ABCMdb

ABCA4 p.Arg1129Cys

ClinVar:	c.3386G>T , p.Arg1129Leu ? , not provided
Predicted by SNAP2:	A: D (75%), C: D (91%), D: D (75%), E: D (75%), F: D (75%), G: D (71%), H: D (63%), I: D (75%), K: N (61%), L: D (95%), M: D (75%), N: D (53%), P: D (75%), Q: D (66%), S: D (63%), T: D (59%), V: D (75%), W: D (95%), Y: D (75%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Analysis of the ABCR (ABCA4) gene in 4-aminoquinol... Am J Ophthalmol. 2001 Jun;131(6):761-6. Shroyer NF, Lewis RA, Lupski JR
Analysis of the ABCR (ABCA4) gene in 4-aminoquinoline retinopathy: is retinal toxicity by chloroquine and hydroxychloroquine related to Stargardt disease?
Am J Ophthalmol. 2001 Jun;131(6):761-6., [PMID:11384574]

Abstract [show]
PURPOSE: To determine if mutations in ABCR (ABCA4) are associated with chloroquine/hydroxychloroquine retinopathy. METHODS: DNA from eight patients with chloroquine or hydroxychloroquine retinopathy was studied. Controls were 80 individuals over age 65 years with normal retinal examinations. Ophthalmoscopy, color vision testing, visual fields, retinal photography, and fluorescein angiography were performed on the eight patients. Direct DNA sequencing of the exons and flanking intronic regions of the ABCR gene was completed for all patients. RESULTS: Clinical evaluation confirmed the diagnosis of chloroquine/hydroxychloroquine retinopathy and excluded Stargardt disease in each patient. Two patients had heterozygous ABCR missense mutations previously associated with Stargardt disease. None of the controls had these missense mutations. Three other patients had other missense polymorphisms. CONCLUSIONS: Some individuals who have ABCR mutations may be predisposed to develop retinal toxicity when exposed to chloroquine/hydroxychloroquine. We urge further study of a larger cohort of patients with chloroquine/hydroxychloroquine retinopathy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Subject 3 is heterozygous for the transition 3385C3T, which encodes the missense substitution Arg1129Cys. Login to comment
51 This alteration was reported previously in an unrelated patient with Stargardt disease.23 In addition, the missense substitution of leucine for arginine at this residue (Arg1129Leu) was reported in an unrelated patient with age-related macular degeneration and two unrelated patients with Stargardt disease.18,23 Thus, the mutation Arg1129Cys is considered pathogenic and may predispose the development of retinopathy in the heterozygous state. Subject 7 carries three missense mutations. Login to comment
71 Subject 3 is heterozygous for the mutation Arg1129Cys. Login to comment
73 Also, recent biochemical characterization of recombinant ABCR protein with the Arg1129Leu mutation revealed a substantial reduction in both expression and ATP binding when compared with wild type ABCR.27 Thus, the pathogenic allele Arg1129Cys is likely to cause severe reduction in ABCR activity and may predispose development of chloroquine/hydroxychloroquine maculopathy in the heterozygous state. Subject 7 is compound heterozygous for the missense mutation Arg2107His and the complex allele (Leu1201Arg; Arg2107His). Login to comment

[hide] Genotype/Phenotype analysis of a photoreceptor-spe... Am J Hum Genet. 1999 Feb;64(2):422-34. Lewis RA, Shroyer NF, Singh N, Allikmets R, Hutchinson A, Li Y, Lupski JR, Leppert M, Dean M
Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease.
Am J Hum Genet. 1999 Feb;64(2):422-34., [PMID:9973280]

Abstract [show]
Mutation scanning and direct DNA sequencing of all 50 exons of ABCR were completed for 150 families segregating recessive Stargardt disease (STGD1). ABCR variations were identified in 173 (57%) disease chromosomes, the majority of which represent missense amino acid substitutions. These ABCR variants were not found in 220 unaffected control individuals (440 chromosomes) but do cosegregate with the disease in these families with STGD1, and many occur in conserved functional domains. Missense amino acid substitutions located in the amino terminal one-third of the protein appear to be associated with earlier onset of the disease and may represent misfolding alleles. The two most common mutant alleles, G1961E and A1038V, each identified in 16 of 173 disease chromosomes, composed 18.5% of mutations identified. G1961E has been associated previously, at a statistically significant level in the heterozygous state, with age-related macular degeneration (AMD). Clinical evaluation of these 150 families with STGD1 revealed a high frequency of AMD in first- and second-degree relatives. These findings support the hypothesis that compound heterozygous ABCR mutations are responsible for STGD1 and that some heterozygous ABCR mutations may enhance susceptibility to AMD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
111 In three instances, identical codons were affected by different base-pair substitutions, yielding different predicted missense amino acid substitutions (R572Q and R572P; R1129C and R1129L) or a missense substitution and a stop codon (R2030Q and R2030X). Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment
112 In three instances, identical codons were affected by different base-pair substitutions, yielding different predicted missense amino acid substitutions (R572Q and R572P; R1129C and R1129L) or a missense substitution and a stop codon (R2030Q and R2030X). Login to comment

[hide] Mutation of the Stargardt disease gene (ABCR) in a... Science. 1997 Sep 19;277(5333):1805-7. Allikmets R, Shroyer NF, Singh N, Seddon JM, Lewis RA, Bernstein PS, Peiffer A, Zabriskie NA, Li Y, Hutchinson A, Dean M, Lupski JR, Leppert M
Mutation of the Stargardt disease gene (ABCR) in age-related macular degeneration.
Science. 1997 Sep 19;277(5333):1805-7., [PMID:9295268]

Abstract [show]
Age-related macular degeneration (AMD) is the leading cause of severe central visual impairment among the elderly and is associated both with environmental factors such as smoking and with genetic factors. Here, 167 unrelated AMD patients were screened for alterations in ABCR, a gene that encodes a retinal rod photoreceptor protein and is defective in Stargardt disease, a common hereditary form of macular dystrophy. Thirteen different AMD-associated alterations, both deletions and amino acid substitutions, were found in one allele of ABCR in 26 patients (16%). Identification of ABCR alterations will permit presymptomatic testing of high-risk individuals and may lead to earlier diagnosis of AMD and to new strategies for prevention and therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 Mutation AMD (n ϭ167) STGD (n ϭ 98) General population (n ϭ 220) E471K 2 (1.2%) NA 0 (0%) R1129L 1 (0.6%) 0 (0%)* 0 (0%) T1428M 1 (0.6%) 0 (0%) 0 (0%) R1517S 1 (0.6%) 0 (0%) 0 (0%) I1562T 2 (1.2%) 0 (0%) 0 (0%) G1578R 1 (0.6%) 0 (0%) 0 (0%) 5196ϩ1G 3 A 1 (0.6%) 0 (0%) 0 (0%) R1898H 1 (0.6%) 4 (4%) 0 (0%) G1961E 6 (3.6%) 8 (8%) 0 (0%) L1970F 1 (0.6%) 0 (0%) 0 (0%) 6519⌬11bp 1 (0.6%)† 1 (1%)† 0 (0%) D2177N 7 (4.2%) 0 (0%) 1 (0.45%) 6568⌬C 1 (0.6%) 0 (0%) 0 (0%) Totals 26 (16%) 13 (13%) 1 (0.45%) *A substitution to a different amino acid (R1129C) was detected in one STGD1 patient. Login to comment
96 Mutation AMD (n 5167) STGD (n 5 98) General population (n 5 220) E471K 2 (1.2%) NA 0 (0%) R1129L 1 (0.6%) 0 (0%)* 0 (0%) T1428M 1 (0.6%) 0 (0%) 0 (0%) R1517S 1 (0.6%) 0 (0%) 0 (0%) I1562T 2 (1.2%) 0 (0%) 0 (0%) G1578R 1 (0.6%) 0 (0%) 0 (0%) 519611G 3 A 1 (0.6%) 0 (0%) 0 (0%) R1898H 1 (0.6%) 4 (4%) 0 (0%) G1961E 6 (3.6%) 8 (8%) 0 (0%) L1970F 1 (0.6%) 0 (0%) 0 (0%) 6519D11bp 1 (0.6%)ߤ 1 (1%)ߤ 0 (0%) D2177N 7 (4.2%) 0 (0%) 1 (0.45%) 6568DC 1 (0.6%) 0 (0%) 0 (0%) Totals 26 (16%) 13 (13%) 1 (0.45%) *A substitution to a different amino acid (R1129C) was detected in one STGD1 patient. Login to comment

[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]

Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Disease-associated nsSNPs at Three Structural Hotspots in Human ABC Transporter NBDs Gene Disease Position ARA motif ABCB11 BRIC2 A570T ABCD1 X-ALD A616V CFTR CF A559T ABCC6 PXE R765Q ABCC8 HHF1 R841G ABCC8 HHF1 R1493Q ABCC8 HHF1 R1493W ABCD1 X-ALD R617C ABCD1 X-ALD R617G ABCD1 X-ALD R617H CFTR CF R560K CFTR CF R560S CFTR CF R560T ABCA1 HDLD1 A1046D ABCB4 ICP A546D C-loop 1 motif ABCC8 HHF1 D1471H ABCC8 HHF1 D1471N CFTR CBAVD G544V ABCC8 HHF1 G1478R C-loop2 motif ABCA4 STGD1 H2128R ABCC8 HHF1 K889T ABCD1 X-ALD R660P ABCD1 X-ALD R660W ABCA1 HDLD2 M1091T ABCA4 STGD1 E2131K ABCA12 LI2 E1539K ABCA4 STGD1 and CORD3 E1122K CFTR CF L610S ABCC8 HHF1 L1543P ABCA1 Colorectal cancer sample; somatic mutation A2109T ABCC9 CMD1O A1513T ABCD1 X-ALD H667D CFTR CF A613T ABCA1 HDLD2 D1099Y ABCD1 X-ALD T668I CFTR CF D614G ABCA4 STGD1 R2139W ABCA4 STGD1 R1129C ABCA4 ARMD2, STGD1, and FFM R1129L Disease abbreviations are as follows: BRIC2, benign recurrent intrahepatic cholestasis type 2; X-ALD, X-linked adrenoleukodystrophy; CF, cystic fibrosis; PXE, Pseudoxanthoma elasticum; HHF1, familial hyperinsulinemic hypoglycemia-1; HDLD1, high density lipoprotein deficiency type 1; ICP, intrahepatic cholestasis of pregnancy; CBAVD, congenital bilateral absence of the vas deferens; STGD1, Stargardt disease type 1; HDLD2, high density lipoprotein deficiency type 2; LI2, ichthyosis lamellar type 2; CORD3, cone-rod dystrophy type 3; CMD1O, cardiomyopathy dilated type 1O; ARMD2, age-related macular degeneration type 2; FFM, fundus flavimaculatus. Login to comment

[hide] Quantitative fundus autofluorescence in recessive ... Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624. Burke TR, Duncker T, Woods RL, Greenberg JP, Zernant J, Tsang SH, Smith RT, Allikmets R, Sparrow JR, Delori FC
Quantitative fundus autofluorescence in recessive Stargardt disease.
Invest Ophthalmol Vis Sci. 2014 May 1;55(5):2841-52. doi: 10.1167/iovs.13-13624., [PMID:24677105]

Abstract [show]
PURPOSE: To quantify fundus autofluorescence (qAF) in patients with recessive Stargardt disease (STGD1). METHODS: A total of 42 STGD1 patients (ages: 7-52 years) with at least one confirmed disease-associated ABCA4 mutation were studied. Fundus AF images (488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The gray levels (GLs) of each image were calibrated to the reference, zero GL, magnification, and normative optical media density to yield qAF. Texture factor (TF) was calculated to characterize inhomogeneities in the AF image and patients were assigned to the phenotypes of Fishman I through III. RESULTS: Quantified fundus autofluorescence in 36 of 42 patients and TF in 27 of 42 patients were above normal limits for age. Young patients exhibited the relatively highest qAF, with levels up to 8-fold higher than healthy eyes. Quantified fundus autofluorescence and TF were higher in Fishman II and III than Fishman I, who had higher qAF and TF than healthy eyes. Patients carrying the G1916E mutation had lower qAF and TF than most other patients, even in the presence of a second allele associated with severe disease. CONCLUSIONS: Quantified fundus autofluorescence is an indirect approach to measuring RPE lipofuscin in vivo. We report that ABCA4 mutations cause significantly elevated qAF, consistent with previous reports indicating that increased RPE lipofuscin is a hallmark of STGD1. Even when qualitative differences in fundus AF images are not evident, qAF can elucidate phenotypic variation. Quantified fundus autofluorescence will serve to establish genotype-phenotype correlations and as an outcome measure in clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 [A854T; A1038V]; p.C2150Y 512 2.3 26 F 52 1 0.70 0.48 I - p.R212C 722 2.0 27 F 52 13 1.00 1.00 - I p.A1038V; p.A848D 459 4.1 28 M 20 5 0.30 0.40 I - p.L2027F; p.R1108H 507 2.3 29 M 23 7 1.00 1.00 I I p.G1961E; p.R2030Q 334 347 2.4 2.0 30 M 44 26 0.70 0.70 - II p.P1380L; p.R1108H 453 4.7 31 F 30 22 1.00 1.30 - I p.G1961E; c.6005&#fe;1G > T 428 2.3 32 M 12 8 0.40 0.40 I - p.W821R; p.C2150Y 306 2.0 33 F 20 9 0.88 0.88 III III p.R602W; p.M1882I 650 655 2.6 2.5 34 F 47 4 0.40 0.40 I - p.G1961E; p.R1129C 400 2.5 35 F 19 3 0.70 0.48 II II p. Login to comment

[hide] Quantitative fundus autofluorescence distinguishes... Ophthalmology. 2015 Feb;122(2):345-55. doi: 10.1016/j.ophtha.2014.08.017. Epub 2014 Oct 3. Duncker T, Tsang SH, Lee W, Zernant J, Allikmets R, Delori FC, Sparrow JR
Quantitative fundus autofluorescence distinguishes ABCA4-associated and non-ABCA4-associated bull's-eye maculopathy.
Ophthalmology. 2015 Feb;122(2):345-55. doi: 10.1016/j.ophtha.2014.08.017. Epub 2014 Oct 3., [PMID:25283059]

Abstract [show]
PURPOSE: Quantitative fundus autofluorescence (qAF) and spectral-domain optical coherence tomography (SD OCT) were performed in patients with bull's-eye maculopathy (BEM) to identify phenotypic markers that can aid in the differentiation of ABCA4-associated and non-ABCA4-associated disease. DESIGN: Prospective cross-sectional study at an academic referral center. SUBJECTS: Thirty-seven BEM patients (age range, 8-60 years) were studied. All patients exhibited a localized macular lesion exhibiting a smooth contour and qualitatively normal-appearing surrounding retina without flecks. Control values consisted of previously published data from 277 healthy subjects (374 eyes; age range, 5-60 years) without a family history of retinal dystrophy. METHODS: Autofluorescence (AF) images (30 degrees , 488-nm excitation) were acquired with a confocal scanning laser ophthalmoscope equipped with an internal fluorescent reference to account for variable laser power and detector sensitivity. The grey levels (GLs) from 8 circularly arranged segments positioned at an eccentricity of approximately 7 degrees to 9 degrees in each image were calibrated to the reference (0 GL), magnification, and normative optical media density to yield qAF. In addition, horizontal SD OCT images through the fovea were obtained. All patients were screened for ABCA4 mutations using the ABCR600 microarray, next-generation sequencing, or both. MAIN OUTCOME MEASURES: Quantitative AF, correlations between AF and SD OCT, and genotyping for ABCA4 variants. RESULTS: ABCA4 mutations were identified in 22 patients, who tended to be younger (mean age, 21.9+/-8.3 years) than patients without ABCA4 mutations (mean age, 42.1+/-14.9 years). Whereas phenotypic differences were not obvious on the basis of qualitative fundus AF and SD OCT imaging, with qAF, the 2 groups of patients were clearly distinguishable. In the ABCA4-positive group, 37 of 41 eyes (19 of 22 patients) had qAF8 of more than the 95% confidence interval for age. Conversely, in the ABCA4-negative group, 22 of 26 eyes (13 of 15 patients) had qAF8 within the normal range. CONCLUSIONS: The qAF method can differentiate between ABCA4-associated and non-ABCA4-associated BEM and may guide clinical diagnosis and genetic testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Sex Age (yrs) Race or Ethnicity Best-Corrected Visual Acuity (Logarithm of the Minimum Angle of Resolution Units) Genetic Data Average of Quantitative Fundus Autofluorescence Values of the 8 Segments ABCA4 Mutations Right Eye Left Eye Allele 1 Allele 2 Right Eye Left Eye 1 M 36 White 0.70 0.70 p.G1961E p.G1961E 282 279 2 F 46 White 0.40 0.40y p.G1961E p.R1129C 391 3 M 17 Asian Indian 0.70 0.88 p.G1961E c.6729&#fe;4_&#fe;18del 340 363 4 M 17 White 0.88 0.88 p.G1961E p.A1773V 340 366 5 M 21 White 0.88 0.88 p.G1961E p.W15* 341 325 6 F 22 White 0.70 0.48 p.G1961E p.G863A 361 351 7 F 20 White 0.70z 0.88z p.G1961E p.L541P 317 8 M 12 White 0.80 0.70 p.G1961E p.P1380L 251 242 9 F 21 White 0.88 0.88 p.G1961E p.R212C 407 439 10 F 26 White 0.40z 0.70z p.G1961E c.5196&#fe;1056A/G 379 344 11 F 24 White 0.88z 0.88z p.G1961E p.C2150R 405 396 12 F 24 White 0.30z 0.18z p.G1961E p.N96D 513 549 13 F 20 White 0.30 0.40 p.G1961E p.N96D 397 355 14 M 25 White 0.00y 0.30 p.G1961E p.Q1003* 322 328 15 M 8.2 White 0.88 0.88 p. Login to comment

[hide] Rescuing Trafficking Mutants of the ATP-binding Ca... J Biol Chem. 2015 Aug 7;290(32):19743-55. doi: 10.1074/jbc.M115.647685. Epub 2015 Jun 19. Sabirzhanova I, Lopes Pacheco M, Rapino D, Grover R, Handa JT, Guggino WB, Cebotaru L
Rescuing Trafficking Mutants of the ATP-binding Cassette Protein, ABCA4, with Small Molecule Correctors as a Treatment for Stargardt Eye Disease.
J Biol Chem. 2015 Aug 7;290(32):19743-55. doi: 10.1074/jbc.M115.647685. Epub 2015 Jun 19., [PMID:26092729]

Abstract [show]
Stargardt disease is the most common form of early onset macular degeneration. Mutations in ABCA4, a member of the ATP-binding cassette (ABC) family, are associated with Stargardt disease. Here, we have examined two disease-causing mutations in the NBD1 region of ABCA4, R1108C, and R1129C, which occur within regions of high similarity with CFTR, another ABC transporter gene, which is associated with cystic fibrosis. We show that R1108C and R1129C are both temperature-sensitive processing mutants that engage the cellular quality control mechanism and show a strong interaction with the chaperone Hsp 27. Both mutant proteins also interact with HDCAC6 and are degraded in the aggresome. We also demonstrate that novel corrector compounds that are being tested as treatment for cystic fibrosis, such as VX-809, can rescue the processing of the ABCA4 mutants, particularly their expression at the cell surface, and can reduce their binding to HDAC6. Thus, our data suggest that VX-809 can potentially be developed as a new therapy for Stargardt disease, for which there is currently no treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Here, we have examined two disease-causing mutations in the NBD1 region of ABCA4, R1108C, and R1129C, which occur within regions of high similarity with CFTR, another ABC transporter gene, which is associated with cystic fibrosis. Login to comment
7 We show that R1108C and R1129C are both temperature-sensitive processing mutants that engage the cellular quality control mechanism and show a strong interaction with the chaperone Hsp 27. Login to comment
52 Two ABCA4 mutations, R1108C and R1129C, were generated using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) with the following oligos: for ABCA4 R1108C forward: TCCTGAAGTATTGCTCAGGCA, complement: TGCCTGAGCAATACTTCAGGA; for R1129C ABCA4 forward: AAGGGGACTGCATTGCCAT, complement: ATGGCAATGCAGTCCCCTT. Login to comment
53 The ABCA4 wild-type (wt), R1108C, and R1129C clones were each subcloned into the pcDNA5/FRT expression vector to generate stably transfected cells. Login to comment
54 Flp-In HEK-293 cells were transfected with pcDNA5/ FRT carrying ABCA4 wt, R1108C, or R1129C according to manufacturer`s protocol (Flp-Inࡊ System, Life Technologies). Login to comment
57 Hygromycin-resistant foci were isolated, expanded, and then analyzed for expression of ABCA4, R1108C, or R1129C by Western blotting. Login to comment
58 Biotinylation-HEK 293 cells stably expressing ABCA4, R1108C, or R1129C were exposed to sulfo-NHS-SS-biotin (Thermo Scientific) for 30 min on ice, rinsed three times with glycine quenching buffer (200 mM glycine and 25 mM Tris/HCl, pH 8.0, in DPBS with calcium and magnesium), and solubilized in lysis buffer (150 mM NaCl, 50 mM Tris/HCl, 1% Nonidet P-40, and protease inhibitors). Login to comment
76 The effect of proteasome, aggresome, and autophagosome inhibitors (MG132, tubacin, and bafilomycin A1, respectively) on wt ABCA4, R1108C, and R1129C mutations was also studied. Login to comment
80 For this study, we focused on two disease-causing mutations in ABCA4, R1108C, and R1129C, both of which are known to be less abundant than the wt (35). Login to comment
85 Fig. 2 shows that the steady-state protein levels of R1108C and R1129C were dramatically increased when cells were grown at reduced temperature. Login to comment
89 Fig. 3 shows that wt ABCA4 protein levels remained relatively constant, whereas the R1108C and R1129C proteins levels were greatly diminished over an 8 h period, indicating that both mutants were unstable and rapidly degraded. Login to comment
91 Although one might predict that blocking proteasomal degradation with MG-132 would lead to an increase in steady-state protein levels, as was seen for wt ABCA4, the steady-state protein expression of R1108C and R1129C actually decreased dramatically after treatment (Fig. 4). Login to comment
93 R1129C was particularly sensitive to tubacin treatment, increasing by nearly 2-fold (Fig. 5); for the R1129C mutant, the expressed protein actually exceeded that of wt ABCA4. Login to comment
94 Only small changes in expressed protein levels occurred following bafilomycin A1 treatment in wt and R1108C ABCA4, whereas the level fell in the R1129C mutant (Fig. 6). Login to comment
101 Two mutations were selected for study (italics/bold), R1108C and R1129C. Login to comment
103 B, HEK-293 cell lines stably expressing wild type (wt) ABCA4, R1108C, or R1129C. Login to comment
104 R1108C and R1129C show a reduced expression of ABCA4 when compared with wt ABCA4. Login to comment
106 Rescuing ABCA4 Trafficking Mutants. AUGUST 7, 2015ߦVOLUME 290ߦNUMBER 32 JOURNAL OF BIOLOGICAL CHEMISTRY 19745 at SEMMELWEIS UNIV OF MEDICINE on December 4, R1108C and R1129C Have Heightened Interactions with Proteins Associated with Their Degradation-Folding of complex proteins such as ABCA4 relies on a series of chaperones. Login to comment
118 Temperature sensitivity of wt ABCA4, R1108C, and R1129C. Login to comment
119 HEK-293 cell lines stably expressing wild type (wt) ABCA4, R1108C, or R1129C were grown continuously at 37 &#b0;C or 27 &#b0;C. Growing cells with R1108C or R1129C at reduced temperature significantly increased the amount of ABCA4 expressed. Login to comment
124 Disappearance of protein from wt ABCA4 and from R1108C and R1129C mutants. Login to comment
125 HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated with cycloheximide (25òe;g/ml) and harvested at 1, 2, 4, 6, or 8 h. The protein expressed from mutations R1108C and R1129C disappeared much faster than that from wt ABCA4 when protein translation was inhibited with cycloheximide, indicating that they are much less stable. Login to comment
128 19746 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290ߦNUMBER 32ߦAUGUST 7, 2015 VCP binding is consistent with the data presented earlier, showing that R1108C and R1129C are preferentially degraded in the aggresome. Login to comment
139 Proteasomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of proteasome inhibitor (MG-132). Login to comment
143 Aggesomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of the aggresome inhibitor tubacin. Login to comment
146 Lysosomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of the proton pump inhibitor of lysosomedegradation bafilomycin A. Login to comment
149 We next applied C3 and noted a more robust response, a nearly 2-fold increase, with the R1129C mutation showing the greatest response (Fig. 10). Login to comment
153 Like C3, another Class I corrector, C18, also produced a robust response, achieving a b03;2-fold maximum increase in protein expression with the R1108C and R1129C mutants (Fig. 12A). Login to comment
158 Quality control protein interactions with ABCA4, R1108C, and R1129C; total lysate (TL), and co-immunoprecipitate (IP). Login to comment
160 As a control, ABCA4 was immunoprecipitated with anti-ABCA4 antibody in the wt, R1108C, and R1129C cell lines. Login to comment
177 Fig. 12B shows that VX-809 was able to rescue both R1108C and R1129C. Login to comment
180 VX-809 Reduces the Interactions of R1108C and R1129C with Proteins Associated with Their Degradation-Figs. Login to comment
183 Interestingly, both correctors reduced the binding of wt (Fig. 16), R1108C (Fig. 17), and R1129C (Fig. 18) to HDAC6. Login to comment
192 It is not surprising that VCP binds to wt ABCA4 FIGURE 9. Effect of C4 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment
194 The greatest effect was on the R1129C mutant. Ezrin was used as the loading control. Login to comment
195 FIGURE 10. Effect of C3 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment
197 The greatest effect was on the wt and the R1129C mutant. Ezrin was used as the loading control. Login to comment
206 The greatest effect was on the wt and the R1129C mutant. Login to comment
212 19750 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290ߦNUMBER 32ߦAUGUST 7, 2015 observations from our experiments here support our contention that R1108C and R1129C are degraded by the aggresome. Login to comment
221 This chaperone bound avidly to both R1108C and R1129C. Login to comment
230 Thus, enhanced HSP 27 binding to the ABCA4 mutants could FIGURE 13. Effect of the combination of C18 d19; C4 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment
232 There was a small effect on the R1129C mutant, but the overall effect was much less pronounced than that of C18 alone. Ezrin was used as the loading control. Login to comment
233 FIGURE 14. Effect of the combination of C18 d19; C3 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment
238 Although the precise defects in the structure of R1108C and R1129C are not known, given the similarity in the way that èc;F508-CFTR and these ABCA4 mutants interact with the cellular quality-control mechanism, we hypothesized that correctors that could rescue èc;F508-CFTR might also rescue R1108C and R1129C. Login to comment
241 FIGURE 15. Effect of VX-809 on the levels of wt ABCA4 and the mutants R1108C and R1129C at the cell surface.Note that treatment produced an increase in protein expression at the cell surface. Login to comment
260 FIGURE 18. Effect of C18 and VX-809 on the binding of wt and mutant R1129C to Hsp 27 and HDAC6; total lysate (TL) and co-immunoprecipitate (IP). Login to comment
261 HEK 293 cell lines expressing R1129C were treated with C18 or VX-809, and ABCA4 was immunoprecipitated with anti-ABCA4 antibody as a control. Login to comment
268 Thus, increased plasma membrane levels of both R1108C and R1129C suggests that the restoration of protein stability by VX-809 is sufficient to allow the mutant proteins to pass or avoid the checkpoints, and proceed to the plasma membrane. Login to comment
275 We show that R1108C and R1129C in NBD1 are both temperature-sensitive processing mutants that engage the cellular quality control mechanism via a strong interaction with the chaperone Hsp 27. Login to comment