ABCMdb

ABCC7 p.Arg347Leu

[switch to full view]
Comments [show]

None has been submitted yet.

Publications

PMID: 10026154 [PubMed] Cotten JF et al: "Cystic fibrosis-associated mutations at arginine 347 alter the pore architecture of CFTR. Evidence for disruption of a salt bridge."

No. Sentence Comment

12 At least four CF-associated mutations have been identified at position 347 in M6: R347C, R347H, R347L, and R347P, suggesting that Arg-347 is important for CFTR structure and function (13-15).2 Early studies by Sheppard et al. (7) showed that mutation of Arg-347 to proline significantly decreased single-channel conductance with little effect on CFTR trafficking to the plasma membrane. Login to comment
25 We examined the cytosolic pH (pHc)-dependent behavior of CFTR-R347H and that of the other residue 347 mutants both with (R347C, R347D, R347E, and R347K) and without (R347L) a pHc-titratable residue. Login to comment
76 Even R347L, which does not have a titratable side chain, displayed this behavior (Fig. 1). Login to comment
86 Visual inspection suggested that the lifetimes of OL and OB states were also influenced by the nature of the residue at position 347: R347E and R347H tended to have longer dwell times in the OL and OB states, whereas R347L, R347C, and R347D tended to display shorter dwell times. Login to comment
90 Since R347L displayed two pHc-dependent conductance states and since leucine is aliphatic and non-ionizable, the pHc dependence of residue 347 mutants cannot be attributed simply to protonation of residue 347. Login to comment
113 The observable pK (0 mV) for the equilibrium between OL and OB of R347E and R347H were 6.4 and 6.3, respectively. The faster kinetics of R347D, R347C, and R347L made dwell-time analysis for these mutants less reliable. Login to comment
117 Fig. 3B shows that R347C, R347D, and R347L did not reach a peak variance over the range of pHc studied, suggesting that their apparent pK is less than 5.0-5.5. Login to comment
136 B, open-channel current variance of the R347C, R347D, R347L, and R347E mutants versus pHc. Login to comment
210 The Arg-347 residue is targeted by several CF-associated mutations, R347C, R347H, R347L, and R347P (13-15).2 Our data suggest that CF-associated as well as other mutations at residue 347 affect CFTR similarly. Login to comment

PMID: 11118444 [PubMed] Clain J et al: "Two mild cystic fibrosis-associated mutations result in severe cystic fibrosis when combined in cis and reveal a residue important for cystic fibrosis transmembrane conductance regulator processing and function."

No. Sentence Comment

14 At least four CF-associated mutations have been identified in isolation at position 347 (R347C, R347H, R347L, and R347P) and two at position 979 (D979A and D979V), suggesting that Arg-347 and Asp-979 are important for CFTR structure and/or function. Login to comment

PMID: 12070257 [PubMed] Scotet V et al: "Prenatal detection of cystic fibrosis by ultrasonography: a retrospective study of more than 346 000 pregnancies."

No. Sentence Comment

246 Therefore, the spectrum of mutations identified in this fetal population is not representative of that identified in our CF population, in which we found a significant number of mild mutations or mutations for which the clinical consequences are not yet established (for example, G91R, R117H, R347L, R560K).34 35 These findings provide the foundation for further investigations towards understanding the pathogenesis of early bowel disease, but also why it results in manifestations in the bowel rather than in the lungs during the fetal period. Login to comment

PMID: 12124743 [PubMed] Salvatore F et al: "Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes."

No. Sentence Comment

46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994]. Login to comment

PMID: 12815607 [PubMed] Scotet V et al: "Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland."

No. Sentence Comment

64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

PMID: 15880796 [PubMed] Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."

No. Sentence Comment

58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

PMID: 19236881 [PubMed] Enquist K et al: "Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein."

No. Sentence Comment

113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment

PMID: 22892530 [PubMed] Sobczynska-Tomaszewska A et al: "Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy."

No. Sentence Comment

57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment
171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele. Login to comment

PMID: 9550362 [PubMed] Hojo S et al: "Severe cystic fibrosis associated with a deltaF508/R347H + D979A compound heterozygous genotype."

No. Sentence Comment

71 The other mutation, R347L was identified in a compound heterozygote state with AF508 by Andrizet et al. (11) in a girl who at the age of 2 years did not yet exhibit any symptoms. Login to comment
72 Mutations R347P and R347L change an arginine- codon to proline and leucine respectively, i.e. a basic amino acid to amino acids bearing nonpolar side chains in CFTR. Login to comment
73 Kosztolanyi et al. (5) suggested that the unusually mild nature of CF in patient AF508/R347H genotype is associated with the fact that a missense mutation resulting in an exchange between similarly charged (basic) amino acids, histidine for arginine, produces even less significant change in ion flow through the chloride channel than the transition in R347P and R347L. Login to comment

PMID: 8530001 [PubMed] Ferec C et al: "Neonatal screening for cystic fibrosis: result of a pilot study using both immunoreactive trypsinogen and cystic fibrosis gene mutation analyses."

No. Sentence Comment

80 Identification of novel mutations The systematic screening of exons 7, 10, and I I performed on each positive Guthrie card during this period has led us to identify five new mutations in the CFTR 30 545 % of non AF508 mutations 20 9 1717-1G->A 10 & & i i Esox G91R I 621+1G->T R117H 6b[ 7 905delG 1078 del T R347H 1221 det CT F311L R347L i10 i11i12 13 14a~l ! Login to comment

PMID: 7551394 [PubMed] Friedman KJ et al: "Screening Young syndrome patients for CFTR mutations."

No. Sentence Comment

78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

PMID: 7526685 [PubMed] Morral N et al: "Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene."

No. Sentence Comment

108 )-.T R347L Audrezet et al. 1993 G--S-C R347P Dean et al. 1990 1789 ......... C--.G R553G C. Ferec, personal communication CI-T R553X Cutting et al. 1990 1790 ......... G---A R553Q Dork et al.1991a 3328 ......... C-OT R1066C Fanen et al. 1992 3329 ......... G-.A R1066H Ferec et al. 1992 GT R1066L Mercier et al. 1993 3340 ......... CT R1070W M. Macek, Jr., unpublished data 3341 ......... G-A R1070Q Mercier et al. 1993 a This change is a polymorphism, not a disease mutation. Login to comment
124 Two other mutations (R347H and R347L) (Cremonesi et al. 1992; Audrezet et al. 1993) have occurred at nucleotide 1172 (G--A and G--T), and another one (R347C) has occurred at nucleotide 1171, which consists of a C-*T transition (C. Ferec, personal communication). Login to comment

PMID: 7525963 [PubMed] Chevalier-Porst F et al: "Mutation analysis in 600 French cystic fibrosis patients."

No. Sentence Comment

21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

PMID: 7521710 [PubMed] Ravnik-Glavac M et al: "Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene."

No. Sentence Comment

121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

PMID: 7516232 [PubMed] Bienvenu T et al: "A new missense mutation (G27E) in exon 2 of the CFTR gene in a mildly affected cystic fibrosis patient."

No. Sentence Comment

36 Other missense mutations (i.e. E92K, R117H, R334W, R347P, R347L) especially located in the first transmembrane domain are associated with pancreatic sufficiency (15-17). Login to comment

PMID: 7683952 [PubMed] Audrezet MP et al: "Identification of 12 novel mutations in the CFTR gene."

No. Sentence Comment

37 R347L This missense mutation changes an arginine (an amino acid with a basic side chain) for a leucine bearing a non-polar side chain. Login to comment
39 The affected girl, a two year old compound heterozygote (genotype AF508/R347L), was diagnosed by systematic neonatal screening and up to now presented with no clinical symptoms (pancreatic sufficient). Login to comment
92 For the four other mutations: R347L and A349V in exon 7, A534E in exon 11 and 3601 -17 T - C, we have only indirect evidence in support of their being causative of disease: (i) these changes have never been observed on more than 300 non CF chromosomes so far examined (this panel of non CF chromosomes has been established from a series of non CF chromosomes, the normal alleles being deduced from non carrier siblings of non affected children); (ii) the missense mutations result in a switch to an amino acid of different polarity at that site; and (iii) the amino acids 347 (arginine) and 534 (alanine) are conserved in the CFTR of human, cow, Xenopus, mouse and dogfish, and the amino acid 349 (alanine) is conserved in the CFTR of human, cow and Xenopus (20). Login to comment
98 This notion has also been confirmed by a series of observations of the effects of missense mutations, such as Rl 17H (28), G91R (29) or R347L (this report), which are associated with pancreatic insufficiency and a milder form of the disease. Login to comment

PMID: 16678395 [PubMed] Munthe-Kaas MC et al: "CFTR gene mutations and asthma in the Norwegian Environment and Childhood Asthma study."

No. Sentence Comment

25 CFTR mutation Alleles (%) F508del 184 (62.2) R117C 12 (4.1) R117H 12 394delTT 11 (3.8) 4005+2T-C 11 G551D 6 (2.0) 3659delC 5 (1.7) E60X 4 (1.4) V232D 4 1525-2A-G 3 (1.0) N1303K 3 G542X 2 (0.7) E279X 2 R75X 2 S912X 2 E116X 1 (0.3) L295Q 1 R347L 1 Q493X 1 I506L 1 I507del 1 R553X 1 G576A 1 621-1G-T 1 2183AA-G 1 S945L 1 R1162X 1 I1234V 1 3849+10 kbC-T 1 W1282X 1 Unknown 18 (6.5) Total alleles 296 (100%) Mutations detected with OLA31 m kit-74%. Login to comment