ABCMdb

PMID: 24366667

Donmez Cakil Y, Khunweeraphong N, Parveen Z, Schmid D, Artaker M, Ecker GF, Sitte HH, Pusch O, Stockner T, Chiba P
Pore-exposed tyrosine residues of P-glycoprotein are important hydrogen-bonding partners for drugs.
Mol Pharmacol. 2014 Mar;85(3):420-8. doi: 10.1124/mol.113.088526. Epub 2013 Dec 23., [PubMed]

Sentences

No. Mutations Sentence Comment

53 ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr307Phe ABCB1 p.Tyr307Phe ABCB1 p.Tyr307Phe ABCB1 p.Tyr307Phe ABCB1 p.Tyr307Phe ABCB1 p.Tyr307Phe ABCB1 p.Tyr310Phe ABCB1 p.Tyr310Phe ABCB1 p.Tyr310Phe ABCB1 p.Tyr310Phe ABCB1 p.Tyr310Phe ABCB1 p.Tyr310Phe Construction of P-gp Mutants The following primers were used for generation of the Y307F, Y310F, Y307F/Y310F, Y950F, Y953F, and Y950F/Y953F mutations of hexa-His-tagged human P-gp in the entry vector pENTR4: Y307F- forward, 59-CTTTCCTGCTGATCTTTGCATCTTATGCTCTGGCC-39; Y307F-reverse, 59-GGCCAGAGCATAAGATGCAAAGATCAGCAGG AAAG-39; Y310F-forward, 59-CTTTCCTGCTGATCTATGCATCTTT TGCTCTGGCC-39; Y310F-reverse, 59-GGCCAGAGCAAAAGATGCA- TAGATCAGCAGGAAAG-39; Y307F/Y310F-forward, 59-CTTTCCTG CTGATCTTTGCATCTTTTGCTCTGGCC-39; Y307F/Y310F-reverse, 59-GGCCAGAGCAAAAGATGCAAAGATCAGCAGGAAAG-39; Y950F- forward, 59-TCACCCAGGCAATGATGTTTTTTTCCTATGCTGGATG- 39; Y950F-reverse, 59-CATCCAGCATAGGAAAAAAACATCATTGCC TGGGTGA-39; Y953F-forward, 59-ACCCAGGCAATGATGTATTTTT CCTTTGCTGGATGTTTC-39; Y953F-reverse, 59-GAAACATCCAGCAAA GGAAAAATACATCATTGCCTGGGT-39; Y950F/Y953F-forward, 59-CCTT CACCCAGGCAATGATGTTTTTTTCCTTTGCTGGATGTTTCC -39; and Y950F/Y953F-reverse, 59-GGAAACATCCAGCAAAGGAAAAAAACATCA TTGCCTGGGTGAAGG-39. Login to comment 54 ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg ABCB1 p.Gln773Arg ABCB1 p.Gln773Arg ABCB1 p.Gln773Arg Furthermore, Q132R and Q773R mutations were introduced to the constructs above by using the following: Q132R- forward, 59-GCTGCTTACATTCGTGTTTCATTTTG-39; Q132R-reverse, 59- CAAAATGAAACACGAATGTAAGCAGC-39; Q773R-forward, 59-CAT TTTTCCTTCGAGGTTTCACATTTG-39; and Q773R-reverse, 59-CA TTTTTCCTTCGAGGTTTCACATTTG-39. Login to comment 114 ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Gln132Arg ABCB1 p.Gln773Arg ABCB1 p.Tyr307Phe ABCB1 p.Tyr310Phe All mutants were detected at the plasma membrane, although the expression levels of Q132R/Y950F, Q773R/Y950F, and Y307F/Y310F were reduced (Supplemental Fig. 5). Login to comment 117 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe Mutant Y950F showed a similar transport rate as wild-type protein, whereas mutant Y953F showed a significantly decreased rate (54% 6 12% of wild-type) (Fig. 2). Login to comment 118 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe The double mutant Y950F/Y953F showed a decrease that was comparable with that observed for the Y953F single mutant alone. Login to comment 120 ABCB1 p.Gln132Arg ABCB1 p.Gln773Arg Access of rh123 to binding sites 1 and 2 can be controlled by the introduction of positive charges (arginines) in the access path to the ligand binding sites. We previously showed that the Q132R mutation blocks access to site 2 for rh123, whereas the Q773R mutation prevents rh123 access to site 1 (Parveen et al., 2011). Login to comment 121 ABCB1 p.Tyr953Phe The effect of the Y953F mutation on rh123 efflux should be abolished by introducing selector residue R132 and should be more pronounced when deselecting site 1 by introducing selector residue R773. Login to comment 125 ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg This is illustrated by comparable transport activity of the Q132R/Y950F, Q132R/Y953F, and Q132R/ Y950F/Y953F mutants. Login to comment 128 ABCB1 p.Tyr953Phe ABCB1 p.Gln773Arg ABCB1 p.Gln773Arg By contrast, transport rates were found to be lower in the Q773R/Y953F mutant compared with the Q773R mutant alone, although this decrease did not reach statistical significance. Login to comment 129 ABCB1 p.Tyr950Phe Indeed, no decrease in transport activity was observed for the Y950F mutant introduced in the R773 background. Login to comment 137 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Gln773Arg Q773R/Y950F/Y953F was expressed at the surface, but no rh123 efflux was detectable. Login to comment 146 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe The wild-type showed an IC50 value of 518 6 141 nM, whereas the values for the single mutants Y950F and Y953F were 1348 6 229 and 1207 6 362 nM, respectively. Login to comment 148 ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe An analogous pattern was seen for GPV031 (wild-type, 85 6 22 nM; Y950F, 238 6 84 nM; Y953F, 287 6 109 nM; and Y950F/Y953F, 630 6 87 nM) (Fig. 3C). Login to comment 152 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe In contrast with protonatable propafenones, a higher IC50 value was observed for the Y953F, but not for the Y950F, single mutant. Login to comment 153 ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe The fold change for the double mutant was comparable with that observed for the Y953F single mutant (wild-type, 2239 6 391 nM; Y950F, 2984 6 79 nM, n.s.; Y953F, 15,946 6 2941 nM, 7.1-fold change relative to wild-type; and Y950F/Y953F, 17,819 6 2106 nM, 8-fold change). Login to comment 155 ABCB1 p.Gln132Arg The at least 3-fold difference in IC50 values for wild-type protein (GPV005, 518 6 141 nM; and GPV031, 85 6 22 nM) (Fig. 3, B and C) and the Q132R mutant (GPV005, 1414 6 215 nM; and GPV031, 521 6 183 nM) (Fig. 4, A and B) demonstrates that an arginine residue in position 132 prevents access of protonatable compounds to site 2. Login to comment 159 ABCB1 p.Tyr950Phe ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe (A) Open diamonds, wild-type; filled circles, Y950F/Y953F; triangles, Y950F; squares, Y953F. Login to comment 163 ABCB1 p.Tyr950Phe ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg show that for the Q132R/Y950F mutant, IC50 values were similar to those observed in the Q132R background alone. Login to comment 164 ABCB1 p.Tyr953Phe ABCB1 p.Gln132Arg However, IC50 values were still higher in the Q132R/Y953F mutation. Login to comment 168 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Tyr953Phe ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg For the nonprotonatable acid amide GPV366, a higher IC50 value was observed in the Q132R/Y953F mutant (Q132R, 1074 6 282 nM; and Q132R/Y953F, 3261 6 965 nM), whereas the Y950F mutation in the same background did not affect potency (966 6 259 nM) (Fig. 4C). Login to comment 169 ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg Although the pattern was similar to that observed in the wild-type background, the fold change was lower in the Q132R background and the IC50 value was somewhat lower in the protein containing the Q132R mutation than for wild-type. Login to comment 170 ABCB1 p.Gln132Arg A possible explanation for this effect is the lack of competition of GPV366 in the preferred binding site 2 with rh123, because rh123 binding to site 2 is abolished by the Q132R mutation. Login to comment 171 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Gln132Arg The higher IC50 values in the Q132R/Y950F/Y953F mutant were not due to an additive effect of the two tyrosine mutations on binding of propafenones. Login to comment 173 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg Certainly, the effect is not brought about by a global perturbance of protein structure and function, because the Q132R mutant and the Q132R/Y950F/Y953F triple mutant showed comparable rh123 transport rates (Fig. 2). Login to comment 189 ABCB1 p.Gln132Arg The tyrosine mutants were generated in the Q132R mutation background. Login to comment 191 ABCB1 p.Gln132Arg *P , 0.05; **P , 0.01; ***P , 0.001, compared with Q132R mutation. Login to comment 192 ABCB1 p.Gln773Arg rates in the wild-type and the Q773R backgrounds was observed. Login to comment 193 ABCB1 p.Tyr953Phe ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg Identical transport rates were found for the Q132R and the Y953F mutants in the Q132R background. Login to comment 198 ABCB1 p.Tyr953Phe As expected, the double mutant showed an IC50 value that was comparable with that of the Y953F mutant. Login to comment 200 ABCB1 p.Gln132Arg IC50 values were therefore expected to be the same in single and double tyrosine mutants generated in the Q132R background. Login to comment 201 ABCB1 p.Tyr950Phe ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg Indeed, no difference was observed between the Q132R single mutant and the Q132R/Y950F double mutant. Login to comment 202 ABCB1 p.Tyr953Phe However, higher IC50 values were found for the Y953F mutant, although less pronounced than in the wild-type background. Login to comment 205 ABCB1 p.Gln132Arg The uncharged ligand species can still have access to site 2, which has been deselected for the protonated ligand species by introducing the Q132R mutation. Login to comment 212 ABCB1 p.Tyr953Phe ABCB1 p.Gln132Arg ABCB1 p.Gln132Arg For GPV005, mutant Q132R/Y953F showed a 1.5-fold higher IC50 value than the Q132R mutation, whereas the fold changes were 2.1-fold for GPV031 and 3.0-fold for uncharged GPV366. Login to comment 214 ABCB1 p.Gln132Arg However, such an effect was not observed in the Q132R background (Fig. 4, A and B). Login to comment 217 ABCB1 p.Tyr950Phe ABCB1 p.Tyr953Phe ABCB1 p.Gln132Arg The triple Q132R/Y950F/Y953F mutant showed a further increase in IC50 values for all compounds, which is obviously not due to interaction with tyrosines. Login to comment 246 ABCB4 p.Tyr949Ala The Y949A mutation increased toxicity by colchicine and adriamycin, the Y946A made cells more sensitive to vinblastine, and both mutants increased sensitivity toward actinomycin D. Login to comment 248 ABCB1 p.Tyr953Ala Loo and Clarke (2000) demonstrated altered ATPase stimulation of the human protein for the Y953A mutant by verapamil, colchicine, and vinblastine, but did not present evidence for a direct involvement in drug binding. Login to comment