ABCMdb

ABCC1 p.Cys43Ser

None has been submitted yet.

Publications

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

830 A thorough investigation on the functional significance of 10 non-synonymous SNP, leading to amino acid changes C43S, T73I, S92F, T117; R230Q, R633Q, R723Q, A989T, C1047S. Login to comment
852 Table 5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to Le Saux et al., 2000; Ito et al., 2001; Moriya et al., 2002; Conrad et al., 2002; Oselin et al., 2003b; Wang et al., 2004) Position/ Nucleotide Aminoacid or effect Orientals Caucasians Function 128G>C C43S 0.01 - elevateda 218C>T T73I 0.00-0.04 - 257C>T S92F 0.00 0.00 decreaseda 350C>T T117M - 0.02 (decreased)a 689G>A R230N 0.00 0.00 (decreased)a 816G>A synonymous - 0.04 825T>C synonymous - 0.30 1057G>A V353M 0.00 0.005 elevateda 1299G>T R433S - 0.01 elevated Vmax of doxorubicin, decreased transport of LTC4 a,b 1684T>C synonymous - 0.80 1898G>A R633Q - 0.01 (decreased)a 2012G>T G671V - 0.03 doxorubicine-induced cardiomyopathyc 2168G>A R723Q 0.01-0.07 - decreaseda 2965G>A A989T 0.00 0.005 (decreased)a 3140G>C C1047S 0.00 0.00 3173G>A R1058Q 0.01 - 4002G>A synonymous - 0.28 4535C>T S1512L - 0.03 decreaseda a Letourneau et al. (2005). Login to comment

PMID: 17323126 [PubMed] Huang Y et al: "Pharmacogenetics/genomics of membrane transporters in cancer chemotherapy."

No. Sentence Comment

124 Moreover, Letourneau et al. examined 10 non-synonymous ABCC1 SNPs to determine Table 2 Summary of genetic variants in ABC transporters ABCB1, ABCC1, ABCC2 and ABCG2 involved in cancer chemotherapy Variants (location, effect) Phenotype Drug Sample Reference ABCB1 +103T>C (5'flanking, non-coding) Increased transcription Doxorubicin vincristine osteosarcoma Stein et al., 1994 [19] +8T>C (5'flanking, non-coding) Unknown Leukemia Rund et al., 1999 [21] 1236C>T (exon12, synonymous) Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Higher exposure Irinotecan, SN-38 Cancer patients Mathijssen et al., 2003 [45] 2677G>T/A (exon21, A893S/T) Lower expression placenta Tanabe et al., 2001 [42] Lower expression placenta Hitzl et al., 2004 [37] Higher expression AML blasts Illmer et al., 2002 [47] Allele specific expression Cell lines, lymphoma Mickley et al., 1998 [22] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Survival leukemia Illmer et al., 2002 [47] Survival leukemia van den Heuvel-Eibrink et al., 2001 [48] Worse survival AML blasts Kim et al., 2006 [10] Higher efficacy Paclitaxel Ovarian cancer Green et al., 2006 [50] 2995G>A (exon24, A999T) None Cell lines, lymphoma Mickley et al., 1998 [22] 3435C>T (exon26, synonymous) Lower expression Duodenal protein Hoffmeyer et al., 2000 [26] Lower expression placenta Hitzl et al., 2004 [37] Higher expression Intestine mRNA Nakamura et al., 2002 [32] Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Lower efflux Digoxin CD56+ NK cells Hitzl et al., 2001 [27] Higher plasma level Digoxin Healthy volunteers Hoffmeyer et al., 2000 [26] Higher AUC Cyclosporin transplant patients Bonhomme-Faivre et al., 2004 [36] Lower CNS relapse Cancer patients Stanulla et al., 2005 [46] Better survival leukemia Illmer et al., 2002 [47] Higher efficacy Breast cancer Kafka et al., 2003 [49] Higher activity, worse survival AML Kim et al., 2006 [10] Better survival Platinums Esophageal cancer Wu et al., 2006 [43] No difference Docetaxel patients Puisset et al., 2004 [41] No difference Irinotecan Cancer patients Mathijssen et al., 2004 [39] No difference Vincristine patients Plasschaert et al., 2004 [40] No difference colon Taniguchi et al., 2003 [24] ABCC1 -260G>C (5'flanking, non-coding) Higher activity Transfected cell line Wang et al., 2005 [62] Table 2 (Continued) Variants (location, effect) Phenotype Drug Sample Reference 128G>C (exon2, C43S) Reduced resistance Vincristine, arsenite Transfected cell line Leslie et al., 2003 [60] 1299G>T (exon10, R433S) Reduced transport of LTC4, increased resistance to doxorubicin Leukotriene C4, doxorubicin Transfected cell line Conrad et al., 2002 [59] 2012G>T (exon16, G671V) No change in activityLeukotriene C4 Transfected cell line Conrad et al., 2001 [58] Heart toxicity Doxorubicin nLon-Hodgkin lymphoma Wojnowski et al., 2005 [63] 2965G>A (exon22, A989T) Reduced transport Estradiol 17β-glucuronide Transfected cell line Letourneau et al., 2005 [61] ABCC2 1271A>G (exon10, R421G) Reduced drug elimination, increased nephrotoxicity Methotrexate One lymphoma patient Hulot et al., 2005 [79] 3972C>T (exon28, nonsynonymous) Reduced drug clearance Irinotecan Cancer patients Innocenti et al., 2004 [80] ABCG2 376C>T (exon4, Q126stop) Reduced transport Porphyrin Trensfected cell Tamura et al., 2006 [104] 421C>A (exon5, Q141K) Lower expression Transfected cell lines Imai et al., 2002 [94] Lower expression Transfected cell lines Kondo et al., 2004 [95] Lower expression Placenta Kobayashi et al., 2005 [98] Reduced ATPase activity Trensfected cell lines Mizuarai et al., 2004 [97] Higher plasma levels Diflomotecan patients Sparreboom et al., 2004 [100] Increased bioavailability Topotecan patients Sparreboom et al., 2005 [101] Increased bioavailability 9-Aminocamptothecin patients Zamboni et al., 2006 [81] Increased drug accumulation Imatinib Transfected cell lines Gardner et al., 2006 [96] Increased drug accumulation Topotecan Trensfected cell lines Imai et al., 2002 [94] No difference Imatinib patients Gardner et al., 2006 [96] No difference intestine Zamber et al., 2003 [99] No difference MTX Trensfected cell lines Kondo et al., 2004 [95] the effects on expression and function of this transporter in transfected HEK293T cells [61]. Login to comment
123 An exon 2 mutation 128G>C, which results in a Cys43Ser substitution impaired the plasma membrane localization of ABCC1 protein and reduced the cellular resistance to vincristine and arsenite from that for wild-type ABCC1 [60]. Login to comment

PMID: 18154452 [PubMed] Sharom FJ et al: "ABC multidrug transporters: structure, function and role in chemoresistance."

No. Sentence Comment

352 The nonsynonymous change G128C (C43S) impaired the plasma membrane localization of the protein, and also decreased resistance to doxorubicin and sodium arsenite [168]. Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

75 Another naturally occurring ABCC1 polymorphism that has been investigated in vitro is Cys43Ser. Login to comment
81 MRP1 (ABCC1) NH2 NBD NBD in out Membrane Cys43Ser Ser92Phe Thr117Met Arg230Gln Val353Met Arg633Gln Gly671Val Arg723Gln Arg433Ser Ala989Thr Cys1047Ser Val1146Ile Arg1058Gln Thr1401Met Ser1512Leu Thr73Ile COOH NBD NBD COOH NBD COOH NBD NBD Table1MRP1(ABCC1)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 128G>CCys43SerExon2--1[1]-Decreaseinvincristineresistance[2]rs41395947 Disruptedplasmamembranetraffickingin transfectedcells[2] 218C>TThr73IleExon2--1[1]3.7Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] rs41494447 257C>TSer92PheExon30a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 350C>TThr117MetExon3-100[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] 689G>AArg230GlnExon70a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 1057G>AVal353MetExon90a 0.5a 0a -- 1299G>TArg433SerExon10-1.4[6]--Changesintransportandresistance[7] 1898G>AArg633GlnExon13-[8]--Noinfluenceonexpressionandtransportin membranevesicles[4] 2012G>TGly671ValExon16-2.8[6]--Noinfluenceonexpressionandtransportin membranevesicles[6] Associatedwithanthracycline-induced cardiotoxicity[9] 2168G>AArg723GlnExon17--7.3[1]5.6Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4]noinfluenceonmRNA expressioninenterocytes(n=1)[10] rs4148356 2965G>AAla989ThrExon220a 0.5a 0a -Noinfluenceonexpressionandtransportin membranevesicles(non-significantreduction inE17βGtransport)[4] 323 3140G>CCys1047SerExon234.5a 0a 0a -Noinfluenceonexpressionandtransportin membranevesicles[4] rs13337489 3173G>AArg1058GlnExon23--1[1]-Noinfluenceonexpressionandtransportin membranevesicles[4] rs41410450 3436G>AVal1146IleExon24-----rs28706727 4102C>TThr1401MetExon29-----rs8057331 4535C>TSer1512LeuExon31-[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

PMID: 19200005 [PubMed] Porcelli L et al: "Intracellular trafficking of MDR transporters and relevance of SNPs."

No. Sentence Comment

149 Polymorphisms and Mutations Affecting the Cellular Localization of MDR Transporters Transporter Variant Amino-acid Change Localization References Intracellular + plasma membrane [99] C421A Q141K Plasma membrane [97, 98, 101] Intracellular + plasma membrane [98, 101] G34A V12M Plasma membrane [97, 99] ABCG2 G1322A S441N Intracellular [97, 98] ABCC1 G128C C43S Intracellular + plasma membrane [116] 4175-4180del RM1392-1393del Intracellular (ER) [118] C2302T R768W Intracellular (ER) [119] A3517T I1173F Intracellular (ER) [120, 121] C2366T S789F Intracellular + plasma membrane [122] ABCC2 G4348A A1459T Intracellular + plasma membrane [122] 293 transfected cells. Login to comment
241 In particular, the cell lines expressing the variants Cys43Ser-ABCC1, Cys 265Ala-ABCC1 and Cys265Ser-ABCC1 exhibited severely disrupted plasma membrane trafficking [116]. Login to comment
242 Of note, the Cys43Ser variant, resulting from a single nucleotide change at position 128 (G128C), has an allele frequency of 0.01 in a Japanese population [117]. Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

134 A thorough investigation on the functional significance of ten nonsynonymous SNPs, leading to amino acid changes C43S, T73I, S92F, T117; R230Q, R633Q, R723Q, A989T, C1047S. Login to comment
155 ABCC2 (Multidrug Resistance-Associated Protein 2) Table 6.5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to (33, 77-80, 136)) Position Amino acid or effect Orientals Caucasians Function c.128G>C C43S 0.01 - Elevateda c. 218C>T T73I 0.00-0.04 - c. 257C>T S92F 0.00 0.00 Decreaseda c. 350C>T T117M - 0.02 (Decreased)a c. 689G>A R230N 0.00 0.00 (Decreased)a c. 816G>A Synonymous - 0.04 c. 825T>C Synonymous - 0.30 c. 1057G>A V353M 0.00 0.005 Elevateda c. 1299G>T R433S - 0.01 Elevated vmax of doxorubicin, decreased transport of LTC4 a,b c. 1684T>C Synonymous - 0.80 c. 1898G>A R633Q - 0.01 (Decreased)a c. 2012G>T G671V - 0.03 Doxorubicine-induced cardiomyopathyc c. 2168G>A R723Q 0.01-0.07 - Decreaseda c. 2965G>A A989T 0.00 0.005 (Decreased)a c. 3140G>C C1047S 0.00 0.00 c. 3173G>A R1058Q 0.01 - c. 4002G>A Synonymous - 0.28 c. 4535C>T S1512L - 0.03 Decreaseda References: a [81], b [77], c [84] an inducible expression of ABCC2, which contributes also to the phenomenon of drug resistance. Login to comment

PMID: 19950006 [PubMed] Sissung TM et al: "Pharmacogenetics of membrane transporters: an update on current approaches."

No. Sentence Comment

67 Those studied include C43S, T73I, S92F, T117M, R230Q, V353M, R433S, R633Q, G671V, R723Q, A989T, C1047S, R1058Q, A1337T, and S1512L. Login to comment
69 However, it has been noted that C43S, R433S, and A989T result in decreased ABCB1 function [43]. Login to comment

PMID: 11266082 [PubMed] Ito S et al: "Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects."

No. Sentence Comment

32 Four of the 16 mutations were associated with an amino acid substitution; G to C transversion at position 128 (G128C, Cys to Ser at codon 43) in exon 2, C to T at 218 (C218T, Thr to Ile at 73) in exon 2, G to A at 2168 (G2168A, Arg to Gln at 723) in exon 17 and G to A at 3173 (G3173A, Arg to Gln at 1058) in exon 23 (position numbering from Grant et al., 1997) (Fig. 2). Login to comment
63 In the MRP1 gene, we identi®ed four missense mutations, G128C (Cys43Ser), C218T (Thr73Ile), G2168A (Arg723Gln) and G3173A (Arg1058Gln). Login to comment
67 Frequencies of mutations in the MRP1 gene in a Japanese population (n 48) Primer pair Location Nucleic acid Nucleotide sequence Amino acid Genotype Allele frequency substitutiona substitution Wild-type Mutation w/w w/m m/m w m MR12/1 Exon 2 G128C gccttGttttt gccttCttttt Cys43Ser 47 1 0 0.990 0.010 MR12/1 Exon 2 C218T caaaaCcaaaa caaaaTcaaaa Thr73Ile 47 1 0 0.990 0.010 MR18/1 Exon 8 T825C aaggtTgtgta aaggtCgtgta Val275Val 18 24 6 0.625 0.375 MR19/1 Exon 9 T1062C gtgaaTgacac gtgaaCgacac Asn354Asn 17 28 3 0.646 0.354 MR113/1 Exon 13 T1684C tggccTtgtgc tggccCtgtgc Leu562Leu 31 15 2 0.802 0.198 MR116/1 Exon 16 C2007T atcccCgaagg atcccTgaagg Pro669Pro 40 8 0 0.917 0.083 MR117/1 Exon 17 G2168A tctccGagaaa tctccAagaaa Arg723Gln 41 7 0 0.927 0.073 MR120/1 Exon 20 C2665T gcggtCcaggg gcggtTcaggg Pro889Pro 47 1 0 0.990 0.010 MR120/1 Exon 20 T2694C gagaaTggcat gagaaCggcat Asn898Asn 47 1 0 0.990 0.010 MR123/1 Exon 23 G3173A cctgcGgtcac cctgcAgtcac Arg1058Gln 47 1 0 0.990 0.010 MR128/1 Exon 28 G4002A aagtcGtccct aagtcAtccct Ser1334Ser 36 9 3 0.844 0.156 MR131/1 Exon 31 C4524T gagtaCggcgc gagtaTggcgc Tyr1508Tyr 47 1 0 0.990 0.010 MR19/1 Intron 9 A12188G aggggAcgctg aggggGcgctg ± 17 28 3 0.646 0.354 MR112/1 Intron 11 C1474À48T atgggCtgatc atgggTtgatc ± 44 3 1 0.948 0.052 MR119/1 Intron 18 C2461À30G gcactCacgtg gcactGacgtg ± 27 14 7 0.708 0.292 MR119/1 Intron 18 T2461À38C acacaTgtgca acacaCgtgca ± 41 7 0 0.927 0.073 The positions of the identi®ed polymorphisms correspond to positions of the MRP1 gene (Grant et al., 1997; EMBL/GenBank accession no. Login to comment

PMID: 12731862 [PubMed] Leslie EM et al: "Functional and structural consequences of cysteine substitutions in the NH2 proximal region of the human multidrug resistance protein 1 (MRP1/ABCC1)."

No. Sentence Comment

7 All Cys mutants transported organic anions (0.5-1.5-fold wild-type MRP1 activity), and cells expressing Ser-substituted but not Ala-substituted Cys43 and Cys265 MRP1 mutants exhibited a 2.5-fold decrease and a 3-fold increase in arsenite resistance, respectively; Cys43Ser MRP1 also conferred lower levels of vincristine resistance. Login to comment
54 Mutagenesis was performed according to the manufacturer`s instructions with the following sense mutagenic primers (substituted nucleotides are underlined and introduced or lost restriction sites are in italics) as follows: Cys43Ala (5'-G TGG GTG CCT GCT TTT TAC CTC TGG GCC-3'), Cys43Ser (5'-G TGG GTG CCT TCT TTT TAC CTC-3'), Cys49Ala (5'-C CTC TGG GCC GCA TTC CCC TTC TAC-3') (BsmI), Cys49Ser (5'-C CTC TGG GCC TCT TTC CCC TTC-3'), Cys85Ala (5'-G TGG ATC GTC GCG TGG GCA GAC C-3') (BstUI), Cys85Ser (5'-G TGG ATC GTC AGC TGG GCA GAC C-3'), Cys148Ala (5'-GTA GCC CTA GTG GCT GCC CTA GCC-3') (BglI), Cys148Ser (5'-GTA GCC CTA GTG TCT GCC CTA GCC-3'), Cys190Ala (5'-C GTC TTG TCC GCA TTC TCA GAT CGC-3') (BsmI), Cys190Ser (5'-C GTC TTG TCC TCT TTC TCA GAT CG-3'), Cys208Ala (5'-C CCT AAT CCC GCG CCA GAG TCC AG-3') (BstUI), Cys208Ser (5'-C CCT AAT CCC AGC CCA GAG TCC-3'), Cys265Ala (5'-GTA AAG AAC TGG AAG AAG GAA GCC GCG AAG ACT AGG AAG CAG-3') (BpiI), and Cys265Ser (5'- GG AAG AAG GAA TCC GCC AAG ACT AG-3') (BsmI). Login to comment
109 Thus, the cell lines expressing the TM1 mutant Cys43Ser-MRP1 (Figure 3D) and the CL3 mutants Cys265Ala-MRP1 (Figure 3O) and Cys265Ser-MRP1 (Figure 3P) exhibited severely disrupted plasma membrane trafficking. Login to comment
111 Three of the mutant cell lines with impaired plasma membrane trafficking of MRP1 exhibited filament-like staining (Cys43Ala, Cys43Ser, and Cys49Ser) (Figure 3C,D,F) while the cell lines expressing Cys265Ala and Cys265Ser MRP1 showed a stippled-like staining pattern. Login to comment
124 The tryptic digest patterns of Cys43Ser and Cys85Ala-MRP1 were almost indistinguishable from that of WT-MRP1, with the appearance of the N1 fragment and faint N2 bands at trypsin:protein ratios of 1:10 000 and 1:1000, respectively. The tryptic digest patterns for vesicles prepared from mutants FIGURE 2: Expression levels of wild-type and Cys-substituted MRP1 in stably transfected HeLa cells. Login to comment
130 Table 1: Detection of Tryptic Fragments N1 and N2 of MRP1 in Membranes Prepared from HeLa Cells Stably Expressing CysfAla and CysfSer MRP1 Mutantsa trypsin:protein ratio (w:w)transfected HeLa cell line N1 detected N2 detected WT-MRP1 1:10 000 1:1000 C43A-MRP1 1:100 1:100 C43S-MRP1 1:10 000 1:1000 C49A-MRP1 1:250 1:100 C49S-MRP1 1:10 000 1:500 C85A-MRP1 1:10 000 1:1000 C85S-MRP1 1:1000 1:250 C148A-MRP1 1:250 1:250 C148S-MRP1 1:1000 1:500 C190A-MRP1 1:1000 1:1000 C190S-MRP1 1:1000 1:250 C208A-MRP1 1:10 000 1:250 C208S-MRP1 1:10 000 1:500 C265A-MRP1 1:250 1:10 C265S-MRP1 1:1000 1:250 a The data shown represent a summary of the limited trypsin digests shown in Figures 4 and 5. Login to comment
156 Consistent with their Ala-substituted counterparts, Cys49Ser-MRP1, Cys148Ser- MRP1, and Cys265Ser-MRP1 showed moderately reduced E217 G uptake (34-50%) while uptake by Cys43Ser-MRP1 was increased by 40% relative to WT-MRP1. Login to comment
160 Thus, membrane vesicles prepared from the Cys43Ser-MRP1 transfected cell line showed a 40% increase in GSH uptake whereas Cys208Ser-MRP1 vesicles showed a 50% decrease in GSH uptake relative to WT-MRP1. Login to comment
173 Consequently, we examined the resistance of cells expressing mutant MRP1 molecules harboring substitutions of Cys residues in MSD1 (Cys43Ala, Cys43Ser, Cys49Ala, Cys49Ser, Cys190Ala, and Cys190Ser) andCL3(Cys208Ala,Cys208Ser,Cys265Ala,andCys265Ser), to sodium arsenite and potassium antimony tartrate. Login to comment
177 Thus, the arsenite resistance of cells expressing the TM1 Cys43Ser mutant was 2.5-fold lower than the cell line expressing WT-MRP1 whereas cells expressing Cys265Ser MRP1 were approximately 3-fold more resistant to this heavy metal oxyanion (Table 2). Login to comment
178 Representative chemosensitivity assays illustrating the sodium arsenite resistance of cell lines expressing the Cys43Ser and Cys265Ser MRP1 mutants are shown in Figure 7. Login to comment
179 The HeLa cell lines expressing Cys43Ser-MRP1 and Cys265Ser-MRP1 that showed changes in arsenite resistance were also tested for their sensitivity to the anticancer drugs vincristine and doxorubicin. Login to comment
181 The Cys43Ala, Cys43Ser, Cys265Ala, and Cys265Ser MRP1 mutant expressing cell lines were 6.5-, 2.6-, 7.1-, and 5.1-fold resistant to doxorubicin, respectively, levels of resistance that did not differ significantly from the ~5-fold resistance observed with cells expressing WT-MRP1 (Figure 8A). Login to comment
182 In contrast, the cell line expressing Cys43Ser-MRP1 was only 5-fold resistant to vincristine while the cell lines expressing Cys43Ala, Cys265Ala, and Cys265Ser-MRP1 were 21-, 19-, and 13-fold resistant, respectively, levels of resistance comparable to those observed in cells expressing WT-MRP1 (15-fold resistant) (Figure 8B). Login to comment
192 Table 2: Sensitivity of Stably Transfected HeLa Cells Expressing Wild-Type and Cys-Substituted MRP1 to Sodium Arsenite and Potassium Antimony Tartrate relative resistancea transfected HeLa cell line Na+ arsenite K+ antimony tartrate WT-MRP1 3.6 ( 1.3 (1) (n ) 6) 2.0 ( 0.5 (1) (n ) 7) C43A-MRP1 4.3 ( 0.7 (1.2) (n ) 3) 2.0 ( 0.4 (1) (n ) 3) C43S-MRP1 1.4 ( 0.5 (0.4)b (n ) 6) 2.8 ( 1.1 (1.4) (n ) 4) C49A-MRP1 4.0 ( 1.6 (1.1) (n ) 5) 2.6 ( 0.7 (1.3) (n ) 4) C49S-MRP1 3.0 ( 1.5 (0.8) (n ) 4) 3.0 ( 0.6 (1.5) (n ) 4) C190A-MRP1 3.8 ( 0.4 (1) (n ) 4) 4.0 ( 1.2 (2) (n ) 3) C190S-MRP1 2.9 ( 0.4 (0.8) (n ) 4) 2.7 ( 0.4 (1.4) (n ) 3) C208A-MRP1 3.0 ( 0.6 (0.8) (n ) 3) 2.4 ( 0.6 (1.2) (n ) 3) C208S-MRP1 4.2 ( 0.8 (1.2) (n ) 3) 3.8 ( 0.7 (1.9) (n ) 3) C265A-MRP1 2.5 ( 0.2 (0.7) (n ) 4) 2.3 ( 0.6 (0.9) (n ) 3) C265S-MRP1 10.2 ( 0.4 (2.8)b (n ) 5) 4.0 ( 1.7 (2) (n ) 3) a The resistance of stably transfected HeLa cells was determined using a tetrazolium-based cytotoxicity assay. The relative resistance factors were obtained by dividing the IC50 values for wild-type or Cys mutant MRP1 transfected cells by the IC50 values for empty vector control transfected cells and were normalized for differences in MRP1 expression levels. Login to comment
197 In addition, several Cys mutants did not appear fully routed to the plasma membrane, with the most severely disrupted pattern of subcellular localization being observed with the TM1 mutant Cys43Ser and the CL3 mutants Cys265Ala and Cys265Ser. Login to comment
199 The disrupted membrane trafficking of the Cys43Ser MRP1 mutant is of particular interest since a single nucleotide polymorphism resulting in this amino acid substitution has recently been reported in a Japanese population (29). Login to comment
207 In fact, one of the mutants that showed extensive intracellular staining, Cys43Ser-MRP1, had LTC4 and E217 G transport activity that was greater than or equal to that of WT-MRP1. Login to comment
210 All Cys-substituted proteins were present to a certain extent in the plasma membrane of the FIGURE 7: Resistance of HeLa cells expressing Cys43Ser and Cys265Ser mutant MRP1 to sodium arsenite. Login to comment
213 Data are not normalized for MRP1 expression; however, Cys265Ser-MRP1 and Cys43Ser-MRP1 were expressed at levels comparable to, and 1.5-fold higher than, WT-MRP1, respectively. Login to comment
214 Consequently, normalization of the data would not affect the relative resistance of Cys265Ser-MRP1 and would only further emphasize the decreased arsenite resistance of Cys43Ser-MRP1. Login to comment
237 In addition to their limited effects on organic anion transport function, the mutation of Cys residues in MSD1 and CL3 Cys had no effect on the ability of MRP1 to confer resistance to heavy metal-centered oxyanions with just two exceptions (Cys43Ser-MRP1 and Cys265Ser-MRP1). Login to comment
238 Similarly, vincristine resistance was decreased only in the Cys43Ser-MRP1 mutant. Login to comment
247 In addition, as noted above, Cys43Ser-MRP1 was not completely routed to the plasma membrane, and although this had no significant effect on organic anion transport, it might still contribute to changes in arsenite and vincristine resistance since previous studies have shown that these properties of MRP1 are not inextricably linked to each other (31). Login to comment
248 Finally, the reduced ability of Cys43Ser-MRP1 to confer resistance to arsenite and vincristine is of potential clinical relevance because as mentioned previously, Ito et al. (29) have reported the occurrence of a naturally occurring Cys43Ser polymorphism in healthy Japanese subjects. Login to comment

PMID: 14965249 [PubMed] Haimeur A et al: "The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation."

No. Sentence Comment

292 In the case of the G128C MRP1 polymorphism in exon 2, the resulting amino acid substitution (Cys43Ser) disrupted plasma membrane trafficking and reduced doxorubicin, vincristine and arsenite resistance of HeLa cells expressing this MRP1 mutant while conjugated organic anion transport activity remained comparable to wild-type MRP1 [126, 216]. Login to comment

PMID: 16006996 [PubMed] Conseil G et al: "Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters."

No. Sentence Comment

146 Resistance of transfected HeLa cells expressing the MRP1-Cys43Ser mutant to doxorubicin and sodium arsenite was also diminished. Login to comment
148 Fig. 3 Exon 1 2 3 MSDMSD NBD1 MSD NBD2 C4535T(S1512L) G3173A (R1058Q) G3140C (C1047S) G2965A (A989T) G2168A (R723Q) G2012T(G671V) G1898A (R633Q) G1299T(R433S) G1057A (V353M) G689A (R230Q) C350T(T117M) C257T(S92F) C218T(T73I) C128C (C43S) (TM1-5) (TM6-11) (TM12-17) 4 5 6 7 8 9101112 1314 151617 1819 20 21 22 23 242526272829 30 31 Location of non-synonymous SNPs in the coding regions of the genes in the MRP1/ABCC1 gene. Login to comment
152 Fig. 4 Wild-type MRP1 MRP1-Cys43Ser Confocal micrographs of transfected HeLa cells expressing recombinant Cys43Ser mutant and wild-type MRP1 proteins. Login to comment
153 Recombinant wild-type MRP1 (left panel) and mutant MRP1-Cys43Ser (right panel) proteins expressed in stably transfected HeLa cells were detected with human MRP1-specific murine monoclonal antibody QCRL-3 and visualized with Alexa488-tagged secondary antibody (green); nuclei are stained with propidium iodide (red). Login to comment
154 Note the extensive amount of the MRP1-Cys43Ser mutant that has not localized properly to the plasma membrane [44]. Login to comment

PMID: 16041243 [PubMed] Letourneau IJ et al: "Functional characterization of non-synonymous single nucleotide polymorphisms in the gene encoding human multidrug resistance protein 1 (MRP1/ABCC1)."

No. Sentence Comment

28 Of these mutations, the Fig. 1 128G >C (C43S) 128G >T(T73I) 689G >A (R230Q)1057G >A (V353M) 1299G >T(R433S) 1898G >A (R633Q) 2012G >T(G671V) 2168G >A (R723Q) 3173G >A (R1058Q) 4535C >T(S1512L) 3140G >C (C1047S) 2965G >A (A989T) 350C >T(T117M) 257C >T(S92F) 313029282726252423222120181716151413121110987654321 19 MSD1 MSD1 MSD2 MSD3 MSD2 NBD1 MSD3 NBD2 TM 1 2 3 4 5 6 7 8 Val353Met Ala989Thr Cys1047Ser Arg1058Gln NBD2NBD1 Ser1512Leu Arg633Gln Arg433Ser Arg723Gln Thr73lle Thr117Met Arg230Gln Cys43Ser Ser92Phe Gly671Val 9 10 11 12 13 14 15 16 17 (a) (b) Location of reported non-synonymous single nucleotide polymorphisms (SNPs) in MRP1/ABCC1. Login to comment
33 Thus, the Cys43Ser (128G > C) mutation located in TM1 disrupted trafficking of MRP1 to the plasma membrane of HeLa cells and cells expressing the Cys43Ser MRP1 mutant demonstrated a lower level of resistance to vincristine and arsenite than wild-type MRP1. Login to comment
46 The template for generating Table 1 Frequencies of non-synonymous single nucleotide polymorphisms in MRP1/ABCC1 Variant Amino acid substitution Allelic frequency Population References 128G > C Cys43Ser 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 218C > T Thr73Ile 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 3.7% (2/54) Chinese [37] 257C > T Ser92Phe 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 350C > T Thr117Met 1.6% (1/64) Caucasian [28] 689G > A Arg230Gln 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1057G > A Val353Met 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1299G > T Arg433Ser 1.4% (1/72) Caucasian [20] 0% (0/110) Caucasian [19] 1898G > A Arg633Gln 0.8% (2/234) Caucasian [29] 2012G > T Gly671Val 2.8% (2/72) Caucasian [20] 2.6% (6/234) Caucasian [29] 2168G > A Arg723Gln 3.8% (1/26) Japanese [16] 1% (1/96) Japanese [30] 7.3% (7/96) Japanese [17] 5.6% (3/54) Chinese [37] 2965G > A Ala989Thr 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3140G > C Cys1047Ser 0% (0/220) Caucasian www.pharmGKB.org 4.5% (9/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3173G > A Arg1058Gln 0% (0./26) Japanese [16] 1% (1/96) Japanese [17] 4535C > T Ser1512Leu 3.1% (2/24) Caucasian [28] Characterization of MRP1/ABCC1 variants in vitro Le´tourneau et al. 649 the Arg633Gln and Arg723Gln mutants was created by subcloning a HindIII fragment (1329 bp) encoding amino acids 517-959 into pGEM-3z [20]. Login to comment
94 Results from previously characterized non-synonymous SNPs, Cys43Ser, Arg433Ser and Gly671Val, were included where available for comparison [18-20]. Login to comment
123 Previous mutagenesis and inhibition studies have Fig. 3 Cys43Ser Thr73lle Ser92Phe Thr117Met Arg230Gln Arg433Ser Arg633Gln Gly671Val Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu Cys43Ser Thr73lle Ser92Phe Thr117Met Arg230Gln Arg433Ser Arg633Gln Gly671Val Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu Thr73lle Ser92Phe Thr117Met Arg230Gln Arg633Gln Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu LTC4 % WT-MRP1 uptake 0 25 50 75 100 125 E217βG % WT-MRP1 uptake 0 25 50 75 100 125 150 MTX % WT-MRP1 uptake 0 25 50 75 100 125 (b) (c) (a) ATP-dependent vesicular transport of organic anions by mutant MRP1 proteins. Login to comment
128 Hatched bars represent previously published data on non-synonymous SNPs, Cys43Ser, Arg433Ser and Gly671Val, using membrane vesicles from stably transfected HeLa cells and are included for comparison [18-20]. Login to comment
137 On the other hand, the Cys43Ser and Ala989Thr mutations were found by analysis in vitro to significantly modify MRP1 function, despite the fact that these effects were not predicted by the SIFT algorithm [18]. Login to comment
158 This observation may be construed as being Table 2 Conservation of the amino acids substituted by non-synonymous SNP of human MRP1/ABCC1a Protein Speciesb C43S T73I S92F T117Mc R230Q V353M R433S R633Qc G671V R723Q A989T C1047S R1058Q S1512L MRP1 Human C T S T R V R R G R A C R S Monkey C T S M R V R R G Q A C R S Dog C T S M R V R R G R A R R S Cow C A S M Q V R R G R A R R S Rat C A S M Q V R W G R A R R S Mouse C T S M H V R R G R A R R S MRP2 Human L A V T K A K R G K A I R E Monkey L A V T K A K R G K A I R E Dog L A V T K A K R G K A I Q Q Rat L A A T K V K R G K A A R E Mouse L A A T K V K V G K A T R E Rabbit L A V T K V K R G K A I R E MRP3 Human C L S M Y I R K G Q A V R A Rat C L S M L L R K G Q A L R V MRP4 Human - - - - I F K R G R Y T K Y MRP5 Human - - - - V T R S G R T R R S MRP6 Human P A A M R I R S G V A L R A CFTR Human - - - - R Y K A G K L I Q Q SUR1 Human V L L A T V Q R G E L R L E SUR2 Human V L H T Q V Q R G E I N L P Pgp Human - - - - - E K S G A G R R Q YCF1 Saccharomyces cervisiae A I L V T V K L G K S Y R G Mrp1 Caenorhabditis elegans T L D F L I R T G R G L R K Mrp2 Caenorhabditis elegans T F D I L I K T G R G I R K AtMRP2 Arabidopsis thaliana Q L R W L M S P G R R K R E AtMRP1 Arabidopsis thaliana H T A V L M S P G R R K R E a Aligned using Clustal W (http://pbil.univ-lyon1.fr/). Login to comment

PMID: 16393888 [PubMed] Zhang J et al: "Metabolism and transport of oxazaphosphorines and the clinical implications."

No. Sentence Comment

628 The 128C MRP1 polymorphism in exon 2 resulting in Cys43Ser substitution disrupted plasma membrane trafficking and reduced resistance to doxorubicin, vincristine, and arsenite in HeLa cells expressing this MRP1 mutant while the transport of conjugated organic anion remained comparable to wild type MRP1 (Ito et al., 2001a; Leslie et al., 2003). Login to comment

PMID: 18220559 [PubMed] Yu XQ et al: "Multidrug resistance associated proteins as determining factors of pharmacokinetics and pharmacodynamics of drugs."

No. Sentence Comment

405 Important Single Nucleotide Polymorphisms (SNPs) of MRP Genes MRP Chromosomal location Amino acid variation Nucleotide variation Location References Cys43Ser Thr73Ile G128C C218T Exon2 Exon2 [239] Arg433Ser G1299T Exon10 [258] Gly671Val G2012T Exon16 [259] Arg723Gln G2168A Exon17 [239] MRP1 16p13.11-p13.12 Arg1058Gln G3173A Exon23 [239] C-24T Promoter [100, 239] Val417Ile G1249A Exon10 [100, 238, 239] Gly676Arg G2026C Exon16 [237] Try709Arg T2125C Exon17 [236] Arg768Trp Ser789Phe C2302T C2366T Exon18 Exon18 [100, 238, 239] I1173F R1150H A3517T G3449A Exon25 Exon25 [240] Ile1324Ile C3972T Exon28 [100, 239] MRP2 10q23-24 Ala1450Thr G4348A Exon31 [100, 238, 239] (Table 2) contd…. Login to comment

PMID: 19214144 [PubMed] Yin JY et al: "Characterization and analyses of multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphisms in Chinese population."

No. Sentence Comment

5 Results The allelic frequencies of Cys43Ser (128G > C), Thr73Ile (218C > T), Arg723Gln (2168G > A), and Arg1058Gln (3173G > A) in mainland Chinese were 0.5, 1.4, 5.8, and 0.5%, respectively. Login to comment
7 The Cys43Ser mutation did not affect all tested drug resistance. Login to comment
23 The four most common nonsynonymous SNPs in the Asian population are Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations [15,17]. Login to comment
24 While Cys43Ser (128G > C) is located in the first transmembrane (TM), Thr73Ile (218C > T), Arg723Gln (2168G > A) and Arg1058Gln (3173G > A) are located in the first intracellular loop, the first NBD, and the seventh intracellular loop, respectively (Fig. 1a). Login to comment
25 To date, only three naturally occurring mutations of MRP1/ABCC1 (Gly671Val, Arg433Ser, and Cys43Ser) have been fully investigated for their effects on MRP1/ ABCC1-mediated MDR [18-20]. Login to comment
35 Fig. 1 COOH L0 NBD1 NBD2 NH2 KCFQNTVLVWVPCFYLWACFPFYF TM1(a) CL1 Thr73Ile …AWIQNDSLRENILFGC… NBD1 Arg723Gln * * * * …DLLHSILRSPMSFF… CL7 Arg1058Gln PFYFLYLSRHDRGYIQMTPLNKTK Cys43Ser Cys43Ser Thr73Ile Arg723Gln Arg1058Gln 1 Human Monkey Bovine Dog Mouse Rat Chicken 2 3 4 5 6 7 (b) Location and conservation of the amino acid residues with polymorphisms in multidrug-resistance-associated protein 1 (MRP1/ABCC1). Login to comment
36 (a) Location of Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln in the schematic model of MRP1/ABCC1. Login to comment
51 Site-directed mutagenesis For site mutagenesis, cassettes containing various domains of MRP1/ABCC1 cDNA were first released from the full-length cDNA by double digestion (Not I/BamH I for Cys43Ser and Thr73Ile mutation; EcoN I/BsmB I for Arg723Gln mutation; and BsmB I/EcoR I for Arg1058Gln mutation), cloned into pGEM-T Easy (Promega), followed by site-directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, USA) with the following primers (the substituted nucleotides are italicized): 50 -TCGTGTGGGTGCCTTGTTTTTACCTCTGGGC-30 (Cys43Ser); 50 -GATGACACCTCTCAACAAAACCAAA ACTGCCTTGGGATTTT-30 (Thr73lle); 50 -GGATTC AGAATGATTCTCTCCAAGAAAACATCCTTTTTGGA TG-30 (Arg723Gln); 50 -GCACAGCATCCTGCGGTCAC CCATGAGCT-30 (Arg1058Gln). Login to comment
62 The real-time PCR was carried Table 1 Primers and PCR condition for determining polymorphisms Polymorphisms Oligonucleotide primers Annealing temperature (1C) Restriction enzyme Cys43Ser (128G > C) F: GGTCCTCGTGTGGGTGCCAT 57.5 Nla III R: TAGAAGAAGGAACTTAGGGTCAACT Thr73Ile (218C > T) F: TCAGATGACACCTCTCAACAGAA 56.7 Hinf I R: CCAGTTTTCACCTCCCACATTAT Arg723Gln (2168G > A) F: GCCTGGATTCAGAATGATTCTCTTC 52.0 Taq I R: TACTGACCTTCTCGCCAATCTCTGT Arg1058Gln (3173G > A) F: TCTGCATTGTGGAGTTTT 53.0 Pst I R: GACGAAGAAGTAGATGAGGC F, forward; R, reverse. Login to comment
91 Although the Cys43Ser mutation is located in the first TM helix, the other three are located in the intracellular loops or the NBD (Fig. 1a). Login to comment
99 The frequencies of C alleles for the SNP of Cys43Ser and A alleles for the SNP of Arg1058Gln were both about 0.5%. Login to comment
101 The genotyping and allelic frequencies of SNPs for Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations are shown in Table 2. Login to comment
102 The distribution of these SNPs in different populations and their comparison are summarized in Table 3. mRNA and protein expression levels of MRP1/ABCC1 mutants To determine whether these SNPs affect MRP1/ABCC1 expression, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations were recreated in MRP1/ABCC1 cDNA by site-directed mutagenesis and transiently transfected into HEK293 and CHO-K1 cells. Login to comment
107 Subcellular localization of wild-type and mutant MRP1/ABCC1 To further determine whether Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations influence the trafficking of MRP1/ABCC1 to the cell surface, we detected the subcellular localization of wild-type and mutant MRP1/ABCC1 in transiently transfected HEK293 and CHO-K1 cells through the process of immunostaining. Login to comment
108 As shown in Fig. 3, strong plasma membrane staining was observed with all cells that are transfected with either wild-type or mutant MRP1/ABCC1, but not in the Table 3 Comparison of distributive frequencies of MRP1/ABCC1 Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln polymorphisms in different ethnic populations Allelic frequency (n) SNPs (nucleic acid substitution) m w Population References NCBI SNP ID Cys43Ser (128G > C) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41395947 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study Thr73Ile (218C > T) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41494447 0 (0/26) 1 (26/26) Japanese [14] 0.037 (2/54) 0.963 (52/54) Chinese [17] 0.014 (1/72) 0.986 (71/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0(0/72) 1 (72/72) Caucasian [15] 0.014 (6/416) 0.986 (410/416) Chinese This study Arg723Gln (2168G > A) 0.073 (7/96) 0.927 (89/96) Japanese [16] rs4148356 0.038 (1/26) 0.962 (25/26) Japanese [14] 0.056(3/54) 0.944 (51/54) Chinese [17] 0 (0/72) 1 (72/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0 (0/72) 1 (72/72) Caucasian [15] 0.058 (24/416) 0.942 (392/416) Chinese* This study Arg1058Gln (3173G > A) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41410450 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study m, mutant; MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism; w, wild-type. Login to comment
110 Table 2 Genotyping and allelic frequencies of MRP1/ABCC1 polymorphisms SNPs (nucleic acid substitution) Allele Allelic frequency (n) Genotype Genotype frequency (n) Cys43Ser (128G > C) G 0.995 (414) GG 0.990 (206) C 0.005 (2) GC 0.010 (2) CC 0 (0) Thr73lle (218C > T) C 0.986 (410) CC 0.971 (202) T 0.014 (6) CT 0.029 (6) TT 0 (0) Arg723Gln (2168G > A) G 0.942 (392) GG 0.889 (185) A 0.058 (24) GA 0.106 (22) AA 0.005 (1) Arg1058Gln (3173G > A) G 0.995 (414) GG 0.990 (206) A 0.005 (2) GA 0.010 (2) AA 0 (0) MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism. Login to comment
111 210 Fig. 2 1.5 HEK293 CHO-K1 RelativeABCC1mRNAlevel RelativeABCC1mRNAlevel HEK293 CHO-K1 1.0 0.9 1.1 0.8 1.1 ABCC1 β-actin R. level 1.0 0.5 0.0 W ild-type C ys43Ser Arg723G ln Arg1058G ln Thr73lle W ild-type Vector W ild-typeCys43Ser Thr73lle Arg723G lnArg1058G ln C ys43Ser Arg723G ln Arg1058G ln Thr73lle 1.0 1.1 0.8 0.8 0.9 ABCC1 β-actin R. level Vector W ild-type Cys43Ser Thr73lle Arg723G lnArg1058G ln 1.5 1.0 0.5 0.0 (a) (b) Effect of mutations on multidrug resistance-associated protein 1 (MRP1/ABCC1) expression. Login to comment
112 HEK293 and CHO-K1 cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 followed by preparation of RNAs for quantitative real-time reverse-transcribed PCR analysis of MRP1/ABCC1 R. level (relative level) (a), or preparation of cell lysates for western blot analysis of MRP1/ABCC1 protein level (b). Login to comment
116 Fig. 3 Vector Wild-type Cys43Ser Thr73lle Arg723Gln Arg1058Gln Vector MRP1/ ABCC1 P1 MRP1/ ABCC1 P1(a) MergeMerge Wild-type Cys43Ser Thr73lle Arg723Gln Arg1058Gln (b) Effect of mutations on subcellular localization of multidrug resistance-associated protein 1 (MRP1/ABCC1). Login to comment
117 HEK293 (a) and CHO-K1 (b) cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1, followed by fixation and immunostaining of MRP1/ABCC1 using MRPr1 antibody and fluorescein isothiocyanate-conjugated secondary antibody. Login to comment
126 HEK293 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment
132 The Cys43Ser mutation does not seem to have any effect on the activity of MRP1/ABCC1 in conferring resistance to all the drugs tested in either of the cell lines used (Figs 4 and 5 and Tables 4 and 5). Login to comment
136 CHO-K1 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment
142 Discussion In this study, we identified the allelic frequencies of Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln in a mainland Chinese population. Login to comment
147 This study shows for the first time the frequencies of nonsynonymous mutations, Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln, in a large sample of healthy volunteers from mainland China. Login to comment
148 In the 208 Chinese volunteers enrolled in this study, few had Cys43Ser, Thr73Ile, and Arg1058Gln polymorphisms. Login to comment
161 Table 4 Resistance factors of transfected HEK293 cells to chemotherapeutic agents Resistance factorsa Drugs WT MRP1/ABCC1 Cys43Ser (128G > C) Thr73lle (218C > T) Arg723Gln (2168G > A) Arg1058Gln (3173G > A) Cisplatin 0.95 ± 0.24 0.95 ± 0.14 0.83 ± 0.18 0.76 ± 0.20 1.10 ± 0.10 Paclitaxel 1.14 ± 0.09 0.99 ± 0.16 0.99 ± 0.21 1.10 ± 0.22 1.04 ± 0.16 Daunorubicin 17.82 ± 3.15 17.27 ± 2.37 19.73 ± 1.98 9.09 ± 1.68 8.73 ± 2.62 Doxorubicin 14.38 ± 0.75 15.13 ± 0.91 14.63 ± 1.52 3.63 ± 1.20 2.38 ± 1.03 Etoposide 12.65 ± 2.09 11.51 ± 1.92 13.08 ± 1.84 4.41 ± 0.67 6.65 ± 1.05 Methotrexate 10.80 ± 1.33 10.50 ± 1.58 6.70 ± 0.95 6.20 ± 0.90 10.70 ± 1.26 Vinblastine 5.44 ± 1.36 5.72 ± 1.60 5.64 ± 1.04 2.80 ± 1.26 5.44 ± 1.62 Vincristine 11.35 ± 3.11 11.17 ± 2.91 8.89 ± 2.40 3.76 ± 1.15 11.18 ± 2.82 IC50, half maximal inhibitory concentration; MRP1/ABCC1, multidrug resistance-associated protein 1; WT, wild-type. Login to comment
163 Table 5 Resistance factors of transfected CHO-K1 cells to chemotherapeutic agents Resistance factorsa Drugs WT MRP1/ABCC1 Cys43Ser (128G > C) Thr73lle (218C > T) Arg723Gln (2168G > A) Arg1058Gln (3173G > A) Cisplatin 0.94 ± 0.05 0.98 ± 0.12 0.89 ± 0.04 0.99 ± 0.09 0.89 ± 1.10 Paclitaxel 0.94 ± 0.11 0.88 ± 0.10 0.96 ± 0.05 1.00 ± 0.07 0.96 ± 0.06 Daunorubicin 12.97 ± 2.76 13.09 ± 2.68 13.07 ± 2.81 2.96 ± 0.58 4.81 ± 1.01 Doxorubicin 15.44 ± 1.37 15.84 ± 0.91 15.44 ± 1.95 6.46 ± 0.90 7.22 ± 0.86 Etoposide 16.57 ± 1.91 16.44 ± 1.95 4.84 ± 0.51 3.56 ± 0.36 4.77 ± 0.56 Methotrexate 3.78 ± 1.07 3.70 ± 1.01 3.60 ± 1.39 3.75 ± 1.08 1.67 ± 0.53 Vinblastine 10.35 ± 1.61 10.32 ± 1.70 10.27 ± 1.66 5.73 ± 0.87 8.50 ± 1.32 Vincristine 6.93 ± 1.13 6.78 ± 1.18 6.79 ± 1.04 2.27 ± 0.34 6.85 ± 1.14 IC50, half maximal inhibitory concentration; MRP1/ABCC1, multidrug resistance-associated protein 1; WT, wild-type. Login to comment
165 214 The four SNPs (Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln) studied here are located in various domains of human MRP1/ABCC1. Login to comment
171 Nonetheless, their drug-resistance profiles were rather different: Arg1058Gln mutation decreased resistance to several anticancer drugs, whereas Cys43Ser mutation did not significantly affect resistance to any drugs tested. Login to comment
173 In a previous study, however, the Cys43Ser mutation did seem to cause a decrease in resistance to vincristine in HeLa cells [20]. Login to comment
174 The reason for the difference between these two studies is not known, however, considering that different cell lines may have different impacts on the effect of mutations on MRP1/ABCC1 function (see also, discussion in the last paragraph), it is tempting to speculate that HeLa cells behave differently than HEK293 and CHO-K1 cells regarding the effect of Cys43Ser mutation on MRP1/ABCC1 function. Login to comment

PMID: 19949927 [PubMed] Chang XB et al: "Molecular mechanism of ATP-dependent solute transport by multidrug resistance-associated protein 1."

No. Sentence Comment

104 Mutations of C43S in TM1 (112); P343A, K332L and K332D in TM6 (113, 114); W445A and P448A in TM8 (113, 115); T550A, T556A and P557A in TM10 (113, 116); N590A, F594A, P595A, N597A, S604A and S605A in TM11 (113, 117, 118); E1089Q, E1089A, E1089L, E1089N, K1092, S1097 and N1100 in TM14 (119, 120); R1197K in TM16 (121); Y1236F, T1241A, T1242A, T1242C, T1242S, T1242L, Y1243F, N1245A, W1246C, W1246A, W1246F, W1246Y or R1249K in TM17 (121-124) significantly affect MRP1 function. Login to comment

PMID: 21143116 [PubMed] He SM et al: "Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1)."

No. Sentence Comment

816 There are at least 15 naturally occurring mutations identified in MRP1/ABCC1, including Cys43Ser in TM1, Thr73Ile in CL1, Ser92Phe in TM2, Arg230Asn in L0, Val353Met at TM6/TM7 interface, Arg433Ser in TM8, Gly671Val in TM11, Arg723Gln located between the Walker A and Walker B motifs of NBD1, Ala861Thr at NBD1/TM12 interface, Ala989Thr in TM12, Cys1047Ser in TM13, Arg1058Gln in CL7, Val1146Ile in CL7, Thr1337Ala between the Walker A and Walker B motifs of NBD2, and Thr1401Met, and many of them have been found to affect its transport activity [171, 362, 363, 366, 367, 377-384]. Login to comment
818 The Cys43Ser mutant in TM1 (128G>C in exon 2) exhibited impaired plasma membrane location of the transporter, with a 2.5-fold decrease in arsenite resistance and a lower vincristine resistance [171]. Login to comment
820 When Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln were separately transfected in CHO-K1 or HEK293 cells, the cells displayed altered resistance profiles to a panel of anticancer drugs compared to the wild-type [366]. Login to comment

PMID: 21736601 [PubMed] Yin JY et al: "ABCC1 polymorphism Arg723Gln (2168G > A) is associated with lung cancer susceptibility in a Chinese population."

No. Sentence Comment

24 For example, Cys43Ser (128G>C), which is located in the NH2 proximal region, was found to be important for the maintenance of MRP1/ABCC1-induced drug resistance.6 Another polymorphism, Arg433Ser (1299G>A), has the potential to increase resistance to doxorubicin in transfected Hela cells.7 Our previous investigation also showed that Arg723Gln (2168G>A) could significantly reduce MRP1/ABCC1 induced MDR.8 Furthermore, a number of in vivo studies have provided the clinical data to support the important role of MRP1/ABCC1 polymorphisms in disease susceptibility, drug metabolism and toxicity. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

PMID: 24080162 [PubMed] Conseil G et al: "Two polymorphic variants of ABCC1 selectively alter drug resistance and inhibitor sensitivity of the multidrug and organic anion transporter multidrug resistance protein 1."

No. Sentence Comment

4 Mutants C43S and S92F were correctly routed to the HEK cell plasma membrane, but the levels were too low to permit functional characterization. Login to comment
27 Previously, we generated and partially characterized recombinant forms of ABCC1 nsSNPs: rs45511401 (2012G.T; G671V), rs60782127 (1299G.T; R433S), and rs41395947 (128G.C; C43S) (Conrad et al., 2001, 2002; Leslie et al., 2003). Login to comment
31 Yet another phenotype was observed for the C43S nsSNP in the first TM helix of MSD0. Login to comment
32 Not only did C43S increase organic anion transport activity and reduce resistance to vincristine and arsenite (Leslie et al., 2003), it also mildly disrupted MRP1 membrane trafficking. Login to comment
34 In contrast to our experimental data, the predictive algorithms SIFT (Sorting Tolerant From Intolerant) and PolyPhen indicated that G671V would adversely affect MRP1 function but C43S and A989T were less likely to do so, whereas predictions for R433S were mixed (L&#e9;tourneau et al., 2005). Login to comment
40 Four (C43S, S92F, G671V, A989T) were mutants that our earlier studies showed had a phenotype discordant from that predicted by Polyphen and/or SIFT (L&#e9;tourneau et al., 2005). Login to comment
115 The predicted effects of the nsSNPs C43S and S92F in MSD0 are mixed (Table 1). Login to comment
116 They are predicted to be possibly damaging by Polyphen2 but tolerated by SIFT (except for SIFTBLink which places S92F at the threshold), and to cause substantial physicochemical changes and probably low occurrence (Grantham and matrices), yet the I-mutant Suite predicts C43S to be more destabilizing than S92F (Table 1). Login to comment
122 C43S . Login to comment
129 However, despite our repeated attempts, HEK cell lines homogeneously expressing the two MSD0 mutants, C43S and S92F, could not be isolated. Login to comment
131 Immunoblots of lysates prepared from the S92F and C43S cell lines showed MRP1 protein levels that were much lower than wild-type MRP1 (Supplemental Fig. 1), as might be expected from nonclonal cell lines. Login to comment
133 The C43S and S92F mutants in the nonclonal cell populations were also properly routed to the plasma membrane although, as expected because of the heterogeneity of MRP1 expression in these cell lines, significantly fewer cells expressed these proteins (Supplemental Fig. 1). Login to comment
134 Because of the confounding effects of mixed cell populations on the interpretation of subsequent functional assays, the C43S and S92F mutants were not characterized further. Login to comment
141 TABLE 1 Predicted effects of MRP1 nsSNPs examined in this study according to various in silico prediction methods nsSNP SIFT/SIFTBLink Probability Scoresa PolyPhen2 Classificationb (Score) I-Mutant Suite "Stability"c (DDG in kcal mol21 ) Grantham Value Difference (D)d Blosum50e PAM250f (Threshold) (,0.05) (.1.000) (,20.5; .0.5) (.50) (,0) (,0) C43S 0.51/0.08 possibly damaging (0.819) decrease (20.74) 112 21 0 S92F 0.11/0.05 possibly damaging (0.303) neutral (20.05) 155 23 23 NBD1-R633Q 0.66/0.57 benign (0.001) decrease (21.16) 43 1 1 NBD1-G671V 0.00/0.02 probably damaging (1.000) decrease (20.57) 109 24 21 NBD1-R723Q 0.49/0.39 benign(0.002) decrease (20.71) 43 1 1 A989T 0.53/0.12 benign (0.000) decrease (20.73) 58 0 1 C1047S 0.07/0.64 benign (0.001) decrease (20.67) 112 21 0 a SIFT (Sorting Intolerant From Tolerant) was used by manually entering a sequence alignment comprising only human homologs of MRP1, and SIFT-BLink probability scores were obtained using 100 aligned computer-selected sequences (threshold for nontolerated substitution set at ,0.05). Login to comment
217 The first category includes the two nsSNPs in TM1 (C43S) and TM2 (S92F) that could not be functionally characterized because stable homogeneously expressing clonal HEK cell lines for these mutants could not be isolated. Login to comment
220 However, most in silico prediction programs based on chemical properties, amino acid conservation, and structural data classify the C43S and S92F nsSNPs as very likely to be deleterious to MRP1 function. Login to comment
221 Previously, we showed that C43S expressed in HeLa cells was associated with decreased arsenite and vincristine resistance, and moderately impaired MRP1 trafficking to the plasma membrane (Leslie et al., 2003). Login to comment

PMID: 24670052 [PubMed] Kunicka T et al: "Importance of ABCC1 for cancer therapy and prognosis."

No. Sentence Comment

134 Letourneau et al. (2005) studied the influence of 10 DOI: 10.3109/03602532.2014.901348 ABCC1 and cancer therapy and prognosis non-synonymous SNPs - Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Arg723Gln (G2168A, rs4148356), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450) and Ser1512Leu (C4535T, rs369410659) - on ABCC1 expression using membrane vesicles isolated from transfected cells and assessed transport activity for three known ABCC1 substrates. Login to comment
159 NCBI ID Reference Amino acid exchange Nucleotide exchange Location Function MAFa rs41395947 Cys43Ser G128C Exon 2 Non-synonymous Unknown rs41494447 Thr73Ile C218T Exon 2 Non-synonymous T &#bc; 0.003 rs8187844 Ser92Phe C257T Exon 3 Non-synonymous T &#bc; 0.004 rs8187848 Arg230Gln G689A Exon 7 Non-synonymous A &#bc; 0.009 rs2230669 Pro272Pro G816A Exon 8 Synonymous A &#bc; 0.037 rs246221 Val275Val T825C Exon 8 Synonymous C &#bc; 0.301 rs35592 non-coding T-176C Intron 9 Non-coding C &#bc; 0.257 rs60782127 Arg433Ser G1299T Exon 10 Non-synonymous T &#bc; 0.004 rs35605 Leu562Leu T1684C Exon 13 Synonymous T &#bc; 0.173 rs112282109 Arg633Gln G1898A Exon 14 Non-synonymous A &#bc; 0.004 rs45511401 Gly671Val G2012T Exon 16 Non-synonymous T &#bc; 0.050 rs4148356 Arg723Gln G2168A Exon17 Non-synonymous A &#bc; 0.027 rs35529209 Ala989Thr G2965A Exon 22 Non-synonymous Unknown rs13337489 Cys1047Ser G3140C Exon 23 Non-synonymous C &#bc; 0.000 rs41410450 Arg1058Gln G3173A Exon 23 Non-synonymous Unknown rs2238476 non-coding G-1960A Intron 23 Non-coding T &#bc; 0.062 rs2230671 Ser1334Ser G4002A Exon 28 Synonymous T &#bc; 0.208 rs28364006 Thr1337Ala A4009G Exon 28 Non-synonymous Unknown rs369410659 Ser1512Leu C4535T Exon 31 Non-synonymous Unknown a Minor allele frequencies for Caucasinans in dbSNP based on HapMap-CEU population or 1000 genomes. Login to comment

PMID: 25078270 [PubMed] Kunicka T et al: "Non-coding polymorphisms in nucleotide binding domain 1 in ABCC1 gene associate with transcript level and survival of patients with breast cancer."

No. Sentence Comment

215 Ten other non-synonymous SNPs leading to amino acid substitutions (Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450), and Ser1512Leu (C4535T, rs369410659)) followed earlier had no effect on ABCC1 expression either, indicating that single amino acid substitutions may not necessarily influence the activity of the final protein [44]. Login to comment