40.0 1.02 0.94 1001+11C.T* 13.4 10.9 1.27 0.016 14.5 1.40 0.42 125G.C 10.3 9.7 1.07 0.26 12.7 1.36 0.45 P1290P 7.6 7.9 0.95 0.28 7.3 0.91 0.86 1716G.A 4.5 4.1 1.10 0.26 1.8 0.43 0.39 R668C 1.0 1.4 0.72 0.19 0.0 0.00 0.38 G576A 0.7 1.2 0.58 0.11 0.0 0.00 0.41 computationally modeled the molecular structure, and studied the dynamics, of wild type (WT) and mutated CFTR channels. Login to comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

PMID: 25060775 [PubMed] Com G et al: "Exercise intolerance, malnutrition, abnormal sweat chloride levels, and two CFTR mutations: is it cystic fibrosis?"

No. Sentence Comment

31 A full CFTR mutation panel revealed heterozygous mutations of p.G576A and p.R668C. Login to comment
45 Meanwhile, his CFTR gene mutation information was researched on two CF mutation databases (www.genet.sickkids.on.ca and www.cftr2.org), and it was found that neither p.G576A nor p.R668C mutations were associated with clinically significant disease. Login to comment

PMID: 25674778 [PubMed] Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."

No. Sentence Comment

32 [1075C>A;1079C>A] (Q359K/T360K) - - - Mutations that do not cause CF when combined with another CF-causing mutation c.1727G>C (G576A) c.3485G>T (R1162L) c.224G>A (R75Q) - - c.3080T>C (I1027T) c.91C>T (R31C) c.3705T>G (S1235R) - - c.2991G>C (L997F) c.2002C>T (R668C) c.2260G>A (V754M) - - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒContinued (http://www.hgvs.org/mutnomen/) and legacy mutation nomenclature (http://www.cftr2.org/browse.php). Login to comment

PMID: 25797027 [PubMed] Bergougnoux A et al: "Should diffuse bronchiectasis still be considered a CFTR-related disorder?"

No. Sentence Comment

77 (=) IVS8-(T)n no rs NA NA NA NA UV UV (ND) c.1519_1521delATC p.Ile507del I507del/ƊI507 rs121908745 0.021 0 NA 0.0024 (n2) 0.0038 (n3) CF CF (ND) c.1521_1523delCTT p.Phe508del F508del/ƊF508 rs113993960 0.01 0 0.01 (calculated) 0.67 (n1) CF CF c.1584G N A p.Glu528Glu 1716G N A rs1800095 0.021 0.0638 0.005-0.042 (15 studies) 0 (n1) P NNV c.1727G N C p.Gly576Ala G576A rs1800098 0.0638 0.0213 0.003-0.33 (4 studies) 0 (n1) UV M c.2002C N T p.Arg668Cys R668C rs1800100 0.0638 0.0319 0.004-0.02 (14 studies) 0 (n1) UV M c.2620-26A N G p. Login to comment
93 The UVs p.Gly576Ala and p.Arg668Cys were found in six patients with DB and two controls. Login to comment
96 Furthermore, p.Arg668Cys was found alone in one healthy control. Login to comment
110 The results of this analysis and comparison, when possible, with the MAF range for the general population (dbSNP database) or the CF population (our laboratory cohort or previously published control cohorts [10,11]) indicated that the variants p.Arg75Gln, p.Gly576Ala and p.Arg668Cys were twice more present in the DB cohort than in the general population. Login to comment
136 Splicing was altered in the minigenes containing the exonic variants p.Gly576Ala, p.Arg668Cys and, to a lesser extent, p.Thr966Thr. Login to comment
138 Indeed, the in silico analysis predicted that only the p.Arg668Cys missense variants could lead to a splicing defect. Login to comment
139 In agreement, when using the exon 14-WT and the c.2002C N T (p.Arg668Cys) minigenes, three transcript populations were identified, corresponding to complete exon 14 inclusion (upper band) or skipping (lower band), or inclusion of exon 14 lacking the first 248 nucleotides (middle band), as already described [20]. Login to comment
142 Moreover, for the variants p.Gly576Ala and p.Arg668Cys, the quantity of normal CFTR transcript was reduced by 57 and 37%, respectively, compared to the WT gene (Fig. 2C). Login to comment
148 Transfection of full length CFTR containing the mutation p.Arg75Gln, p.Gly576Ala/p.Arg668Cys (alone and together), p.Val754Met or p.Thr966Thr induced a 30-50% decrease in CFTR mRNA level, compared to WT CFTR (Fig. 2C). Login to comment
153 Quantification of the blots indicated that the level of mature CFTR protein was decreased by 17%-26% in cells expressing the p.Arg75Gln, p.Arg117His, p.Gly576Ala, p.Arg668Cys (alone and together), p.Leu997Phe or p.Thr966Thr variant, and by 48% and 39% in cells expressing p.Glu528Glu and p.Val754Met, respectively (Fig. 2D, lower panel). Login to comment
185 Minigene splicing assays in Beas-2B cells to compare the effect of the p.Gly576Ala, p.Arg668Cys and p.Thr966Thr and wild type (WT) CFTR minigenes on the splicing patterns of exons 13, 14 and 16, respectively. Login to comment

PMID: 25824995 [PubMed] Salinas DB et al: "Benign outcome among positive cystic fibrosis newborn screen children with non-CF-causing variants."

No. Sentence Comment

4 Conclusions: The outcomes in children 2-6 years of age with the L997F, G576A, R1162L, V754M, R668C, R31C, and S1235R variants are consistent with the CFTR2 non-CF-causing classification. Login to comment
55 There were no sweat chloride results meeting CF diagnostic criteria of ࣙ60 mmol/L in the N-CF group, and only one subject with three variants (G542X, G576A, R668C) had values in the "possible CF" category (ࣙ40 mmol/L) beyond 6 months. Login to comment
96 a All subjects who had G576A from this study also had R668C in cis. Login to comment
97 Two other subjects had R668C without G576A. Login to comment
98 G576A and R668C were analyzed as single alleles in CFTR2. Login to comment

PMID: 25874479 [PubMed] Loukas YL et al: "Clinical diagnostic Next-Generation sequencing: the case of CFTR carrier screening."

No. Sentence Comment

101 Another proband carried the p.Arg668Cys, a variant detected in CF patients but not proved to be CF causing based on CFTR2 database interpretation (http://www.cftr2.org/). Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

373 [1117-8A>G;1727G>C;2002C>T] uncertain: found only with an unknown allele in trans 1249-8A>G nd; G576A non CF-causing; R668C non CF-causing 1259insA c.1127_1128insA CF-PI CF-causing p.Gln378AlafsX4 E379X c.1135G>T CF-PI nd p.Glu379* M394R c.1181T>G CF-PI nd p.Met394Arg (TG)11T5 c. Login to comment
384 [1727G>C;2002C>T] CFTR-RD G576A non CF-causing; R668C non-CF causing p. Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

87 [Gln359Lys; Thr360Lys] L558S c.1673 T4C p.Leu558Ser Y569D c.1705 T4G p.Tyr569Asp D579G c.1736 A4G p.Asp579Gly D614G c.1841 A4G p.Asp614Gly S977F c.2930C4T p.Ser977Phe F1052V c.3154 T4G p.Phe1052Val G1069R c.3205G4A p.Gly1069Arg R1070Q c.3209G4A p.Arg1070Gln D1152H c.3454G4C p.Asp1152His I1234V c.3700 A4G p.Ile1234Val 5T c.1210 - 12[5] Examples of common not CF-causing variantsc R31C c.91C4T p.Arg31Cys R74W c.220C4T p.Arg74Trp R75Q c.224G4A p.Arg75Gln I148T c.443 T4C p.Ile148Thr M470V c.1408 A4G p.Met470Val G576A c.1727G4C p.Gly576Ala R668C c.2002C4T p.Arg668Cys V754M c.2260G4A p.Val754Met L997F c.2991G4C p.Leu997Phe I1027T c.3080 T4C p.Ile1027Thr R1070W c.3208C4T p.Arg1070Trp R1162L c.3485G4T p.Arg1162Leu Table 1 (Continued) HGVS nomenclature Legacy name cDNA nucleotide name Protein name S1235R c.3705 T4G p.Ser1235Arg D1270N c.3808G4A p.Asp1270Asn 7T c.1210-12[7] Abbreviation: HGVS, Human Genome Variation Society. Login to comment
103 [220C4T;c.3208C4T;3808G4A] I148T is a neutral variant, but can be associated in cis with a severe CF variant c.3067_3072del (legacy 3199del6 or 3195del6) that, in isolation causes CF, whereas I148T in isolation does not.19,20 G576A is found in cis with R668C and R668C can be found alone or in cis with G576A. Login to comment

PMID: 26500004 [PubMed] Pepermans X et al: "Identification and frequencies of cystic fibrosis mutations in central Argentina."

No. Sentence Comment

84 In one patient, the variants c.1727G N C (p.Gly576Ala) and c.2002C N T (p.Arg668Cys) were observed. Login to comment
100 [1727G N C(;)2002C N T] G576A-R668C 1 (0.6) No Yes in trans non CF-causing in trans No p.Ser589Ile c.1766G N T S589I 1 (0.6) No Yes No No NA c.1766 + 1G N A 1898 + 1G N A 1 (0.6) Yes Yes CF-causing rs186089140 p.Ser737Phe c.2210C N T S737F 1 (0.6) No Yes No rs397508376 p.Leu812Phefs*11 c.2434_2435insT 2566insT 1 (0.6) No Yes No No p.Ser821Argfs*4 c.2462_2463delGT 2594delGT 1 (0.6) No Yes CF-causing No p.Tyr852Leufs*44 c.2554dupT c.2554dupT &#a7; 1 (0.6) No No No rs80224560 NA c.2657 + 5G N A 2789 + 5G N A 1 (0.6) No Yes CF-causing rs75096551 NA c.2988 + 1G N A 3120 + 1G N A 1 (0.6) Yes Yes CF-causing rs76151804 NA c.3140-26A N G 3272-26A N G 1 (0.6) No Yes CF-causing rs143570767 NA c.3873 + 1G N A 4005 + 1G N A 1 (0.6) No Yes CF-causing rs397508631 p.Ser1297Phefs*5 c.3884_3885insT 4016insT 1 (0.6) No Yes CF-causing No p.Leu1414Phe c.4242_4242 + 1delGGinsTT 4374_4374 + 1GG N TT 1 (0.6) No Yes No No NA c.1210-12T [5] TG11-5T 1 (0.6) Yes Yes Varying clinical consequence - p.= c.= WT 14 (8.4) NA NA NA HGVS (Human Genoma Variation Society) used for protein nomenclature [15,16]. Login to comment

PMID: 26574590 [PubMed] Kharrazi M et al: "Newborn Screening for Cystic Fibrosis in California."

No. Sentence Comment

123 IRT below cutoff 14 9 / (mutations not identified) White (n = 5) Meconium ileus (n = 2) 9 / c.1727G.C (G576A)/ c.2002C.T (R668C) Hispanic (n = 3) Family history (n = 2) 16 / c.1521_1523delCTT (F508del)/ c.1624G.T (G5423) Other/multiple (n = 6) Symptoms (n = 12) 28 / c.1521_1523delCTT (F508del)/ c.1521_1523delCTT (F508del) 28 / c.14C.T (P5L)/ c.870-7_870-5delTTT (1002-7delTTT) 29 / (mutations not identified) 31 / c.1521_1523delCTT (F508del)/ c.2175_2176insA (2307insA) 31 / (mutation not identified)/ c. Login to comment