ABCC1 p.Arg1058Gln
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 16766035
[PubMed]
Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."
No.
Sentence
Comment
831
R1058Q and S1512L was performed recently by Letourneau et al. (2005) in transfected HEK293T cells.
X
ABCC1 p.Arg1058Gln 16766035:831:0
status: NEW852 Table 5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to Le Saux et al., 2000; Ito et al., 2001; Moriya et al., 2002; Conrad et al., 2002; Oselin et al., 2003b; Wang et al., 2004) Position/ Nucleotide Aminoacid or effect Orientals Caucasians Function 128G>C C43S 0.01 - elevateda 218C>T T73I 0.00-0.04 - 257C>T S92F 0.00 0.00 decreaseda 350C>T T117M - 0.02 (decreased)a 689G>A R230N 0.00 0.00 (decreased)a 816G>A synonymous - 0.04 825T>C synonymous - 0.30 1057G>A V353M 0.00 0.005 elevateda 1299G>T R433S - 0.01 elevated Vmax of doxorubicin, decreased transport of LTC4 a,b 1684T>C synonymous - 0.80 1898G>A R633Q - 0.01 (decreased)a 2012G>T G671V - 0.03 doxorubicine-induced cardiomyopathyc 2168G>A R723Q 0.01-0.07 - decreaseda 2965G>A A989T 0.00 0.005 (decreased)a 3140G>C C1047S 0.00 0.00 3173G>A R1058Q 0.01 - 4002G>A synonymous - 0.28 4535C>T S1512L - 0.03 decreaseda a Letourneau et al. (2005).
X
ABCC1 p.Arg1058Gln 16766035:852:877
status: NEW
PMID: 18464048
[PubMed]
Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."
No.
Sentence
Comment
81
MRP1 (ABCC1) NH2 NBD NBD in out Membrane Cys43Ser Ser92Phe Thr117Met Arg230Gln Val353Met Arg633Gln Gly671Val Arg723Gln Arg433Ser Ala989Thr Cys1047Ser Val1146Ile Arg1058Gln Thr1401Met Ser1512Leu Thr73Ile COOH NBD NBD COOH NBD COOH NBD NBD Table1MRP1(ABCC1)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 128G>CCys43SerExon2--1[1]-Decreaseinvincristineresistance[2]rs41395947 Disruptedplasmamembranetraffickingin transfectedcells[2] 218C>TThr73IleExon2--1[1]3.7Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] rs41494447 257C>TSer92PheExon30a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 350C>TThr117MetExon3-100[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] 689G>AArg230GlnExon70a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 1057G>AVal353MetExon90a 0.5a 0a -- 1299G>TArg433SerExon10-1.4[6]--Changesintransportandresistance[7] 1898G>AArg633GlnExon13-[8]--Noinfluenceonexpressionandtransportin membranevesicles[4] 2012G>TGly671ValExon16-2.8[6]--Noinfluenceonexpressionandtransportin membranevesicles[6] Associatedwithanthracycline-induced cardiotoxicity[9] 2168G>AArg723GlnExon17--7.3[1]5.6Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4]noinfluenceonmRNA expressioninenterocytes(n=1)[10] rs4148356 2965G>AAla989ThrExon220a 0.5a 0a -Noinfluenceonexpressionandtransportin membranevesicles(non-significantreduction inE17βGtransport)[4] 323 3140G>CCys1047SerExon234.5a 0a 0a -Noinfluenceonexpressionandtransportin membranevesicles[4] rs13337489 3173G>AArg1058GlnExon23--1[1]-Noinfluenceonexpressionandtransportin membranevesicles[4] rs41410450 3436G>AVal1146IleExon24-----rs28706727 4102C>TThr1401MetExon29-----rs8057331 4535C>TSer1512LeuExon31-[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined.
X
ABCC1 p.Arg1058Gln 18464048:81:161
status: NEW
PMID: 19949922
[PubMed]
Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."
No.
Sentence
Comment
135
R1058Q, and S1512L was performed by Létourneau et al.
X
ABCC1 p.Arg1058Gln 19949922:135:0
status: NEW155 ABCC2 (Multidrug Resistance-Associated Protein 2) Table 6.5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to (33, 77-80, 136)) Position Amino acid or effect Orientals Caucasians Function c.128G>C C43S 0.01 - Elevateda c. 218C>T T73I 0.00-0.04 - c. 257C>T S92F 0.00 0.00 Decreaseda c. 350C>T T117M - 0.02 (Decreased)a c. 689G>A R230N 0.00 0.00 (Decreased)a c. 816G>A Synonymous - 0.04 c. 825T>C Synonymous - 0.30 c. 1057G>A V353M 0.00 0.005 Elevateda c. 1299G>T R433S - 0.01 Elevated vmax of doxorubicin, decreased transport of LTC4 a,b c. 1684T>C Synonymous - 0.80 c. 1898G>A R633Q - 0.01 (Decreased)a c. 2012G>T G671V - 0.03 Doxorubicine-induced cardiomyopathyc c. 2168G>A R723Q 0.01-0.07 - Decreaseda c. 2965G>A A989T 0.00 0.005 (Decreased)a c. 3140G>C C1047S 0.00 0.00 c. 3173G>A R1058Q 0.01 - c. 4002G>A Synonymous - 0.28 c. 4535C>T S1512L - 0.03 Decreaseda References: a [81], b [77], c [84] an inducible expression of ABCC2, which contributes also to the phenomenon of drug resistance.
X
ABCC1 p.Arg1058Gln 19949922:155:860
status: NEW
PMID: 19950006
[PubMed]
Sissung TM et al: "Pharmacogenetics of membrane transporters: an update on current approaches."
No.
Sentence
Comment
67
Those studied include C43S, T73I, S92F, T117M, R230Q, V353M, R433S, R633Q, G671V, R723Q, A989T, C1047S, R1058Q, A1337T, and S1512L.
X
ABCC1 p.Arg1058Gln 19950006:67:104
status: NEW
PMID: 11266082
[PubMed]
Ito S et al: "Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects."
No.
Sentence
Comment
32
Four of the 16 mutations were associated with an amino acid substitution; G to C transversion at position 128 (G128C, Cys to Ser at codon 43) in exon 2, C to T at 218 (C218T, Thr to Ile at 73) in exon 2, G to A at 2168 (G2168A, Arg to Gln at 723) in exon 17 and G to A at 3173 (G3173A, Arg to Gln at 1058) in exon 23 (position numbering from Grant et al., 1997) (Fig. 2).
X
ABCC1 p.Arg1058Gln 11266082:32:286
status: NEW63 In the MRP1 gene, we identi®ed four missense mutations, G128C (Cys43Ser), C218T (Thr73Ile), G2168A (Arg723Gln) and G3173A (Arg1058Gln).
X
ABCC1 p.Arg1058Gln 11266082:63:128
status: NEW67 Frequencies of mutations in the MRP1 gene in a Japanese population (n 48) Primer pair Location Nucleic acid Nucleotide sequence Amino acid Genotype Allele frequency substitutiona substitution Wild-type Mutation w/w w/m m/m w m MR12/1 Exon 2 G128C gccttGttttt gccttCttttt Cys43Ser 47 1 0 0.990 0.010 MR12/1 Exon 2 C218T caaaaCcaaaa caaaaTcaaaa Thr73Ile 47 1 0 0.990 0.010 MR18/1 Exon 8 T825C aaggtTgtgta aaggtCgtgta Val275Val 18 24 6 0.625 0.375 MR19/1 Exon 9 T1062C gtgaaTgacac gtgaaCgacac Asn354Asn 17 28 3 0.646 0.354 MR113/1 Exon 13 T1684C tggccTtgtgc tggccCtgtgc Leu562Leu 31 15 2 0.802 0.198 MR116/1 Exon 16 C2007T atcccCgaagg atcccTgaagg Pro669Pro 40 8 0 0.917 0.083 MR117/1 Exon 17 G2168A tctccGagaaa tctccAagaaa Arg723Gln 41 7 0 0.927 0.073 MR120/1 Exon 20 C2665T gcggtCcaggg gcggtTcaggg Pro889Pro 47 1 0 0.990 0.010 MR120/1 Exon 20 T2694C gagaaTggcat gagaaCggcat Asn898Asn 47 1 0 0.990 0.010 MR123/1 Exon 23 G3173A cctgcGgtcac cctgcAgtcac Arg1058Gln 47 1 0 0.990 0.010 MR128/1 Exon 28 G4002A aagtcGtccct aagtcAtccct Ser1334Ser 36 9 3 0.844 0.156 MR131/1 Exon 31 C4524T gagtaCggcgc gagtaTggcgc Tyr1508Tyr 47 1 0 0.990 0.010 MR19/1 Intron 9 A12188G aggggAcgctg aggggGcgctg ± 17 28 3 0.646 0.354 MR112/1 Intron 11 C1474À48T atgggCtgatc atgggTtgatc ± 44 3 1 0.948 0.052 MR119/1 Intron 18 C2461À30G gcactCacgtg gcactGacgtg ± 27 14 7 0.708 0.292 MR119/1 Intron 18 T2461À38C acacaTgtgca acacaCgtgca ± 41 7 0 0.927 0.073 The positions of the identi®ed polymorphisms correspond to positions of the MRP1 gene (Grant et al., 1997; EMBL/GenBank accession no.
X
ABCC1 p.Arg1058Gln 11266082:67:955
status: NEW
PMID: 16006996
[PubMed]
Conseil G et al: "Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters."
No.
Sentence
Comment
148
Fig. 3 Exon 1 2 3 MSDMSD NBD1 MSD NBD2 C4535T(S1512L) G3173A (R1058Q) G3140C (C1047S) G2965A (A989T) G2168A (R723Q) G2012T(G671V) G1898A (R633Q) G1299T(R433S) G1057A (V353M) G689A (R230Q) C350T(T117M) C257T(S92F) C218T(T73I) C128C (C43S) (TM1-5) (TM6-11) (TM12-17) 4 5 6 7 8 9101112 1314 151617 1819 20 21 22 23 242526272829 30 31 Location of non-synonymous SNPs in the coding regions of the genes in the MRP1/ABCC1 gene.
X
ABCC1 p.Arg1058Gln 16006996:148:62
status: NEW
PMID: 16041243
[PubMed]
Letourneau IJ et al: "Functional characterization of non-synonymous single nucleotide polymorphisms in the gene encoding human multidrug resistance protein 1 (MRP1/ABCC1)."
No.
Sentence
Comment
3
Variants 218C > T (Thr73Ile), 257C > T (Ser92Phe), 350C > T (Thr117Met), 689G > A (Arg230Gln), 1898G > A (Arg633Gln), 2168G > A (Arg723Gln), 2965G > A (Ala989Thr), 3140G > C (Cys1047Ser), 3173G > A (Arg1058Gln) and 4535C > T (Ser1512Leu) were recreated using site-directed mutagenesis and transfected into human embryonic kidney cells.
X
ABCC1 p.Arg1058Gln 16041243:3:199
status: NEW28 Of these mutations, the Fig. 1 128G >C (C43S) 128G >T(T73I) 689G >A (R230Q)1057G >A (V353M) 1299G >T(R433S) 1898G >A (R633Q) 2012G >T(G671V) 2168G >A (R723Q) 3173G >A (R1058Q) 4535C >T(S1512L) 3140G >C (C1047S) 2965G >A (A989T) 350C >T(T117M) 257C >T(S92F) 313029282726252423222120181716151413121110987654321 19 MSD1 MSD1 MSD2 MSD3 MSD2 NBD1 MSD3 NBD2 TM 1 2 3 4 5 6 7 8 Val353Met Ala989Thr Cys1047Ser Arg1058Gln NBD2NBD1 Ser1512Leu Arg633Gln Arg433Ser Arg723Gln Thr73lle Thr117Met Arg230Gln Cys43Ser Ser92Phe Gly671Val 9 10 11 12 13 14 15 16 17 (a) (b) Location of reported non-synonymous single nucleotide polymorphisms (SNPs) in MRP1/ABCC1.
X
ABCC1 p.Arg1058Gln 16041243:28:168
status: NEWX
ABCC1 p.Arg1058Gln 16041243:28:402
status: NEW46 The template for generating Table 1 Frequencies of non-synonymous single nucleotide polymorphisms in MRP1/ABCC1 Variant Amino acid substitution Allelic frequency Population References 128G > C Cys43Ser 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 218C > T Thr73Ile 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 3.7% (2/54) Chinese [37] 257C > T Ser92Phe 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 350C > T Thr117Met 1.6% (1/64) Caucasian [28] 689G > A Arg230Gln 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1057G > A Val353Met 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1299G > T Arg433Ser 1.4% (1/72) Caucasian [20] 0% (0/110) Caucasian [19] 1898G > A Arg633Gln 0.8% (2/234) Caucasian [29] 2012G > T Gly671Val 2.8% (2/72) Caucasian [20] 2.6% (6/234) Caucasian [29] 2168G > A Arg723Gln 3.8% (1/26) Japanese [16] 1% (1/96) Japanese [30] 7.3% (7/96) Japanese [17] 5.6% (3/54) Chinese [37] 2965G > A Ala989Thr 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3140G > C Cys1047Ser 0% (0/220) Caucasian www.pharmGKB.org 4.5% (9/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3173G > A Arg1058Gln 0% (0./26) Japanese [16] 1% (1/96) Japanese [17] 4535C > T Ser1512Leu 3.1% (2/24) Caucasian [28] Characterization of MRP1/ABCC1 variants in vitro Le´tourneau et al. 649 the Arg633Gln and Arg723Gln mutants was created by subcloning a HindIII fragment (1329 bp) encoding amino acids 517-959 into pGEM-3z [20].
X
ABCC1 p.Arg1058Gln 16041243:46:1382
status: NEW47 The mutagenesis template for the Ala989Thr, Cys1047Ser and Arg1058Gln mutants was created by subcloning a 1986-bp XmaI fragment encoding amino acids 780-1440 from pcDNA3.1( - )MRP1k into pGEM-3z [21].
X
ABCC1 p.Arg1058Gln 16041243:47:59
status: NEW50 Mutagenesis was performed according to the manufacturer`s instructions with the following sense primers (substituted nucleotides for amino acid mutation are underlined, introduced or disrupted restriction sites are italicized and other silent substitutions are in lower case letters) as follows: Thr73Ile (50 -G ATG ACA CCT CTC AAC AAA ATC AAAACTGCCTTGGG-30 ); Ser92Phe (50 -GG GCA GAC CTG TTC TAC TTT TTC TGG GAA AG-30 ) (EarI); Thr117Met (50 -CTC TTG GGC ATC ACC ATG CTG CTT GCT ACC-30 ); Arg230Gln (50 -GG TTG ATT GTA CAG GGC TAC CGC C-30 ) (BsrGI); Arg633Gln (50 -GAC AGC ATC GAG CGA CAG CCT GTG AAA GAC GGC GG-30 ) (Eam1105I); Arg723Gln (50 -CAG AAT GAC TCT CTC CAA GAA AAt ATC CTT TTT GGA TGT CAG C-30 ) (PleI); Ala989Thr (50 -C ATG TGT AAC CAC GTG TCC ACG CTG GCT TCC-30 ) (PmlI); Cys1047Ser (50 - GCT TCC CGC TCT CTG CAT GTG GAC CTG C-30 ) (PmlI); Arg1058Gln (50 -CTG CTG CAC AGC ATC CTC CAG TCA CCC ATG AGC-30 ) (BstEII); and Ser1512Leu (50 -CAG GAG TAC GGA GCC CCA TTG GAC CTt CTG CAG CAG-30 ) (NarI).
X
ABCC1 p.Arg1058Gln 16041243:50:856
status: NEW51 Following mutagenesis, the desired fragment was subcloned back into pcDNA3.1(-) MRP1k as a XbaI/BamHI fragment (865 bp) for the Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln mutants; a Bsu36I/Esp3I fragment (721 bp) for the Arg633Gln and Arg723Gln mutants; a Esp3I/EcoRI fragment (1313 bp) for the Ala989Thr, Cys1047Ser, Arg1058Gln mutants; and a EcoRI/KpnI fragment (778 bp) for the Ser1512Leu mutant.
X
ABCC1 p.Arg1058Gln 16041243:51:319
status: NEW83 Expression levels of MRP1 mutants To investigate the effect of the amino acid substitutions resulting from the non-synonymous SNPs on MRP1 protein expression and function, MRP1 expression vectors containing the mutations responsible for the substitutions (Thr73Ile, Ser92Phe, Thr117Met, Arg230Gln, Arg633Gln, Arg723Gln, Thr989Ala, Cys1047Ser, Arg1058Gln, Ser1512Leu) were generated by site-directed mutagenesis and transfected into HEK293T cells.
X
ABCC1 p.Arg1058Gln 16041243:83:343
status: NEW87 The mutants were considered in four groups based on their location in the transporter: (a) MSD1/CL3 mutants Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln; (b) NBD1 mutants Arg633Gln and Arg723Gln; (c) MSD3 mutants Ala989Thr, Cys1047Ser and Arg1058Gln; and (d) COOH-terminus mutant Ser1512Leu.
X
ABCC1 p.Arg1058Gln 16041243:87:238
status: NEW123 Previous mutagenesis and inhibition studies have Fig. 3 Cys43Ser Thr73lle Ser92Phe Thr117Met Arg230Gln Arg433Ser Arg633Gln Gly671Val Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu Cys43Ser Thr73lle Ser92Phe Thr117Met Arg230Gln Arg433Ser Arg633Gln Gly671Val Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu Thr73lle Ser92Phe Thr117Met Arg230Gln Arg633Gln Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu LTC4 % WT-MRP1 uptake 0 25 50 75 100 125 E217βG % WT-MRP1 uptake 0 25 50 75 100 125 150 MTX % WT-MRP1 uptake 0 25 50 75 100 125 (b) (c) (a) ATP-dependent vesicular transport of organic anions by mutant MRP1 proteins.
X
ABCC1 p.Arg1058Gln 16041243:123:164
status: NEWX
ABCC1 p.Arg1058Gln 16041243:123:294
status: NEWX
ABCC1 p.Arg1058Gln 16041243:123:395
status: NEW134 Thus, when the subset included the human homologs MRP2, MRP3 and MRP6, the SIFT analysis predicted that the Arg433Ser, Gly671Val and Arg1058Gln substitutions would be deleterious for MRP1 function.
X
ABCC1 p.Arg1058Gln 16041243:134:133
status: NEW157 It is interesting to note that, in some cases, the human MRP1 polymorphic residue is found in the sequence of an MRP1 ortholog or other ABCC homolog (e.g. Thr117Met, Arg230Gln, Arg723Gln and Arg1058Gln).
X
ABCC1 p.Arg1058Gln 16041243:157:191
status: NEW158 This observation may be construed as being Table 2 Conservation of the amino acids substituted by non-synonymous SNP of human MRP1/ABCC1a Protein Speciesb C43S T73I S92F T117Mc R230Q V353M R433S R633Qc G671V R723Q A989T C1047S R1058Q S1512L MRP1 Human C T S T R V R R G R A C R S Monkey C T S M R V R R G Q A C R S Dog C T S M R V R R G R A R R S Cow C A S M Q V R R G R A R R S Rat C A S M Q V R W G R A R R S Mouse C T S M H V R R G R A R R S MRP2 Human L A V T K A K R G K A I R E Monkey L A V T K A K R G K A I R E Dog L A V T K A K R G K A I Q Q Rat L A A T K V K R G K A A R E Mouse L A A T K V K V G K A T R E Rabbit L A V T K V K R G K A I R E MRP3 Human C L S M Y I R K G Q A V R A Rat C L S M L L R K G Q A L R V MRP4 Human - - - - I F K R G R Y T K Y MRP5 Human - - - - V T R S G R T R R S MRP6 Human P A A M R I R S G V A L R A CFTR Human - - - - R Y K A G K L I Q Q SUR1 Human V L L A T V Q R G E L R L E SUR2 Human V L H T Q V Q R G E I N L P Pgp Human - - - - - E K S G A G R R Q YCF1 Saccharomyces cervisiae A I L V T V K L G K S Y R G Mrp1 Caenorhabditis elegans T L D F L I R T G R G L R K Mrp2 Caenorhabditis elegans T F D I L I K T G R G I R K AtMRP2 Arabidopsis thaliana Q L R W L M S P G R R K R E AtMRP1 Arabidopsis thaliana H T A V L M S P G R R K R E a Aligned using Clustal W (http://pbil.univ-lyon1.fr/).
X
ABCC1 p.Arg1058Gln 16041243:158:227
status: NEW
PMID: 17329911
[PubMed]
Fukushima-Uesaka H et al: "Genetic variations and haplotype structures of the ABC transporter gene ABCC1 in a Japanese population."
No.
Sentence
Comment
69
We also detected three known nonsynonymous variations, 218CÀT (Thr73Ile), 2168GÀA (Arg723Gln), and 3173GÀA (Arg1058Gln) at frequencies of 0.007, 0.065 and 0.003, respectively. These frequencies were similar to those found in the earlier reports for Japanese11) and Chinese.21) One of the variations, Arg723Gln, leads to reduced transport activities for LTC4, estradiol 17b-glucuronide and methotrexate.12) We did not detect three previously reported variations: 2012GÀT (Gly671Val; found with approximately 0.03 frequency in Caucasians), 3140GÀC (Cys1047Ser; 0.05 in African-Americans), and 4535CÀT (Ser1512Leu; 0.03 in Caucasians).8,9,12) These SNPs might be ethnic- specic.
X
ABCC1 p.Arg1058Gln 17329911:69:123
status: NEW120 As for Block 3 (Table 5), the haplotypes with 3550GÀA (Glu1184Lys), 3901CÀT (Arg1301Cys), 3490GÀA (Val1164Ile) and 3173GÀA (Arg1058Gln) were dened as *2, *3, *4 and *5, respectively.
X
ABCC1 p.Arg1058Gln 17329911:120:144
status: NEW124 In addition, the variations 3550GÀA (Glu1184Lys, *2), 3901CÀT (Arg1301Cys, *3), 3490GÀA (Val1164Ile, *4) and 3173GÀA (Arg1058Gln, *5) could be included in the Block 3 htSNPs.
X
ABCC1 p.Arg1058Gln 17329911:124:138
status: NEW
PMID: 18220559
[PubMed]
Yu XQ et al: "Multidrug resistance associated proteins as determining factors of pharmacokinetics and pharmacodynamics of drugs."
No.
Sentence
Comment
405
Important Single Nucleotide Polymorphisms (SNPs) of MRP Genes MRP Chromosomal location Amino acid variation Nucleotide variation Location References Cys43Ser Thr73Ile G128C C218T Exon2 Exon2 [239] Arg433Ser G1299T Exon10 [258] Gly671Val G2012T Exon16 [259] Arg723Gln G2168A Exon17 [239] MRP1 16p13.11-p13.12 Arg1058Gln G3173A Exon23 [239] C-24T Promoter [100, 239] Val417Ile G1249A Exon10 [100, 238, 239] Gly676Arg G2026C Exon16 [237] Try709Arg T2125C Exon17 [236] Arg768Trp Ser789Phe C2302T C2366T Exon18 Exon18 [100, 238, 239] I1173F R1150H A3517T G3449A Exon25 Exon25 [240] Ile1324Ile C3972T Exon28 [100, 239] MRP2 10q23-24 Ala1450Thr G4348A Exon31 [100, 238, 239] (Table 2) contd….
X
ABCC1 p.Arg1058Gln 18220559:405:308
status: NEW
PMID: 19214144
[PubMed]
Yin JY et al: "Characterization and analyses of multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphisms in Chinese population."
No.
Sentence
Comment
5
Results The allelic frequencies of Cys43Ser (128G > C), Thr73Ile (218C > T), Arg723Gln (2168G > A), and Arg1058Gln (3173G > A) in mainland Chinese were 0.5, 1.4, 5.8, and 0.5%, respectively.
X
ABCC1 p.Arg1058Gln 19214144:5:104
status: NEW8 In contrast, the Thr73Ile mutation reduced resistance to methotrexate and etoposide, whereas the Arg1058Gln mutation increased the response of two anthracycline drugs and etoposide in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells.
X
ABCC1 p.Arg1058Gln 19214144:8:97
status: NEW23 The four most common nonsynonymous SNPs in the Asian population are Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations [15,17].
X
ABCC1 p.Arg1058Gln 19214144:23:103
status: NEW24 While Cys43Ser (128G > C) is located in the first transmembrane (TM), Thr73Ile (218C > T), Arg723Gln (2168G > A) and Arg1058Gln (3173G > A) are located in the first intracellular loop, the first NBD, and the seventh intracellular loop, respectively (Fig. 1a).
X
ABCC1 p.Arg1058Gln 19214144:24:117
status: NEW35 Fig. 1 COOH L0 NBD1 NBD2 NH2 KCFQNTVLVWVPCFYLWACFPFYF TM1(a) CL1 Thr73Ile …AWIQNDSLRENILFGC… NBD1 Arg723Gln * * * * …DLLHSILRSPMSFF… CL7 Arg1058Gln PFYFLYLSRHDRGYIQMTPLNKTK Cys43Ser Cys43Ser Thr73Ile Arg723Gln Arg1058Gln 1 Human Monkey Bovine Dog Mouse Rat Chicken 2 3 4 5 6 7 (b) Location and conservation of the amino acid residues with polymorphisms in multidrug-resistance-associated protein 1 (MRP1/ABCC1).
X
ABCC1 p.Arg1058Gln 19214144:35:165
status: NEWX
ABCC1 p.Arg1058Gln 19214144:35:238
status: NEW36 (a) Location of Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln in the schematic model of MRP1/ABCC1.
X
ABCC1 p.Arg1058Gln 19214144:36:51
status: NEW51 Site-directed mutagenesis For site mutagenesis, cassettes containing various domains of MRP1/ABCC1 cDNA were first released from the full-length cDNA by double digestion (Not I/BamH I for Cys43Ser and Thr73Ile mutation; EcoN I/BsmB I for Arg723Gln mutation; and BsmB I/EcoR I for Arg1058Gln mutation), cloned into pGEM-T Easy (Promega), followed by site-directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, USA) with the following primers (the substituted nucleotides are italicized): 50 -TCGTGTGGGTGCCTTGTTTTTACCTCTGGGC-30 (Cys43Ser); 50 -GATGACACCTCTCAACAAAACCAAA ACTGCCTTGGGATTTT-30 (Thr73lle); 50 -GGATTC AGAATGATTCTCTCCAAGAAAACATCCTTTTTGGA TG-30 (Arg723Gln); 50 -GCACAGCATCCTGCGGTCAC CCATGAGCT-30 (Arg1058Gln).
X
ABCC1 p.Arg1058Gln 19214144:51:280
status: NEWX
ABCC1 p.Arg1058Gln 19214144:51:760
status: NEW62 The real-time PCR was carried Table 1 Primers and PCR condition for determining polymorphisms Polymorphisms Oligonucleotide primers Annealing temperature (1C) Restriction enzyme Cys43Ser (128G > C) F: GGTCCTCGTGTGGGTGCCAT 57.5 Nla III R: TAGAAGAAGGAACTTAGGGTCAACT Thr73Ile (218C > T) F: TCAGATGACACCTCTCAACAGAA 56.7 Hinf I R: CCAGTTTTCACCTCCCACATTAT Arg723Gln (2168G > A) F: GCCTGGATTCAGAATGATTCTCTTC 52.0 Taq I R: TACTGACCTTCTCGCCAATCTCTGT Arg1058Gln (3173G > A) F: TCTGCATTGTGGAGTTTT 53.0 Pst I R: GACGAAGAAGTAGATGAGGC F, forward; R, reverse.
X
ABCC1 p.Arg1058Gln 19214144:62:441
status: NEW99 The frequencies of C alleles for the SNP of Cys43Ser and A alleles for the SNP of Arg1058Gln were both about 0.5%.
X
ABCC1 p.Arg1058Gln 19214144:99:82
status: NEW101 The genotyping and allelic frequencies of SNPs for Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations are shown in Table 2.
X
ABCC1 p.Arg1058Gln 19214144:101:86
status: NEW102 The distribution of these SNPs in different populations and their comparison are summarized in Table 3. mRNA and protein expression levels of MRP1/ABCC1 mutants To determine whether these SNPs affect MRP1/ABCC1 expression, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations were recreated in MRP1/ABCC1 cDNA by site-directed mutagenesis and transiently transfected into HEK293 and CHO-K1 cells.
X
ABCC1 p.Arg1058Gln 19214144:102:258
status: NEW107 Subcellular localization of wild-type and mutant MRP1/ABCC1 To further determine whether Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations influence the trafficking of MRP1/ABCC1 to the cell surface, we detected the subcellular localization of wild-type and mutant MRP1/ABCC1 in transiently transfected HEK293 and CHO-K1 cells through the process of immunostaining.
X
ABCC1 p.Arg1058Gln 19214144:107:124
status: NEW108 As shown in Fig. 3, strong plasma membrane staining was observed with all cells that are transfected with either wild-type or mutant MRP1/ABCC1, but not in the Table 3 Comparison of distributive frequencies of MRP1/ABCC1 Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln polymorphisms in different ethnic populations Allelic frequency (n) SNPs (nucleic acid substitution) m w Population References NCBI SNP ID Cys43Ser (128G > C) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41395947 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study Thr73Ile (218C > T) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41494447 0 (0/26) 1 (26/26) Japanese [14] 0.037 (2/54) 0.963 (52/54) Chinese [17] 0.014 (1/72) 0.986 (71/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0(0/72) 1 (72/72) Caucasian [15] 0.014 (6/416) 0.986 (410/416) Chinese This study Arg723Gln (2168G > A) 0.073 (7/96) 0.927 (89/96) Japanese [16] rs4148356 0.038 (1/26) 0.962 (25/26) Japanese [14] 0.056(3/54) 0.944 (51/54) Chinese [17] 0 (0/72) 1 (72/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0 (0/72) 1 (72/72) Caucasian [15] 0.058 (24/416) 0.942 (392/416) Chinese* This study Arg1058Gln (3173G > A) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41410450 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study m, mutant; MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism; w, wild-type.
X
ABCC1 p.Arg1058Gln 19214144:108:256
status: NEWX
ABCC1 p.Arg1058Gln 19214144:108:1235
status: NEW110 Table 2 Genotyping and allelic frequencies of MRP1/ABCC1 polymorphisms SNPs (nucleic acid substitution) Allele Allelic frequency (n) Genotype Genotype frequency (n) Cys43Ser (128G > C) G 0.995 (414) GG 0.990 (206) C 0.005 (2) GC 0.010 (2) CC 0 (0) Thr73lle (218C > T) C 0.986 (410) CC 0.971 (202) T 0.014 (6) CT 0.029 (6) TT 0 (0) Arg723Gln (2168G > A) G 0.942 (392) GG 0.889 (185) A 0.058 (24) GA 0.106 (22) AA 0.005 (1) Arg1058Gln (3173G > A) G 0.995 (414) GG 0.990 (206) A 0.005 (2) GA 0.010 (2) AA 0 (0) MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism.
X
ABCC1 p.Arg1058Gln 19214144:110:422
status: NEW112 HEK293 and CHO-K1 cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 followed by preparation of RNAs for quantitative real-time reverse-transcribed PCR analysis of MRP1/ABCC1 R. level (relative level) (a), or preparation of cell lysates for western blot analysis of MRP1/ABCC1 protein level (b).
X
ABCC1 p.Arg1058Gln 19214144:112:122
status: NEW116 Fig. 3 Vector Wild-type Cys43Ser Thr73lle Arg723Gln Arg1058Gln Vector MRP1/ ABCC1 P1 MRP1/ ABCC1 P1(a) MergeMerge Wild-type Cys43Ser Thr73lle Arg723Gln Arg1058Gln (b) Effect of mutations on subcellular localization of multidrug resistance-associated protein 1 (MRP1/ABCC1).
X
ABCC1 p.Arg1058Gln 19214144:116:52
status: NEWX
ABCC1 p.Arg1058Gln 19214144:116:152
status: NEW117 HEK293 (a) and CHO-K1 (b) cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1, followed by fixation and immunostaining of MRP1/ABCC1 using MRPr1 antibody and fluorescein isothiocyanate-conjugated secondary antibody.
X
ABCC1 p.Arg1058Gln 19214144:117:130
status: NEW126 HEK293 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50).
X
ABCC1 p.Arg1058Gln 19214144:126:94
status: NEW135 The Arg1058Gln mutant caused a significant decrease in resistance to anthracyclines and Fig. 5 IC50(nmol/l) Vincristine 20 15 10 5 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln * * * * Vinblastine 15 10 5 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln * * IC50(nmol/l)IC50(nmol/l) 15 10 5 0 * * Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln Daunorubicin IC50(nmol/l) IC50(nmol/l) Methotrexate Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln 15 10 5 0 15 10 5 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln Doxorubicin 200 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln Cisplatin IC50(nmol/l) 150 100 50 0 IC50(nmol/l) Paclitaxel 10 8 6 4 2 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln IC50(nmol/l) Etoposide 20 15 10 5 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln * ** Effect of mutations on multidrug resistance-associated protein 1 (MRP1/ABCC1)-mediated multidrug resistance in CHO-K1 cells.
X
ABCC1 p.Arg1058Gln 19214144:135:4
status: NEW136 CHO-K1 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50).
X
ABCC1 p.Arg1058Gln 19214144:136:94
status: NEW139 In CHO-K1 cells, the Arg1058Gln mutant also conferred lower resistance to vinblastine, methotrexate, anthracyclines, and etoposide.
X
ABCC1 p.Arg1058Gln 19214144:139:21
status: NEW142 Discussion In this study, we identified the allelic frequencies of Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln in a mainland Chinese population.
X
ABCC1 p.Arg1058Gln 19214144:142:102
status: NEW145 In addition, Arg1058Gln can reduce drug resistance of etoposide, daunorubicin, and doxorubicin.
X
ABCC1 p.Arg1058Gln 19214144:145:13
status: NEW147 This study shows for the first time the frequencies of nonsynonymous mutations, Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln, in a large sample of healthy volunteers from mainland China.
X
ABCC1 p.Arg1058Gln 19214144:147:115
status: NEW148 In the 208 Chinese volunteers enrolled in this study, few had Cys43Ser, Thr73Ile, and Arg1058Gln polymorphisms.
X
ABCC1 p.Arg1058Gln 19214144:148:86
status: NEW161 Table 4 Resistance factors of transfected HEK293 cells to chemotherapeutic agents Resistance factorsa Drugs WT MRP1/ABCC1 Cys43Ser (128G > C) Thr73lle (218C > T) Arg723Gln (2168G > A) Arg1058Gln (3173G > A) Cisplatin 0.95 ± 0.24 0.95 ± 0.14 0.83 ± 0.18 0.76 ± 0.20 1.10 ± 0.10 Paclitaxel 1.14 ± 0.09 0.99 ± 0.16 0.99 ± 0.21 1.10 ± 0.22 1.04 ± 0.16 Daunorubicin 17.82 ± 3.15 17.27 ± 2.37 19.73 ± 1.98 9.09 ± 1.68 8.73 ± 2.62 Doxorubicin 14.38 ± 0.75 15.13 ± 0.91 14.63 ± 1.52 3.63 ± 1.20 2.38 ± 1.03 Etoposide 12.65 ± 2.09 11.51 ± 1.92 13.08 ± 1.84 4.41 ± 0.67 6.65 ± 1.05 Methotrexate 10.80 ± 1.33 10.50 ± 1.58 6.70 ± 0.95 6.20 ± 0.90 10.70 ± 1.26 Vinblastine 5.44 ± 1.36 5.72 ± 1.60 5.64 ± 1.04 2.80 ± 1.26 5.44 ± 1.62 Vincristine 11.35 ± 3.11 11.17 ± 2.91 8.89 ± 2.40 3.76 ± 1.15 11.18 ± 2.82 IC50, half maximal inhibitory concentration; MRP1/ABCC1, multidrug resistance-associated protein 1; WT, wild-type.
X
ABCC1 p.Arg1058Gln 19214144:161:184
status: NEW163 Table 5 Resistance factors of transfected CHO-K1 cells to chemotherapeutic agents Resistance factorsa Drugs WT MRP1/ABCC1 Cys43Ser (128G > C) Thr73lle (218C > T) Arg723Gln (2168G > A) Arg1058Gln (3173G > A) Cisplatin 0.94 ± 0.05 0.98 ± 0.12 0.89 ± 0.04 0.99 ± 0.09 0.89 ± 1.10 Paclitaxel 0.94 ± 0.11 0.88 ± 0.10 0.96 ± 0.05 1.00 ± 0.07 0.96 ± 0.06 Daunorubicin 12.97 ± 2.76 13.09 ± 2.68 13.07 ± 2.81 2.96 ± 0.58 4.81 ± 1.01 Doxorubicin 15.44 ± 1.37 15.84 ± 0.91 15.44 ± 1.95 6.46 ± 0.90 7.22 ± 0.86 Etoposide 16.57 ± 1.91 16.44 ± 1.95 4.84 ± 0.51 3.56 ± 0.36 4.77 ± 0.56 Methotrexate 3.78 ± 1.07 3.70 ± 1.01 3.60 ± 1.39 3.75 ± 1.08 1.67 ± 0.53 Vinblastine 10.35 ± 1.61 10.32 ± 1.70 10.27 ± 1.66 5.73 ± 0.87 8.50 ± 1.32 Vincristine 6.93 ± 1.13 6.78 ± 1.18 6.79 ± 1.04 2.27 ± 0.34 6.85 ± 1.14 IC50, half maximal inhibitory concentration; MRP1/ABCC1, multidrug resistance-associated protein 1; WT, wild-type.
X
ABCC1 p.Arg1058Gln 19214144:163:184
status: NEW165 214 The four SNPs (Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln) studied here are located in various domains of human MRP1/ABCC1.
X
ABCC1 p.Arg1058Gln 19214144:165:55
status: NEW171 Nonetheless, their drug-resistance profiles were rather different: Arg1058Gln mutation decreased resistance to several anticancer drugs, whereas Cys43Ser mutation did not significantly affect resistance to any drugs tested.
X
ABCC1 p.Arg1058Gln 19214144:171:67
status: NEW175 The Arg1058Gln mutation can increase the response of two anthracyclines and etoposides in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells.
X
ABCC1 p.Arg1058Gln 19214144:175:4
status: NEW
PMID: 21143116
[PubMed]
He SM et al: "Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1)."
No.
Sentence
Comment
816
There are at least 15 naturally occurring mutations identified in MRP1/ABCC1, including Cys43Ser in TM1, Thr73Ile in CL1, Ser92Phe in TM2, Arg230Asn in L0, Val353Met at TM6/TM7 interface, Arg433Ser in TM8, Gly671Val in TM11, Arg723Gln located between the Walker A and Walker B motifs of NBD1, Ala861Thr at NBD1/TM12 interface, Ala989Thr in TM12, Cys1047Ser in TM13, Arg1058Gln in CL7, Val1146Ile in CL7, Thr1337Ala between the Walker A and Walker B motifs of NBD2, and Thr1401Met, and many of them have been found to affect its transport activity [171, 362, 363, 366, 367, 377-384].
X
ABCC1 p.Arg1058Gln 21143116:816:366
status: NEW820 When Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln were separately transfected in CHO-K1 or HEK293 cells, the cells displayed altered resistance profiles to a panel of anticancer drugs compared to the wild-type [366].
X
ABCC1 p.Arg1058Gln 21143116:820:40
status: NEW823 The Arg1058Gln mutant showed a significant decrease in resistance to anthracyclines and etoposide in HEK293 cells [366].
X
ABCC1 p.Arg1058Gln 21143116:823:4
status: NEW824 In CHO-K1 cells, the Arg1058Gln mutant conferred a lower resistance to vinblastine, anthracyclines, etoposide and MTX.
X
ABCC1 p.Arg1058Gln 21143116:824:21
status: NEW
PMID: 21182225
[PubMed]
Zhao J et al: "Promoter polymorphism of MRP1 associated with reduced survival in hepatocellular carcinoma."
No.
Sentence
Comment
46
G1299T (Arg433Ser) confers resistance to doxorubicin by reducing intracellular drug accumulation in HeLa cells that stably express mutant MRP1, whereas the G3173A (Arg1058Gln) variation increases the response to etoposide in HEK293 and CHO-K1 cells[12,13] .
X
ABCC1 p.Arg1058Gln 21182225:46:164
status: NEW
PMID: 20103563
[PubMed]
Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."
No.
Sentence
Comment
7118
Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined.
X
ABCC1 p.Arg1058Gln 20103563:7118:447
status: NEW7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1 Intracellular C218T T73I 1 Normal C257T S92F 2 Normal C350T T117M 2 Normal G689A R230Q Normal G1057A V353M N.D. N.D. G1299T R433S 2 Normal G1898A R633Q 2 Normal G2012T G671V Normal G2168A R723Q 2 Normal G2965A A989T 2 Normal G3140C C1047S 1 Normal G3173A R1058Q Normal C4535T S1512L Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R Normal C4141A R1381S Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2 Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E Normal G912T K304N Normal C1067T T356M N.D. N.D. C1208T P403L 2 Normal G1460A G487E 2 Normal A1492G K498E Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1 Normal G3211A V1071I Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; , no change in function; N.D. not determined.
X
ABCC1 p.Arg1058Gln 20103563:7115:437
status: NEW
No.
Sentence
Comment
134
Letourneau et al. (2005) studied the influence of 10 DOI: 10.3109/03602532.2014.901348 ABCC1 and cancer therapy and prognosis non-synonymous SNPs - Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Arg723Gln (G2168A, rs4148356), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450) and Ser1512Leu (C4535T, rs369410659) - on ABCC1 expression using membrane vesicles isolated from transfected cells and assessed transport activity for three known ABCC1 substrates.
X
ABCC1 p.Arg1058Gln 24670052:134:441
status: NEW159 NCBI ID Reference Amino acid exchange Nucleotide exchange Location Function MAFa rs41395947 Cys43Ser G128C Exon 2 Non-synonymous Unknown rs41494447 Thr73Ile C218T Exon 2 Non-synonymous T &#bc; 0.003 rs8187844 Ser92Phe C257T Exon 3 Non-synonymous T &#bc; 0.004 rs8187848 Arg230Gln G689A Exon 7 Non-synonymous A &#bc; 0.009 rs2230669 Pro272Pro G816A Exon 8 Synonymous A &#bc; 0.037 rs246221 Val275Val T825C Exon 8 Synonymous C &#bc; 0.301 rs35592 non-coding T-176C Intron 9 Non-coding C &#bc; 0.257 rs60782127 Arg433Ser G1299T Exon 10 Non-synonymous T &#bc; 0.004 rs35605 Leu562Leu T1684C Exon 13 Synonymous T &#bc; 0.173 rs112282109 Arg633Gln G1898A Exon 14 Non-synonymous A &#bc; 0.004 rs45511401 Gly671Val G2012T Exon 16 Non-synonymous T &#bc; 0.050 rs4148356 Arg723Gln G2168A Exon17 Non-synonymous A &#bc; 0.027 rs35529209 Ala989Thr G2965A Exon 22 Non-synonymous Unknown rs13337489 Cys1047Ser G3140C Exon 23 Non-synonymous C &#bc; 0.000 rs41410450 Arg1058Gln G3173A Exon 23 Non-synonymous Unknown rs2238476 non-coding G-1960A Intron 23 Non-coding T &#bc; 0.062 rs2230671 Ser1334Ser G4002A Exon 28 Synonymous T &#bc; 0.208 rs28364006 Thr1337Ala A4009G Exon 28 Non-synonymous Unknown rs369410659 Ser1512Leu C4535T Exon 31 Non-synonymous Unknown a Minor allele frequencies for Caucasinans in dbSNP based on HapMap-CEU population or 1000 genomes.
X
ABCC1 p.Arg1058Gln 24670052:159:950
status: NEW
PMID: 25078270
[PubMed]
Kunicka T et al: "Non-coding polymorphisms in nucleotide binding domain 1 in ABCC1 gene associate with transcript level and survival of patients with breast cancer."
No.
Sentence
Comment
215
Ten other non-synonymous SNPs leading to amino acid substitutions (Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450), and Ser1512Leu (C4535T, rs369410659)) followed earlier had no effect on ABCC1 expression either, indicating that single amino acid substitutions may not necessarily influence the activity of the final protein [44].
X
ABCC1 p.Arg1058Gln 25078270:215:327
status: NEW