ABCMdb

PMID: 24777605

Lee S, Henderson MJ, Schiffhauer E, Despanie J, Henry K, Kang PW, Walker D, McClure ML, Wilson L, Sorscher EJ, Zeitlin PL
Interference with ubiquitination in CFTR modifies stability of core glycosylated and cell surface pools.
Mol Cell Biol. 2014 Jul;34(14):2554-65., [PubMed]

Sentences

No. Mutations Sentence Comment

5 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg N-tail mutants, K14R and K68R, lead to increased mature band C CFTR, which can be augmented by proteasomal (but not lysosomal) inhibition, allowing trafficking to the surface. Login to comment 6 ABCC7 p.Lys1041Arg The amount of CFTR in the K1041R mutant was drastically reduced and consisted of bands A/B, suggesting that the site in transmembrane 10 (TM10) was critical to further processing beyond the proteasome. Login to comment 7 ABCC7 p.Lys1218Arg The K1218R mutant increases total and cell surface CFTR, which is further accumulated by proteasomal and lysosomal inhibition. Login to comment 24 ABCC7 p.Trp1282* CFTR cDNA vectors were studied in immortalized human airway epithelial cells (IB3-1; F508del/W1282X heterozygous mutation in CFTR) (14), which were cultured in LHC-8 medium (Gibco, Grand Island, NY) containing 10% fetal bovine serum (FBS) and 1% antibiotic/antimycotic at 37&#b0;C in 4% CO2. Login to comment 73 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg We hypothe- TABLE 1 Primers for site-directed mutagenesis Mutation Directiona Sequence (5=-3=)b K14R F GGCCAGCGTTGTCTCCAGACTTTTTTTCAGCTGGACC R GGTCCAGCTGAAAAAAAGTCTGGAGACAACGCTGGCC K68R F GGCTTCAAAGAAAAATCCTAGACTCATTAATGCCCTTCGGCG R CGCCGAAGGGCATTAATGAGTCTAGGATTTTTCTTTGAAGCC K710R F CCAATCAACTCTATACGAAGATTTTCCATTGTGCAAAAG R CTTTTGCACAATGGAAAATCTTCGTATAGAGTTGATTGG K716R F GAAAATTTTCCATTGTGCAAAGGACTCCCTTACAAATGAATGG R CCATTCATTTGTAAGGGAGTCCTTTGCACAATGGAAAATTTTC K710/716R F CCAATCAACTCTATACGAAGATTTTCCATTGTGCAAAGGACTCCCTTACAAATGAATGG R CCATTCATTTGTAAGGGAGTCCTTTGCACAATGGAAAATCTTCGTATAGAGTTGATTGG K1041R F CCTCACAGCAATTCAGACAACTGGAATCTGAAG R CTTCAGATTCCAGTTGTCTGAGTTGCTGTGAGG K1080R F GAAACTCTGTTCCACAGAGCTCTGAATTTACATAC R GTATGTAAATTCAGAGCTCTGTGGAACAGAGTTTC K1218R F GATCTCACAGCAAGATACACAGAAGG R CCTTCTGTGTATCTTGCTGTGAGATC a F, forward; R, reverse. Login to comment 75 ABCC7 p.Lys710Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys716Arg sized that ubiquitin might be required at these sites to stabilize the nascent protein, and the residues were mutated to arginine (K710R or K716R and the double mutant K710R K716R [K710/ 716R]). Login to comment 78 ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg Interestingly, small perturbations in the predicted structure were seen with the K710R or K716R mutation alone but not when both residues were mutated in the same vector. Login to comment 81 ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg At steady state and 37&#b0;C, the K710R and K716R mutations decrease the level of CFTR C band expression in whole-cell lysates, which suggests that the normally ubiquitinated K710 and K716 residues might be required to help process CFTR beyond the Golgi compartment (Fig. 2B). Login to comment 86 ABCC7 p.Lys1041Arg ABCC7 p.Lys1080Arg We generated K1041R and K1080R mutants and expressed them in IB3-1. Login to comment 89 ABCC7 p.Lys1041Arg Interference with residue 1080 drastically reduced CFTR but, in contrast to the K1041R mutation, significant band C continued to appear, similar to results with the R domain mutants. Login to comment 90 ABCC7 p.Lys1041Arg C-band expression was quantified by densitometry, as shown in Fig. 2B, and K1041R was the lowest although band B expression was higher than in the wt, further supporting a maturational block after band B and before C. Login to comment 97 ABCC7 p.Lys68Arg Lysine-to-arginine mutations caused minor changes in CFTR conformation, except for the K68R mutation which caused changes in the orientation of third alpha helix, where 68R is located (Fig. 3A). Login to comment 99 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg K14R and K68R mutations result in increased levels of immature (A/B band) and mature (C band) forms of CFTR expression (Fig. 2B). Login to comment 102 ABCC7 p.Lys1218Arg The K1218R mutation increases CFTR B and C bands even more significantly than N-tail mutants (Fig. 2B). Login to comment 104 ABCC7 p.Lys1041Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg The observed reduction in expression of K710R, K716R, K710/ 716R, K1041R, and K1080R CFTRs might be the consequence of disordered conformational structure or folding/assembly. Login to comment 106 ABCC7 p.Lys1041Arg The data in Fig. 3B show similar patterns of proteolytic digestion for wt and mutant CFTR; K1041R is the only mutant which shows significantly less CFTR at the final trypsin concentration. Login to comment 117 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg To test this hypothesis for K14R and K68R, we expressed these N-tail mutants in the presence and absence of proteasomal inhibition. Login to comment 119 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg 4A), but proteasome inhibition during expression of the K14R and K68R mutant CFTR cDNAs led to even higher expression levels. Login to comment 130 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg This immunoblot demonstrates increased levels of band C CFTR expression from the K14R, K68R, and K1218R cDNA vectors and decreased levels of band C CFTR expression in K710R, K716R, K710/716R, and K1080R vectors. Login to comment 131 ABCC7 p.Lys1041Arg At steady state, the K1041R mutation in TM10 is almost completely lacking band C CFTR expression. Login to comment 135 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg However, unexpectedly, expression levels in K14R- and K68R- transfected cells were not increased by lysosomal inhibition, perhaps because they were already slow to recycle. Login to comment 136 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg Densitometry analysis showed that a proteasomal inhibitor increased C bands of wt, K14R, and K68R compared to control levels, but changes in A/B bands were insignificant. Login to comment 137 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg Lysosomal inhibitor did not change C bands, but A/B bands of K14R and K68R were decreased compared to control levels. Login to comment 138 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg These data suggest that K14R and K68R mutations allow CFTR to bypass the lysosome for degradation so that preventing lysosomal activity does not further increase the expression level of the mutant compared to wild-type CFTR. Login to comment 139 ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg We also expressed each of the R domain mutants (K710R, K716R, and K710/716R) during inhibition with MG132 and E64/ pepstatin A. Login to comment 140 ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg Treatment with MG132 did not significantly increase A/B/C bands in the mutants, suggesting that K710R and K716R were not able to improve trafficking just because premature degradation was blocked and/or because lysosomal degradation was accelerated (Fig. 4B). Login to comment 144 ABCC7 p.Lys68Arg A K-to-R mutation does not alter the conformational structure of each domain except for the K68R mutant. Login to comment 151 ABCC7 p.Lys1041Arg The K1041R mutant was included to highlight the differences that will be explored further. Login to comment 156 ABCC7 p.Lys1041Arg Interestingly, MG132 treatment rescued only B band expression in the K1041R mutant form of CFTR, but this was not sufficient for trafficking beyond the ER. Login to comment 157 ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg K1080R and K1218R mutants displayed both bands B and C after proteasomal inhibition. Login to comment 158 ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg This supports the hypothesis that the K1080R and K1218R mutants undergo the same degree of proteasomal degradation as wild-type CFTR and are still trafficked. Login to comment 159 ABCC7 p.Lys1041Arg ABCC7 p.Lys1080Arg Prevention of proteolysis at the lysosome accumulates more C band K1041R and K1080R. Login to comment 163 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg (A) The results from expression of control vector, wt CFTR, K14R, and K68R with and without proteasomal or lysosomal inhibition are shown in representative blots. Login to comment 164 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg MG132 increased total A/B/C bands of CFTR in wild-type, K14R, and K68R proteins. Login to comment 166 ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg (B) The results from expression of control vector, wt CFTR, K710R, K716R, and K710/716R with and without proteasomal or lysosomal inhibition are shown in representative blots, similar to the results show in panel A. MG132 increased wt CFTR band C as expected but did not affect band C of the mutants. Login to comment 169 ABCC7 p.Lys1041Arg ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg (C) The results from expression of control vector, wt CFTR, K1041R, K1080R, and K1218R with and without proteasomal or lysosomal inhibition are shown in representative blots similar to the results show in panel A. MG132 rescues band B from K1041R to some extent, as well as a small portion of band C. Login to comment 170 ABCC7 p.Lys1080Arg Lysosomal inhibition recovers some band C. K1080R is rescued by both MG132 and lysosome inhibition. Login to comment 171 ABCC7 p.Lys1218Arg K1218R shows the most robust rescue by both. Login to comment 174 ABCC7 p.Lys1218Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg pression of K1080R C band and improved the K1218R mutant, indicating that the K1218R mutant can avoid lysosomal degradation. Login to comment 175 ABCC7 p.Lys1041Arg ABCC7 p.Lys1080Arg Therefore, these data suggest that K1041R and K1080R mutants are degraded at the proteasome and lysosome, respectively. Login to comment 177 ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg K710R and K716R CFTRs reduce K63-linked polyubiquitination. Login to comment 183 ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg Using an antibody specific for K63-linked polyubiquitin, we show that immunopurified CFTR has visibly less K63-linked polyubiquitination in the K710R and K716R mutants than the wild type (Fig. 5). Login to comment 185 ABCC7 p.Lys1041Arg For K1041R the reduced Ub-K63 immunoblot signal likely derives from the reduced amount of immunoprecipitated product. Login to comment 191 ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg The K710R, K716R, and K710/716R mutants showed faster degradation of the C band of CFTR than the wild type and K1218R. Login to comment 193 ABCC7 p.Lys1218Arg ABCC7 p.Lys1218Arg The initial expression level of K1218R is higher than that of wt CFTR, and the degradation rate of K1218R is similar to that of the wt CFTR. Login to comment 194 ABCC7 p.Lys14Arg ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg K14R, K1080R, and K1218R but not K1041R reach the cell surface. Login to comment 200 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg There were decreased levels of cell surface CFTR detection in the K68R, K710R, K716R, K710/ K716R, and K1041R mutant forms of CFTR, but the wild-type, K14R, K1080R, and K1218R mutants accumulated similar levels of visible cell surface CFTR. Login to comment 201 ABCC7 p.Lys68Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys1080Arg Analysis of the Z stack of images for the wild type, K68R, K710R, K1080R, and K1218R confirmed that the CFTR immunostaining, shown in red, resided at the apical surface in these nonpermeabilized cells (data not shown). Login to comment 207 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg Again, there was a reduction in immunodetectable CFTR (K14R, K68R, K710R, K716R, K710/716R, and K1080R forms) in cell surface membranes compared to wild-type levels. Login to comment 208 ABCC7 p.Lys1218Arg As expected, increased amounts of K1218R were detected from the cell surface fraction (Fig. Login to comment 213 ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg These data demonstrate that by preventing ubiquitination at K710R and K716R, the CFTR mutants are then degraded in the lysosome. Login to comment 214 ABCC7 p.Lys14Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg Preventing ubiquitination at K14R, K1080R, and K1218R allows the mutant protein to gain access to the cell surface. Login to comment 215 ABCC7 p.Lys1041Arg On the other hand, prevention of ubiquitination at 1041 by making the K1041R construct promotes degradation primarily by the proteasome. Login to comment 218 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg Control vector, wt CFTR, K14R, K68R, K710R, K716R, K710/716R, K1041R, K1080R, and K1218R were expressed in IB3-1 cells for 48 h. CFTR was immunoprecipitated (IP) with M3A7 as described in Materials and Methods and separated by SDS-PAGE. Login to comment 221 ABCC7 p.Lys68Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg K63-linked ubiquitin on CFTR is reduced in the K68R, K710R, K716R, and K1218R mutants. Login to comment 222 ABCC7 p.Lys1080Arg K-63-linked ubiquitin appears to be increased in the K1080R mutant. Login to comment 226 ABCC7 p.Lys14Arg ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg FIG 6 K-to-R mutation alters the stability of CFTR protein, and wt CFTR, K14R, K1080R, and K1218R, but not K1041R, are detectable at the cell surface. Login to comment 230 ABCC7 p.Lys1218Arg Wild-type and K1218R CFTR maintain the highest stability with little turnover in 24 h. Login to comment 236 ABCC7 p.Lys1041Arg As expected, CFTR is virtually undetectable in cells expressing control vector or K1041R. Login to comment 237 ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg CFTR is easily detected HDAC6 must interact with CFTR to promote trafficking beyond the ER, then we predict that K1041R would interact preferentially with VCP and that K1218R would interact preferentially with HDAC6. Login to comment 241 ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg HDAC6 was abundant in all cases, and ZO-1 was conspicuously absent from the K1080R and K1218R mutants. Login to comment 247 ABCC7 p.Lys1218Arg K1218R is the most interesting construct since this mutant CFTR does better than the wild type in remaining at the cell surface in large-mass quantities. Login to comment 252 ABCC7 p.Lys14Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg The F508del from the surface of cells expressing wt CFTR, K14R, K1080R, and K1218R. Login to comment 253 ABCC7 p.Lys68Arg A lighter signal is visible from cells expressing K68R and the R domain mutants. Login to comment 261 ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg Band C was most reduced in K1041R and highest in the wt, K1080R, and K1218R, consistent with data in panels A and B. Login to comment 267 ABCC7 p.Lys1218Arg Cell surface band C, prominent for wt CFTR and K1218R located on the PM, was unaffected by MG132 and increased by lysosomal inhibition. Login to comment 268 ABCC7 p.Lys1041Arg Interestingly, higher-molecular-weight forms of K1041R were pulled down from the biotinylated surfaces of cells treated with proteasomal or lysosomal inhibition. Login to comment 269 ABCC7 p.Lys1218Arg A similar pattern was seen with lysosomal inhibition of cells expressing K1218R, suggesting that there is a ubiquitination step between the cell surface and the lysosome occurring through an alternate site. Login to comment 274 ABCC7 p.Lys1218Arg ABCC7 p.Lys1080Arg We did not detect ZO-1 in the K1080R or K1218R complex. Login to comment 275 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg Since ZO-1 interacts with PDZ domains, the reduced interactions in K14R, K68R, K710R, K716R, K710/716R, and K1041R and the absence of interactions with K1080R and K1218R raise the issue of alternative trafficking routes that are not dependent on the C-tail PDZ domain. Login to comment 278 ABCC7 p.Lys1041Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg Poly- or monoubiquitination in K14, K68, K710, K716, 1041, K1080, and K1218 sites allows CFTR to pass through its regular quality control process, producing adequate band C. K710R, K716R, K710/K716R, and K1080R mutants undergo some proteasome- and some lysosome-dependent degradation, whereas K1041R is primarily degraded by the proteasome. Login to comment 279 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg K14R and K68R experience some proteasome degradation, but a sizeable fraction is localized near the plasma membrane. Login to comment 280 ABCC7 p.Lys1218Arg K1218R bypasses the proteasome fairly efficiently and further is slow to undergo lysosomal degradation. Login to comment 296 ABCC7 p.Lys68Arg ABCC7 p.Lys14Arg ABCC7 p.Lys1041Arg ABCC7 p.Lys1218Arg ABCC7 p.Lys710Arg ABCC7 p.Lys716Arg ABCC7 p.Lys1080Arg Interestingly, ZO-1 was highly abundant in complexes formed with wt CFTR; K14R, K68R, K710R, K716R, K710/716R, and K1041R mutants bound less ZO-1, whereas K1080R and K1218R mutant complexes had none. Login to comment 297 ABCC7 p.Lys1080Arg This result indicates that interrupting ubiquitination of CFTR in lysine residue 1218 weakens its interaction with ZO-1 complex and that this decreased affinity to PDZ binding proteins might decelerate the degradative pathway, whereas reduced interaction with ZO-1 in the K1080R mutant accelerated degradation. Login to comment 300 ABCC7 p.Lys710* ABCC7 p.Lys68Glu ABCC7 p.Lys68Asn ABCC7 p.Lys14* ABCC7 p.Lys1080Arg ABCC7 p.Lys1080Ile ABCC7 p.Lys1080Gln Table 3 lists the findings: K14X (stop), K68E, K68N, K710X (stop), K1080Q, K1080R, and K1080I mutations already exist in human genes. Login to comment 302 ABCC7 p.Lys1080Arg The missense mutants may resemble ours, such as the K1080R mutant. Login to comment 303 ABCC7 p.Lys1080Arg It is also interesting that the K1080R mutant is capable of C band expression. Login to comment